ID: 1077298770

View in Genome Browser
Species Human (GRCh38)
Location 11:1837876-1837898
Sequence CCTTCCCTGCATGAGCAGCA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1077298761_1077298770 8 Left 1077298761 11:1837845-1837867 CCCCAACACCTCAGAGACCTGTG No data
Right 1077298770 11:1837876-1837898 CCTTCCCTGCATGAGCAGCAGGG No data
1077298762_1077298770 7 Left 1077298762 11:1837846-1837868 CCCAACACCTCAGAGACCTGTGC No data
Right 1077298770 11:1837876-1837898 CCTTCCCTGCATGAGCAGCAGGG No data
1077298760_1077298770 9 Left 1077298760 11:1837844-1837866 CCCCCAACACCTCAGAGACCTGT No data
Right 1077298770 11:1837876-1837898 CCTTCCCTGCATGAGCAGCAGGG No data
1077298765_1077298770 0 Left 1077298765 11:1837853-1837875 CCTCAGAGACCTGTGCTGCAGGG No data
Right 1077298770 11:1837876-1837898 CCTTCCCTGCATGAGCAGCAGGG No data
1077298767_1077298770 -9 Left 1077298767 11:1837862-1837884 CCTGTGCTGCAGGGCCTTCCCTG No data
Right 1077298770 11:1837876-1837898 CCTTCCCTGCATGAGCAGCAGGG No data
1077298763_1077298770 6 Left 1077298763 11:1837847-1837869 CCAACACCTCAGAGACCTGTGCT No data
Right 1077298770 11:1837876-1837898 CCTTCCCTGCATGAGCAGCAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1077298770 Original CRISPR CCTTCCCTGCATGAGCAGCA GGG Intergenic
No off target data available for this crispr