ID: 1077302916

View in Genome Browser
Species Human (GRCh38)
Location 11:1855417-1855439
Sequence TGCCCTGGACCTAGTGTTGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 126
Summary {0: 1, 1: 0, 2: 2, 3: 12, 4: 111}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1077302916_1077302920 -3 Left 1077302916 11:1855417-1855439 CCCTCAACACTAGGTCCAGGGCA 0: 1
1: 0
2: 2
3: 12
4: 111
Right 1077302920 11:1855437-1855459 GCAGGCCAAGCCCCTCCAGCTGG 0: 1
1: 0
2: 5
3: 39
4: 295
1077302916_1077302923 6 Left 1077302916 11:1855417-1855439 CCCTCAACACTAGGTCCAGGGCA 0: 1
1: 0
2: 2
3: 12
4: 111
Right 1077302923 11:1855446-1855468 GCCCCTCCAGCTGGACAAGTGGG 0: 1
1: 0
2: 1
3: 19
4: 142
1077302916_1077302922 5 Left 1077302916 11:1855417-1855439 CCCTCAACACTAGGTCCAGGGCA 0: 1
1: 0
2: 2
3: 12
4: 111
Right 1077302922 11:1855445-1855467 AGCCCCTCCAGCTGGACAAGTGG 0: 1
1: 0
2: 3
3: 23
4: 213

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1077302916 Original CRISPR TGCCCTGGACCTAGTGTTGA GGG (reversed) Intronic