ID: 1077299755

View in Genome Browser
Species Human (GRCh38)
Location 11:1841489-1841511
Sequence AAGAACATCGAGGAGAAGTC TGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 156
Summary {0: 1, 1: 0, 2: 0, 3: 5, 4: 150}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1077299748_1077299755 16 Left 1077299748 11:1841450-1841472 CCACAGGAGCGGGACCTGCGAGA 0: 1
1: 0
2: 0
3: 7
4: 93
Right 1077299755 11:1841489-1841511 AAGAACATCGAGGAGAAGTCTGG 0: 1
1: 0
2: 0
3: 5
4: 150
1077299752_1077299755 2 Left 1077299752 11:1841464-1841486 CCTGCGAGACGTGGGTGACTGGA 0: 1
1: 0
2: 0
3: 2
4: 55
Right 1077299755 11:1841489-1841511 AAGAACATCGAGGAGAAGTCTGG 0: 1
1: 0
2: 0
3: 5
4: 150
1077299747_1077299755 19 Left 1077299747 11:1841447-1841469 CCTCCACAGGAGCGGGACCTGCG 0: 1
1: 0
2: 2
3: 14
4: 84
Right 1077299755 11:1841489-1841511 AAGAACATCGAGGAGAAGTCTGG 0: 1
1: 0
2: 0
3: 5
4: 150
1077299745_1077299755 25 Left 1077299745 11:1841441-1841463 CCCTCTCCTCCACAGGAGCGGGA 0: 1
1: 0
2: 1
3: 20
4: 177
Right 1077299755 11:1841489-1841511 AAGAACATCGAGGAGAAGTCTGG 0: 1
1: 0
2: 0
3: 5
4: 150
1077299742_1077299755 29 Left 1077299742 11:1841437-1841459 CCTGCCCTCTCCTCCACAGGAGC 0: 1
1: 0
2: 7
3: 59
4: 528
Right 1077299755 11:1841489-1841511 AAGAACATCGAGGAGAAGTCTGG 0: 1
1: 0
2: 0
3: 5
4: 150
1077299746_1077299755 24 Left 1077299746 11:1841442-1841464 CCTCTCCTCCACAGGAGCGGGAC 0: 1
1: 0
2: 0
3: 27
4: 294
Right 1077299755 11:1841489-1841511 AAGAACATCGAGGAGAAGTCTGG 0: 1
1: 0
2: 0
3: 5
4: 150

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1077299755 Original CRISPR AAGAACATCGAGGAGAAGTC TGG Exonic
903748091 1:25602177-25602199 AAGAACCTGGAGCAGAGGTCTGG + Intergenic
903992523 1:27283605-27283627 AAGAACATGGAAGAGAAATGAGG - Intronic
905977956 1:42193378-42193400 AGGAACATCGATAGGAAGTCTGG - Intronic
907830673 1:58061402-58061424 AAGAAGCTAGAGGAGAAGCCTGG - Intronic
908793390 1:67805215-67805237 AGGAACATGGAGGTGAAGTGTGG - Intronic
909507076 1:76404542-76404564 AAGAACATCAAGGAGAATAAAGG + Intronic
913581077 1:120227447-120227469 AAGGACATCGAGGAGACTGCTGG - Intergenic
913627099 1:120670953-120670975 AAGGACATCGAGGAGACTGCTGG + Intergenic
914563007 1:148838884-148838906 AAGGACATCGAGGAGACTGCTGG - Intronic
914609820 1:149291339-149291361 AAGGACATCGAGGAGACTGCTGG + Intergenic
914926222 1:151890535-151890557 GAGAAGATCCAGGAGAAGTGGGG + Intronic
916488592 1:165281025-165281047 CAGAACATGGAGAAGTAGTCTGG + Intronic
919631850 1:199966972-199966994 AAGAAAATGGAGAAGAAGCCAGG + Intergenic
920737969 1:208552584-208552606 GAGAACATCCAGGAGAGCTCAGG + Intergenic
922152225 1:223016425-223016447 AAGAACATCACTGAGAAGTATGG + Intergenic
924014349 1:239704169-239704191 AAGAACATTGAAGATAATTCAGG + Intronic
924812301 1:247414063-247414085 AAGAAAATAGAGAAGAAGCCAGG - Intergenic
1063253003 10:4294716-4294738 AAGAAAATAGAGGAGAAGAGAGG + Intergenic
1064032181 10:11889850-11889872 AAGGACATCATGGAGAAGACTGG + Intergenic
1066344691 10:34573057-34573079 AAGAATTTCAAGGATAAGTCAGG + Intronic
1067163341 10:43845391-43845413 AAGTACCTGGAGGAGAGGTCCGG - Intergenic
1068721672 10:60252784-60252806 AAGTACATCCAGAAGTAGTCAGG - Intronic
