ID: 1077298258

View in Genome Browser
Species Human (GRCh38)
Location 11:1835978-1836000
Sequence CAGCGGGGCCCTTCACCTCC TGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 3878
Summary {0: 1, 1: 0, 2: 12, 3: 2918, 4: 947}

Found 10 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1077298258_1077298271 22 Left 1077298258 11:1835978-1836000 CCAGGAGGTGAAGGGCCCCGCTG 0: 1
1: 0
2: 12
3: 2918
4: 947
Right 1077298271 11:1836023-1836045 GTTTCCGGAAAGGGTGACGGGGG 0: 1
1: 0
2: 0
3: 0
4: 74
1077298258_1077298260 -9 Left 1077298258 11:1835978-1836000 CCAGGAGGTGAAGGGCCCCGCTG 0: 1
1: 0
2: 12
3: 2918
4: 947
Right 1077298260 11:1835992-1836014 GCCCCGCTGCGCAGGACCAGCGG 0: 1
1: 0
2: 1
3: 9
4: 129
1077298258_1077298265 7 Left 1077298258 11:1835978-1836000 CCAGGAGGTGAAGGGCCCCGCTG 0: 1
1: 0
2: 12
3: 2918
4: 947
Right 1077298265 11:1836008-1836030 CCAGCGGTTCTGCGAGTTTCCGG 0: 1
1: 0
2: 1
3: 3
4: 62
1077298258_1077298270 21 Left 1077298258 11:1835978-1836000 CCAGGAGGTGAAGGGCCCCGCTG 0: 1
1: 0
2: 12
3: 2918
4: 947
Right 1077298270 11:1836022-1836044 AGTTTCCGGAAAGGGTGACGGGG 0: 1
1: 0
2: 0
3: 3
4: 61
1077298258_1077298268 19 Left 1077298258 11:1835978-1836000 CCAGGAGGTGAAGGGCCCCGCTG 0: 1
1: 0
2: 12
3: 2918
4: 947
Right 1077298268 11:1836020-1836042 CGAGTTTCCGGAAAGGGTGACGG 0: 1
1: 0
2: 0
3: 2
4: 57
1077298258_1077298266 12 Left 1077298258 11:1835978-1836000 CCAGGAGGTGAAGGGCCCCGCTG 0: 1
1: 0
2: 12
3: 2918
4: 947
Right 1077298266 11:1836013-1836035 GGTTCTGCGAGTTTCCGGAAAGG 0: 1
1: 0
2: 0
3: 5
4: 52
1077298258_1077298274 27 Left 1077298258 11:1835978-1836000 CCAGGAGGTGAAGGGCCCCGCTG 0: 1
1: 0
2: 12
3: 2918
4: 947
Right 1077298274 11:1836028-1836050 CGGAAAGGGTGACGGGGGAAGGG 0: 1
1: 0
2: 1
3: 29
4: 352
1077298258_1077298267 13 Left 1077298258 11:1835978-1836000 CCAGGAGGTGAAGGGCCCCGCTG 0: 1
1: 0
2: 12
3: 2918
4: 947
Right 1077298267 11:1836014-1836036 GTTCTGCGAGTTTCCGGAAAGGG 0: 1
1: 0
2: 0
3: 2
4: 53
1077298258_1077298269 20 Left 1077298258 11:1835978-1836000 CCAGGAGGTGAAGGGCCCCGCTG 0: 1
1: 0
2: 12
3: 2918
4: 947
Right 1077298269 11:1836021-1836043 GAGTTTCCGGAAAGGGTGACGGG 0: 1
1: 0
2: 0
3: 7
4: 94
1077298258_1077298273 26 Left 1077298258 11:1835978-1836000 CCAGGAGGTGAAGGGCCCCGCTG 0: 1
1: 0
2: 12
3: 2918
4: 947
Right 1077298273 11:1836027-1836049 CCGGAAAGGGTGACGGGGGAAGG 0: 1
1: 0
2: 1
3: 14
4: 273

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1077298258 Original CRISPR CAGCGGGGCCCTTCACCTCC TGG (reversed) Exonic
Too many off-targets to display for this crispr