ID: 1077300323

View in Genome Browser
Species Human (GRCh38)
Location 11:1843772-1843794
Sequence GGACACCAGAATCACCCGAG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1077300323_1077300325 -8 Left 1077300323 11:1843772-1843794 CCTCTCGGGTGATTCTGGTGTCC No data
Right 1077300325 11:1843787-1843809 TGGTGTCCCTGCTGGAAGTGAGG No data
1077300323_1077300331 15 Left 1077300323 11:1843772-1843794 CCTCTCGGGTGATTCTGGTGTCC No data
Right 1077300331 11:1843810-1843832 CCTGCAGCCAGTACCCCATGGGG No data
1077300323_1077300329 14 Left 1077300323 11:1843772-1843794 CCTCTCGGGTGATTCTGGTGTCC No data
Right 1077300329 11:1843809-1843831 GCCTGCAGCCAGTACCCCATGGG No data
1077300323_1077300328 13 Left 1077300323 11:1843772-1843794 CCTCTCGGGTGATTCTGGTGTCC No data
Right 1077300328 11:1843808-1843830 GGCCTGCAGCCAGTACCCCATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1077300323 Original CRISPR GGACACCAGAATCACCCGAG AGG (reversed) Intergenic
No off target data available for this crispr