1072090479 10:92122019-92122041 AAAAACATCTAGGAGATGCCAGG + Intronic
1073287592 10:102398113-102398135 AAGGACATCGAGTATAAGACTGG + Intronic
1074284277 10:112083277-112083299 AAGATCATAGTGGAGCAGTCAGG - Intergenic
1075935236 10:126334897-126334919 AAATAAATCGAGGAGGAGTCAGG - Intronic
1077299755 11:1841489-1841511 AAGAACATCGAGGAGAAGTCTGG + Exonic
1078921465 11:15834917-15834939 AAGAAGAAGAAGGAGAAGTCTGG - Intergenic
1079101475 11:17544625-17544647 AAGAAGATCGTGGAGACGTAGGG + Intergenic
1079308963 11:19347571-19347593 ATGAACTTTGAGGAGAAGCCAGG + Intergenic
1083989511 11:66238203-66238225 AAGACCAGAGAGGAGAAGGCTGG + Intronic
1086464365 11:87038019-87038041 AGGAACAGCGCGGAGAAGACAGG - Exonic
1087455666 11:98383301-98383323 AAGAAAACCAAGGAGGAGTCTGG + Intergenic
1088689696 11:112315226-112315248 ATGAACATAGAGGAGGAGGCAGG + Intergenic
1088774560 11:113069803-113069825 AAGGACATCGAGGATGACTCAGG + Intronic
1090977865 11:131691565-131691587 AAGGACATGGAAGGGAAGTCGGG - Intronic
1091147057 11:133289253-133289275 CAAAACATGAAGGAGAAGTCAGG - Intronic
1093864389 12:24207387-24207409 AATGAGATGGAGGAGAAGTCAGG + Intergenic
1095111481 12:38298926-38298948 AAGAACATAGAGTAGCAGGCTGG + Intergenic
1095483983 12:42665309-42665331 AAGGACAGAGAGGAGAAGGCTGG - Intergenic
1098082514 12:66804131-66804153 AAGAAGATCTAGGAGAAGAAAGG - Intronic
1101678742 12:106943790-106943812 AAGAAATTAAAGGAGAAGTCTGG - Intergenic
1102758613 12:115365947-115365969 GAGAACAGCGTGGAGAAGACTGG - Intergenic
1106970277 13:35132124-35132146 AAGAACATTCATGCGAAGTCTGG - Intronic
1107418310 13:40221686-40221708 AAAAACATCGAGGGGTAGTGGGG + Intergenic
1110468051 13:75825986-75826008 AATAACATCAAGGGGGAGTCTGG - Intronic
1110941521 13:81355775-81355797 AAGAAGATTGAGGAGTAGCCAGG + Intergenic
1111288136 13:86122459-86122481 AAGAACATCAAGGAGAAAATTGG - Intergenic
1113067945 13:106390814-106390836 AAGATCAGCGGGGAGAGGTCTGG - Intergenic
1113421923 13:110177704-110177726 AGGAACATCAAGCAGAAGGCTGG - Intronic
1114150771 14:20037064-20037086 ATGAATATCCAGGAGAAGTTAGG - Intergenic
1119149641 14:72346765-72346787 AAGAACATGGGGGAGAACCCAGG - Intronic
1119717184 14:76867401-76867423 AAGAAGCTCGATGAGAAGACAGG + Exonic
1121626412 14:95388699-95388721 AGCAACTTGGAGGAGAAGTCAGG - Intergenic
1126722694 15:51598819-51598841 AACAACATAGAGGAGAAACCTGG - Intronic
1127498190 15:59531973-59531995 AAAAATATCTATGAGAAGTCAGG + Intergenic
1128289690 15:66468420-66468442 AAGTACAGAGAGGAAAAGTCTGG + Intronic
1129661550 15:77555727-77555749 AAGGGCTTCGTGGAGAAGTCTGG - Intergenic
1130964434 15:88686410-88686432 AATAACCTTGAGGAGAAGTGTGG + Intergenic
1132383994 15:101387053-101387075 AAGAACACATTGGAGAAGTCAGG - Intronic
1135596891 16:23751638-23751660 ATGAACATCCAGGAATAGTCAGG - Intergenic
1138561547 16:57803510-57803532 AAGAAGATCAAGGAGAGGACTGG + Intronic
1139793934 16:69466438-69466460 AAGAACAGTGAGGAGAATCCTGG - Intergenic
1141162749 16:81640075-81640097 AGGAACTTCCAGGAGAATTCGGG - Intronic
1144585562 17:16485602-16485624 AAGAACAGCCAGGAGGAGCCAGG + Intronic
1146382102 17:32338481-32338503 AAGTACACCAACGAGAAGTCTGG - Intronic
