ID: 1077305376

View in Genome Browser
Species Human (GRCh38)
Location 11:1866588-1866610
Sequence GCTTATGGGGGGCCAGGGGT AGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 375
Summary {0: 1, 1: 0, 2: 3, 3: 30, 4: 341}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1077305376_1077305385 -9 Left 1077305376 11:1866588-1866610 CCTACCCCTGGCCCCCCATAAGC 0: 1
1: 0
2: 3
3: 30
4: 341
Right 1077305385 11:1866602-1866624 CCCATAAGCCTCCTCCTCCTGGG 0: 1
1: 0
2: 0
3: 42
4: 711
1077305376_1077305388 -1 Left 1077305376 11:1866588-1866610 CCTACCCCTGGCCCCCCATAAGC 0: 1
1: 0
2: 3
3: 30
4: 341
Right 1077305388 11:1866610-1866632 CCTCCTCCTCCTGGGCTTCCAGG 0: 1
1: 1
2: 14
3: 160
4: 1425
1077305376_1077305383 -10 Left 1077305376 11:1866588-1866610 CCTACCCCTGGCCCCCCATAAGC 0: 1
1: 0
2: 3
3: 30
4: 341
Right 1077305383 11:1866601-1866623 CCCCATAAGCCTCCTCCTCCTGG 0: 1
1: 1
2: 3
3: 43
4: 368
1077305376_1077305392 8 Left 1077305376 11:1866588-1866610 CCTACCCCTGGCCCCCCATAAGC 0: 1
1: 0
2: 3
3: 30
4: 341
Right 1077305392 11:1866619-1866641 CCTGGGCTTCCAGGCTCTGCTGG 0: 1
1: 0
2: 4
3: 61
4: 479

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1077305376 Original CRISPR GCTTATGGGGGGCCAGGGGT AGG (reversed) Exonic
901216847 1:7559828-7559850 GCTTCTGGGAGGCCAGGGGAGGG + Intronic
901475297 1:9485296-9485318 GCTACTGGAGGGCCAGGCGTGGG + Intergenic
902128105 1:14234404-14234426 GGGGATGGGGGGCTAGGGGTGGG + Intergenic
902337477 1:15761958-15761980 GCTGAGGTGGGGCCATGGGTGGG - Intronic
902607378 1:17576180-17576202 GGTCTTGGGGGGCCCGGGGTGGG + Intronic
902612421 1:17605003-17605025 GCATATGGGGATCCTGGGGTGGG - Intronic
902804232 1:18850811-18850833 GCTTATGCTGGGATAGGGGTAGG - Intronic
903070940 1:20726772-20726794 GATTCTGGAGGCCCAGGGGTGGG + Intronic
903391346 1:22965488-22965510 GCCTAGGAGGGGCCAGGGTTAGG - Intergenic
903801219 1:25969835-25969857 GCCTATGAGGGGACAGGGGAAGG + Intronic
903886140 1:26542195-26542217 GCATCTGAGGGACCAGGGGTTGG + Intronic
904041971 1:27590413-27590435 GCTTAGGGGAGGCCAGAGGAAGG - Intronic
904387656 1:30155236-30155258 GGTGATGGGGGGCTAGGGGAGGG - Intergenic
904539259 1:31221818-31221840 GGCAATGAGGGGCCAGGGGTAGG + Intronic
905027959 1:34864318-34864340 GCTGAAGGAGGGCCAGGGCTGGG - Intergenic
905215165 1:36401576-36401598 GCCCATGGGTGGCCATGGGTGGG + Intergenic
906317147 1:44793756-44793778 GCCTATGGGAGCCCAGAGGTGGG - Intergenic
906854774 1:49292459-49292481 GCCCATGGGTGGCCATGGGTGGG - Intronic
907247580 1:53117852-53117874 GCTGATGGGGGCCCCAGGGTGGG - Intronic
908853273 1:68395380-68395402 GATTTGGAGGGGCCAGGGGTGGG - Intergenic
909197760 1:72648785-72648807 GCTTCTGGGTGGAAAGGGGTGGG + Intergenic
909773633 1:79457481-79457503 AGATTTGGGGGGCCAGGGGTAGG + Intergenic
