ID: 1077300241

View in Genome Browser
Species Human (GRCh38)
Location 11:1843341-1843363
Sequence GTGCCTACTGGGAAAGGGGG CGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1077300232_1077300241 -9 Left 1077300232 11:1843327-1843349 CCTTTCCAGAGCCTGTGCCTACT No data
Right 1077300241 11:1843341-1843363 GTGCCTACTGGGAAAGGGGGCGG No data
1077300223_1077300241 24 Left 1077300223 11:1843294-1843316 CCTGGCCATGGACCCCTTGCAGG No data
Right 1077300241 11:1843341-1843363 GTGCCTACTGGGAAAGGGGGCGG No data
1077300230_1077300241 11 Left 1077300230 11:1843307-1843329 CCCTTGCAGGGGACATGGCACCT No data
Right 1077300241 11:1843341-1843363 GTGCCTACTGGGAAAGGGGGCGG No data
1077300229_1077300241 12 Left 1077300229 11:1843306-1843328 CCCCTTGCAGGGGACATGGCACC No data
Right 1077300241 11:1843341-1843363 GTGCCTACTGGGAAAGGGGGCGG No data
1077300231_1077300241 10 Left 1077300231 11:1843308-1843330 CCTTGCAGGGGACATGGCACCTT No data
Right 1077300241 11:1843341-1843363 GTGCCTACTGGGAAAGGGGGCGG No data
1077300227_1077300241 19 Left 1077300227 11:1843299-1843321 CCATGGACCCCTTGCAGGGGACA No data
Right 1077300241 11:1843341-1843363 GTGCCTACTGGGAAAGGGGGCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1077300241 Original CRISPR GTGCCTACTGGGAAAGGGGG CGG Intergenic
No off target data available for this crispr