1152775269 17:82197446-82197468 CAGAACATTGAGGAGAAATTCGG + Intronic
1153167086 18:2274276-2274298 AAGAATATGGAGTAGAAGTGTGG + Intergenic
1153743515 18:8153009-8153031 AAGAACATCCAGGAAAGGCCAGG - Intronic
1155620052 18:27768112-27768134 AAGAACATCAAGGACAACCCTGG + Intergenic
1160809125 19:1005515-1005537 AAGACCTTCGAGGAGCTGTCGGG + Exonic
1160922305 19:1526721-1526743 AAGAACATGGAGGTGAAGATTGG + Exonic
1165867097 19:38945724-38945746 CAGAACCTGGAGGAGAAGCCTGG + Intronic
1167431431 19:49457249-49457271 AGAAATATGGAGGAGAAGTCCGG + Intronic
927106966 2:19836154-19836176 ACGAGCATAGAGGAGATGTCAGG + Intergenic
927374674 2:22400246-22400268 AAAAACAGCGAGGTGTAGTCTGG - Intergenic
929216109 2:39415138-39415160 AATAACATCTAGGAGAAGTTTGG - Intronic
931589344 2:63864800-63864822 AAGAACTTCAAAGAGAAGTGAGG - Intronic
935259894 2:101344814-101344836 AAGAATATCCTGGAGAAGCCAGG + Intergenic
935942249 2:108252848-108252870 AAGAAAAAGGAGGAGAAGTAGGG + Intronic
936287167 2:111189770-111189792 AAGAACACCTAGGACAAGCCTGG - Intergenic
936428672 2:112439688-112439710 AAGAACAACTAGGAGAACCCTGG - Intergenic
938170570 2:129071872-129071894 AAAAACATCGCGGACAAGTTTGG - Intergenic
939259626 2:139790397-139790419 AAGAACATAGAGGGGAATTCAGG - Intergenic
946007999 2:216541753-216541775 AAGAACACCAAGCAGAAGTTAGG - Intronic
948884141 2:240874576-240874598 GAGGACTTCGGGGAGAAGTCAGG + Intronic
1169955343 20:11096708-11096730 TATAACATCGTGGGGAAGTCTGG + Intergenic
1172606285 20:36216376-36216398 AAGCACACGGAGGAGGAGTCGGG + Intronic
1175724681 20:61309897-61309919 AAGGACATGGAGCAGAAGTGTGG + Intronic
1175983240 20:62751858-62751880 CAGATCATCGGGGAGAAGACTGG - Intronic
1179988622 21:44934249-44934271 AAGAACATGGAGGAGGAATGTGG - Intronic
1181518398 22:23431440-23431462 AAGCACATCGGGGAGCTGTCAGG - Intergenic
1182747664 22:32617877-32617899 AACAGCATAGAGGAGAAGGCAGG - Intronic
1184810990 22:46831835-46831857 TAGATCATCGTGGCGAAGTCAGG + Intronic
950165882 3:10798572-10798594 AAGAACATCGGTGGGAGGTCTGG + Intergenic
952025953 3:29082559-29082581 AATAACATACAGCAGAAGTCTGG - Intergenic
959241167 3:103796432-103796454 GAGAAGGTCGAGGAGAAGTGGGG + Intergenic
960576963 3:119239937-119239959 AAGAAAATCAAGGAGAGATCAGG - Intronic
962708521 3:138067225-138067247 AAGAACATGGAGGAGAAAAGGGG + Intronic
967224342 3:187276462-187276484 AAGCACATCGAAGTAAAGTCAGG + Intronic
967697128 3:192544970-192544992 GAGGAGATGGAGGAGAAGTCAGG + Intronic
971135432 4:23863360-23863382 AAGAATATCAAGGTTAAGTCAGG - Intronic
971197194 4:24480833-24480855 CAGAAGATCAAGAAGAAGTCTGG + Intergenic
972852192 4:43064007-43064029 AAGAAGACCGAAGAGAAGTGAGG + Intergenic
976742052 4:88366554-88366576 AAGAACATCTAAGAGGAGGCAGG - Intergenic
978303634 4:107297666-107297688 AAGAATATTGTGGACAAGTCCGG - Intergenic
979143766 4:117214144-117214166 AAGAAAATCCAGGGGGAGTCTGG + Intergenic
981278448 4:142929317-142929339 AAGAACATTGAGAAGAAGAGAGG - Intergenic
986216325 5:5722554-5722576 AAGAAAATTGAGGAAAAGGCGGG + Intergenic
986453428 5:7890236-7890258 AAGAAAAAGGAGGAGAAATCAGG - Intronic
995107161 5:108387708-108387730 AAAAAGGTCAAGGAGAAGTCAGG + Intergenic