910101545 1:83583261-83583283 GCTTCTGGGTGGAAAGGGGTGGG - Intergenic
912127736 1:106560606-106560628 GCTTTTGGGGGGTGGGGGGTAGG + Intergenic
912235326 1:107844535-107844557 GCTTATGGGGCTCCATGGGCAGG - Intronic
915246298 1:154558484-154558506 GCAGCTGGGGGGCCAGGGGGCGG - Exonic
915278971 1:154809388-154809410 GCTTATTTGGGGGCTGGGGTGGG + Intronic
915381068 1:155441307-155441329 GCTTGTGGCGGGGCCGGGGTGGG - Intronic
915535117 1:156530780-156530802 GCAGGTGGGGGGCCAGGGGCAGG - Intronic
915720160 1:157978851-157978873 GCTAACTGGGGGCAAGGGGTGGG + Intergenic
917848806 1:179042900-179042922 GCCCATGGGTGGCCATGGGTGGG + Intronic
918511235 1:185316598-185316620 GGTTTTGGGGGGCCTGGGTTAGG - Intronic
920092794 1:203466059-203466081 GCTTGTGGTGGGGCAGGAGTCGG + Intergenic
920501946 1:206490993-206491015 GGTTATCTGGGGCCAGGGGAGGG + Intronic
920535317 1:206733348-206733370 GCATTTGAGGGGCCAGGGGCAGG + Exonic
921065749 1:211621016-211621038 GCTTATGGGGTGGCGGGGGCGGG - Intergenic
921583824 1:216925577-216925599 GTTTTTGGGGGGACAGGGATTGG + Intronic
921727581 1:218540379-218540401 AATTTTGGGGGCCCAGGGGTGGG + Intergenic
922188754 1:223298474-223298496 CAGTATGGGGGGCCAGAGGTAGG + Intronic
1065279056 10:24116155-24116177 GCTTCTTGGAGGCCTGGGGTGGG - Intronic
1065816713 10:29489352-29489374 ACTTTTGGGGGCTCAGGGGTTGG - Intronic
1068300467 10:55131938-55131960 GCTCCTGGGGGGAAAGGGGTAGG - Intronic
1069998268 10:72356629-72356651 CATTTTGGGAGGCCAGGGGTGGG + Intergenic
1070080926 10:73186852-73186874 GATTATTGGTGGCCAGGGGCTGG + Intronic
1070576453 10:77682489-77682511 GCTCAGGGGCTGCCAGGGGTGGG + Intergenic
1070740638 10:78900879-78900901 GCTGCTCAGGGGCCAGGGGTGGG - Intergenic
1071595160 10:86916741-86916763 CATTATGGGAGGCCGGGGGTGGG + Intronic
1071623924 10:87148553-87148575 GTTTGTGGGGGGGCGGGGGTTGG + Intronic
1071878024 10:89863572-89863594 GCTTTTGAGGGGAAAGGGGTGGG + Intergenic
1073434623 10:103508680-103508702 CCTGATGTGGGCCCAGGGGTTGG + Intronic
1073463056 10:103677501-103677523 GGGGATGGGGGGTCAGGGGTAGG + Intronic
1075110660 10:119578792-119578814 GCATATGGGCGGTCAGTGGTTGG - Exonic
1075484843 10:122813871-122813893 GCCCATGGGAGGCCAGGGCTAGG + Intergenic
1075484877 10:122814031-122814053 GCCCATGGGAGGCCAGGGCTGGG + Intergenic
1075484896 10:122814111-122814133 GCCCATGGGAGGCCAGGGCTGGG + Intergenic
1076260225 10:129059233-129059255 GATTATGGTGTGCCAGGGGATGG + Intergenic
1077305376 11:1866588-1866610 GCTTATGGGGGGCCAGGGGTAGG - Exonic
1078039399 11:7844631-7844653 CCTTATGGGTGGCCAAGGGATGG + Intergenic
1078272422 11:9808575-9808597 GCTTATAGAGAGCCAGGGGATGG + Intronic
1078496609 11:11824179-11824201 GATTTGGAGGGGCCAGGGGTGGG - Intergenic
1080287672 11:30635211-30635233 GAATTTGGGGGGCAAGGGGTGGG - Intergenic
1082997817 11:59266997-59267019 GCTGATGGGGGCCTGGGGGTGGG - Intergenic
1083750812 11:64759631-64759653 GCTGCTGGGGAGCCTGGGGTGGG - Intronic
1084239018 11:67805997-67806019 GCTTAGGGAGGGGCAGGTGTCGG + Intergenic
1084411985 11:69010756-69010778 GCCAATGGGAGGCCTGGGGTAGG + Intronic
1084709668 11:70836128-70836150 GCCCATGGGGGGCCAGGGGAAGG + Intronic
1085525875 11:77163263-77163285 GGTTACAGGGGGCCGGGGGTAGG - Intronic
1085728745 11:78978203-78978225 GCGGATGGGGGGCTAGGGGAGGG + Intronic
1088651134 11:111958758-111958780 GTTCATGGGTGGCCATGGGTAGG - Intronic
1089125647 11:116174678-116174700 GCTTATGGATGGTCAGGGGAGGG - Intergenic
1089163593 11:116458072-116458094 GCTGGTGGGGGGCCAGGGGCGGG + Intergenic
1090414546 11:126531570-126531592 GCTTAGGGGGGGCCTTGGGTGGG - Intronic
1091468791 12:708862-708884 GCTGCTGGGGGGCCTGAGGTGGG - Intergenic
1092409779 12:8243854-8243876 GCCTACGCGGGGCCAGGGGCGGG + Intergenic
1095603196 12:44037634-44037656 GTTCATGGGTGGCCATGGGTGGG - Intronic
1095946213 12:47755040-47755062 GCTTGTGGTGGGACAGGGGAAGG + Intronic
1095951182 12:47782907-47782929 GCTTTTGGGGGTCCAGGCCTGGG - Exonic
1096144261 12:49266735-49266757 GCTTCTCGGGAGGCAGGGGTGGG + Intronic
1097246600 12:57610897-57610919 GCTGGCGAGGGGCCAGGGGTGGG - Intronic
1097446486 12:59678636-59678658 GCTCATGGGCAGCCACGGGTAGG + Intronic
1097622861 12:61962890-61962912 GCTGGTGGGGGGCTAGGGGAGGG - Intronic
1097924242 12:65110257-65110279 GAATATTGGGGGCCAGGGGAAGG - Intronic
1099322044 12:81162640-81162662 GCTTCTGGGTGGAAAGGGGTGGG - Intronic
1099676842 12:85771643-85771665 ACTTTTGGGGGGCAATGGGTGGG + Intergenic
1099882005 12:88478224-88478246 GGGGATGGGGGGCCAGGGGAGGG + Intergenic
1100223569 12:92533386-92533408 GCTAGTGGGGTGCCGGGGGTGGG + Intergenic
1100331404 12:93585809-93585831 GCTTTTGAGGGGGCAGGGGCGGG - Intergenic
1100663808 12:96729110-96729132 GCTGCTCGGGGGTCAGGGGTCGG + Intronic
1101741037 12:107500292-107500314 GGTCATGGGGGGCCAGGGAGAGG - Intronic
1102576687 12:113860223-113860245 GCTGGAGGGGGGCCAGGGCTGGG + Intronic
1103733941 12:123046609-123046631 GCTTAGTGGGTGCCAGGGGCTGG - Intronic
1103749582 12:123150265-123150287 GCTTGTCGGGGGCCCAGGGTTGG - Intergenic
1103942543 12:124508884-124508906 GCTGATGGGGGGACAGGAGGTGG + Intronic
1106372180 13:29145669-29145691 GATTTTGGGGTGGCAGGGGTGGG - Intronic
1107806787 13:44160856-44160878 GCTTATGGGTGGATGGGGGTGGG - Exonic
1108924963 13:55731000-55731022 ACTCATTGGGGGCCAGGGGAGGG - Intergenic
1109438907 13:62343597-62343619 GTTCATGGGTGGCCATGGGTGGG - Intergenic
1109780774 13:67107348-67107370 GCCTATGGGTGGCCATGGGCAGG - Intronic
1110041690 13:70767883-70767905 GCTTAGCGGGGGGCAGGGGAAGG + Intergenic
1110201137 13:72851602-72851624 GCTTCTGGGCGGAAAGGGGTGGG + Intronic
1110439119 13:75507875-75507897 GCTCATGGGCGGCCACGGGCAGG + Intergenic