995845723 5:116491709-116491731 AAGTGCAACGAGGAGAAATCAGG + Intronic
996905513 5:128595412-128595434 GAGAACATATAGGAGAAGGCAGG + Intronic
1004141970 6:13026589-13026611 ATGAACAGAGAGGAGAAGACGGG - Intronic
1004633090 6:17439986-17440008 AAGACCATCCAGGAGAACTCTGG - Intronic
1004741604 6:18466880-18466902 TAGAACATAGATGAGAACTCTGG + Exonic
1007339611 6:41182150-41182172 AAGATCATGGAGGAGATTTCTGG - Intergenic
1007855741 6:44854593-44854615 AAGAAAAGAGAGGAGAATTCTGG - Intronic
1012411205 6:98959584-98959606 AAGAACATGGAATAGAAGTGTGG - Intergenic
1012603153 6:101122897-101122919 CAGAACAGAGTGGAGAAGTCAGG + Intergenic
1013071372 6:106732277-106732299 AAGAACATAAAGGAGAAATTTGG - Intergenic
1013173043 6:107654750-107654772 AGGAACATGGAGGAGGAATCAGG + Intronic
1013173054 6:107654793-107654815 AGGAACATGGAGGAGGAATCAGG + Intronic
1013670404 6:112396203-112396225 AAGAAAATCGAAGACAACTCCGG - Intergenic
1015033724 6:128627300-128627322 AAGAATCTCGAGGACAAGGCAGG + Intergenic
1018029558 6:159831357-159831379 AGAAACTTGGAGGAGAAGTCGGG + Intergenic
1020193842 7:6021687-6021709 AAGAAGACCTAGGAGAAGCCGGG + Intronic
1023384427 7:39641462-39641484 AAGAACGTCCATGAGAAGTGGGG - Intronic
1028981589 7:96973148-96973170 AAGAACAGTGAGGAGGAGCCAGG + Intergenic
1031405088 7:121375723-121375745 AAGAAGATTGAAGAGAAGGCTGG - Intronic
1036064454 8:5363419-5363441 AAGAACAACAAGAGGAAGTCTGG - Intergenic
1037147133 8:15586006-15586028 AAGAAGGTTGAGGAGTAGTCAGG + Intronic
1037258262 8:16979524-16979546 AAGAATATAGAGAAGCAGTCTGG + Intergenic
1037296560 8:17408093-17408115 AAGAACATCATGGAGAGGCCGGG + Intronic
1038972028 8:32647016-32647038 AAGGACAAAGAGGAGTAGTCGGG + Intronic
1039954367 8:42195780-42195802 ATGAACATCAAGGAGAAATGGGG - Intronic
1042753162 8:72180289-72180311 AAGAACAAAAAGGAGAAGTAGGG - Intergenic
1042765535 8:72317043-72317065 AAGAACAAAAAGGAGAAGTAGGG - Intergenic
1043692667 8:83174954-83174976 TAGAACATTGGGGTGAAGTCTGG + Intergenic
1051229233 9:14937046-14937068 AAGAACAAAGAATAGAAGTCAGG + Intergenic
1052803470 9:32991420-32991442 AAGAAGAGCCAGGAGAAATCTGG + Intronic
1055171398 9:73263125-73263147 CAGAACATCATGGAGATGTCTGG + Intergenic
1056276612 9:84999943-84999965 AAGCACAGCGAGGAGAGGACAGG + Intronic
1057138255 9:92710304-92710326 AAGAACCTCAAGGAGAAGGGAGG - Intergenic
1057371031 9:94473447-94473469 AAAAACAACCAGGAAAAGTCAGG - Intergenic
1060366463 9:123020371-123020393 AAGCTCTTCGAGGAGAAGTCTGG + Exonic
1061505801 9:131031307-131031329 AAGAGCGTGGAGGGGAAGTCGGG - Intronic
1061882814 9:133576522-133576544 AAGAACAGCGAGGTGAGGGCGGG - Intergenic
1188008481 X:25034792-25034814 AGGAACACCAAGGAGAAGCCTGG - Intergenic
1190880766 X:54491181-54491203 AAGAACATGGAGGACAATTCAGG - Intronic
1192357832 X:70420442-70420464 GAGAACATAGAGTAGTAGTCTGG - Exonic
1192890058 X:75380882-75380904 AAGGAGATCTAGGAGAAGACAGG - Intronic
1193040929 X:77002703-77002725 AAAACCATCAAGTAGAAGTCTGG - Intergenic
1193996556 X:88372409-88372431 ATGAACACCAAGGAGAAGCCTGG - Intergenic
1196040858 X:111202063-111202085 AAGAAGTTCAAGGTGAAGTCTGG + Intronic
1198082658 X:133253765-133253787 AAGAACAGGGAGTAGAAGTTTGG - Intergenic