1110670262 13:78169289-78169311 GCCCATGGGTGGCCATGGGTGGG + Intergenic
1112658282 13:101475784-101475806 GCTGATGGGGGGCAGGTGGTGGG + Intronic
1114338426 14:21716745-21716767 CCTTTTGCGGGGCAAGGGGTAGG - Intergenic
1114675344 14:24436523-24436545 GCTGAGAGAGGGCCAGGGGTGGG - Intronic
1117107927 14:52418018-52418040 GTTGATGGGAGGCGAGGGGTAGG - Intergenic
1119229621 14:72970015-72970037 GCTTGAGGGGGCCGAGGGGTGGG + Exonic
1121257245 14:92539885-92539907 GCTGAGCGGGGGCCTGGGGTGGG + Intronic
1121674207 14:95739360-95739382 GGTGCTGGGGGGCCAGGGGTAGG - Intergenic
1122281598 14:100626134-100626156 GAATGTGGGGGGCCAAGGGTGGG - Intergenic
1122386086 14:101349226-101349248 GCTTCTGGGTGGAAAGGGGTGGG - Intergenic
1122909314 14:104819345-104819367 GCTTCAGGGGTGACAGGGGTGGG - Intergenic
1125053840 15:35334554-35334576 GCCTATTGGGGGCATGGGGTAGG - Intronic
1125532548 15:40423048-40423070 GCTACTGGGGGGCTGGGGGTGGG - Intronic
1125970065 15:43904193-43904215 GTTTCTGGGGGGCCTGTGGTCGG + Intronic
1126372811 15:47964925-47964947 GCTGATGCGGGGCTGGGGGTTGG - Intergenic
1127844958 15:62861823-62861845 GCTTATTTGGGGGCTGGGGTAGG - Intergenic
1129236896 15:74229084-74229106 GCTTGTGGGGAGCCTGGGGGTGG - Intergenic
1129470358 15:75750345-75750367 GCTTATGGCAGGTCTGGGGTTGG + Intergenic
1130072892 15:80664004-80664026 GATTATGGGGGGTGGGGGGTGGG + Intergenic
1130272905 15:82461594-82461616 GCTTATTGGGGGTCAGAGGCTGG - Intergenic
1130465254 15:84188947-84188969 GCTTATTGGGGGTCAGAGGCTGG - Intergenic
1130487434 15:84405855-84405877 GCTTATTGGGGGTCAGAGGCTGG + Intergenic
1130499011 15:84484589-84484611 GCTTATTGGGGGTCAGAGGCTGG + Intergenic
1130513405 15:84607429-84607451 GAGCATGGGGGGTCAGGGGTGGG - Intronic
1130587546 15:85193560-85193582 GCTTATTGGGGGTCAGAGGCTGG - Intergenic
1130750375 15:86705136-86705158 GCTGGTGGGGGGCAAGGGGAGGG + Intronic
1132689613 16:1176670-1176692 GCTGATGGGGGTCCGGGGGCCGG + Intronic
1133184207 16:4083829-4083851 GCTTAGGGGCTGCCAGGGGCTGG + Intronic
1136002440 16:27305098-27305120 CCTTAGGGAGTGCCAGGGGTGGG - Intergenic
1136556244 16:31009591-31009613 GGTTTTGGGGGGACAGGGGAAGG - Intronic
1141315665 16:82960363-82960385 GATAATGGGAGGACAGGGGTGGG + Intronic
1141891234 16:86928034-86928056 GCTTATGGGGGAACAGGGAGGGG + Intergenic
1142098538 16:88259246-88259268 GCTTCGGGGGGGCGGGGGGTGGG - Intergenic
1142142371 16:88478348-88478370 GCTGCGGGTGGGCCAGGGGTGGG + Intronic
1142214757 16:88825065-88825087 GCTCCTGGGTGGCCAGGGCTGGG + Intronic
1143602069 17:7953653-7953675 ACTGATTGGTGGCCAGGGGTTGG + Intergenic
1143761239 17:9105557-9105579 GCTCCTGTGGGGACAGGGGTGGG + Intronic
1143852878 17:9825842-9825864 GCTTTTGGGGGGGCAGGGGCGGG + Exonic
1144131544 17:12251395-12251417 AGCTCTGGGGGGCCAGGGGTGGG + Intergenic
1145770559 17:27489812-27489834 GAAGATGGGGGCCCAGGGGTTGG + Intronic
1147649389 17:42053480-42053502 GCCTCTGAGGGGCCAGGGGAGGG - Intronic
1148088692 17:45009721-45009743 TCTTATGAGGGCCCAGGGGCAGG - Intergenic
1148438464 17:47699518-47699540 GCTTCTGGAGGTCCAGGGCTGGG + Intronic
1148779948 17:50115774-50115796 GCACATGGGGAGCCAGGGGCGGG + Intronic
1149033560 17:52110180-52110202 GGTTATGGGGATCCAGGGGAGGG - Intronic
1149561706 17:57612088-57612110 GCTTATGCAGGGCCTGGGGGAGG + Intronic
1149564208 17:57629995-57630017 GCTCATGGGGGCCCCGGGGCAGG - Intronic
1149971167 17:61219901-61219923 GGTTATGGGGGGAGAGGAGTAGG + Intronic
1150260366 17:63785177-63785199 GGTTTTGGGGGGCCAGGTGCAGG + Intronic
1150450254 17:65260775-65260797 GGCTAAGGGAGGCCAGGGGTGGG - Intergenic
1151895084 17:76974724-76974746 GCTCTTGGGGGGCCAGGAGCAGG + Intergenic
1151928057 17:77213250-77213272 GCCTGTGGTAGGCCAGGGGTCGG + Intronic
1152864223 17:82712707-82712729 GTTCATGGGCGGCCATGGGTGGG + Intergenic
1153522985 18:5969361-5969383 GCTGCTGGGGGGCCAGGGCTGGG - Intronic
1153585720 18:6617956-6617978 GGTTGTTGGGGGGCAGGGGTAGG + Intergenic
1153723980 18:7936762-7936784 GTTCATGGGTGGCCATGGGTGGG - Intronic
1154359334 18:13645872-13645894 GTTTATTTGGGGACAGGGGTTGG + Exonic
1155546829 18:26924339-26924361 TTTTATGGGGGCCCTGGGGTGGG + Intronic
1157860120 18:51133700-51133722 GCCTCTGTGGGGGCAGGGGTTGG + Intergenic
1157868263 18:51205195-51205217 GCTTAGTGGTTGCCAGGGGTTGG + Intronic
1158902818 18:61982177-61982199 GGGTATGGGGGGCTAGGGTTAGG - Intergenic
1159774291 18:72585679-72585701 GCTTCTGGGTGGAAAGGGGTGGG - Intronic
1160158266 18:76450358-76450380 GCTTCTGTGGGGCCTGGGGAGGG - Intronic
1160294531 18:77625201-77625223 GCTTGTGGGTGGGCAGTGGTGGG - Intergenic
1161221177 19:3118930-3118952 GGATGTGGGGGGCCAGCGGTCGG + Exonic
1161815775 19:6498995-6499017 GCCTCTGGGTGGCCAGGGGGTGG + Intronic
1162492434 19:11001355-11001377 GCTGATTGGGAGCCAGAGGTAGG + Intronic
1163369358 19:16893425-16893447 GCTTGTAGGGTGCCAGGGGTGGG + Intronic
1163418799 19:17202765-17202787 AGTTATGGGGTGCCAGGGGTGGG + Intronic
1164229242 19:23273594-23273616 GCTTCTCGGGGGCCGGGGGGGGG + Intergenic
1164550724 19:29210197-29210219 GCTTATGGGAGTGGAGGGGTTGG - Intronic
1164822532 19:31261152-31261174 GCCTACAGGGCGCCAGGGGTGGG - Intergenic
1164866795 19:31611064-31611086 GCTTATGGGAGGTCAGGTGTGGG + Intergenic
1165330384 19:35138698-35138720 GCTGGAGGGGGGCCAGGGGGCGG - Intronic
1165941132 19:39415300-39415322 GGTTATGGGGGCCAAGGGGCTGG - Intronic
1166542787 19:43616685-43616707 GTTTATAGAGGGGCAGGGGTGGG - Intronic
1166810011 19:45508931-45508953 GATTATGGGGGGCCAGGGGAGGG - Intronic
1166898044 19:46036325-46036347 GCTCTTGGGGGGCCAGGAGCAGG + Intergenic
1167521721 19:49959469-49959491 GGTTCTGGGGCCCCAGGGGTGGG + Exonic
1167523662 19:49971253-49971275 GGTTCTGGGGCCCCAGGGGTGGG - Intergenic
1168241090 19:55089225-55089247 GCTTATTGGGGGGCGGGGGGCGG - Intergenic
1168721239 19:58556011-58556033 ATTTATTGGGGGCCATGGGTAGG - Exonic
926362443 2:12102472-12102494 GCATATGGGAGCCCAGGGCTTGG + Intergenic
927743182 2:25590727-25590749 GTTCATGGGTGGCCATGGGTAGG + Intronic
927847389 2:26478577-26478599 GCTCATGGGGGGAGAGGGGTGGG + Intronic
928219574 2:29392413-29392435 GCTTTTGGTGGGTCAGAGGTGGG + Intronic
928263126 2:29785777-29785799 GCTGACGGGAGGCCGGGGGTGGG - Intronic
928465697 2:31520396-31520418 GATTTGGAGGGGCCAGGGGTGGG + Intergenic
930026423 2:47031899-47031921 GCTGATGGGGAGCCACGAGTGGG - Intronic
930612024 2:53554289-53554311 GCTTATGGGTGACCATGGATGGG - Intronic
931933045 2:67162358-67162380 GCAGATGGAGGGCCAGGGGAGGG + Intergenic
932536549 2:72603358-72603380 GGTGCTGGGGGGCCAGGGGAGGG - Intronic
933493964 2:83024483-83024505 GCGTATGGGGGGAAATGGGTGGG + Intergenic
933719569 2:85389400-85389422 GATGATGTGGGCCCAGGGGTTGG + Intronic
933729462 2:85446093-85446115 GCTGATGCAAGGCCAGGGGTGGG + Intergenic
934659989 2:96138211-96138233 GCTCCTGGGGGGCCAAGGGGAGG - Intronic
934720943 2:96576298-96576320 GGTTATGGAGGGACAAGGGTTGG + Intergenic
936049072 2:109209442-109209464 GCTTATGTGATGCCATGGGTTGG + Intronic
937359221 2:121217509-121217531 CCTTATGGAGGGCCGGGGGGCGG + Exonic
937801481 2:126085502-126085524 TCTTGTGGGGAGACAGGGGTGGG + Intergenic
938065362 2:128279167-128279189 GCTGATGGGGGTGCGGGGGTGGG + Intronic
938686263 2:133741499-133741521 GATTTGGAGGGGCCAGGGGTTGG - Intergenic
940074021 2:149720476-149720498 GATTATTGGGGGCCAACGGTGGG + Intergenic
941590736 2:167417086-167417108 CATTTTGGGAGGCCAGGGGTGGG + Intergenic
946408797 2:219506428-219506450 GCTTCCTGGGGGCCAGGGCTGGG + Intronic
946482482 2:220070410-220070432 GCTGAAGGGGAGCAAGGGGTTGG - Intergenic
946737829 2:222772570-222772592 GCTTGTGGGGAGCAAGGGCTGGG - Intergenic
947542027 2:230986268-230986290 GCCTTGGAGGGGCCAGGGGTGGG - Intergenic
1169002258 20:2176668-2176690 GAGTAAGGGGTGCCAGGGGTTGG + Intronic
1172528907 20:35617413-35617435 GCTTGGGAGGGGCCGGGGGTGGG - Intronic
1173247216 20:41345033-41345055 ACTTATGGGGGACCAAGGGTGGG - Intronic
1175844343 20:62050827-62050849 TGTTCTGGGGGGCCAGGTGTGGG - Intronic
1176048481 20:63104603-63104625 GCTCCTGGGGGGGCAGGGGTGGG - Intergenic
1176284995 21:5014707-5014729 GCATATGGGTGTCCAGGGGCTGG - Intergenic
1177054412 21:16282826-16282848 GCTTCCGGGGGGCCAGGGGATGG + Intergenic
1178351392 21:31874580-31874602 GGTGATGAGGGGGCAGGGGTGGG - Intronic
1178418772 21:32426511-32426533 GCTGGTGGGGTGGCAGGGGTTGG - Intronic
1179481817 21:41683110-41683132 TCTTCTCGGTGGCCAGGGGTGGG + Intergenic
1179567926 21:42260753-42260775 GCTCATGGGGGAACAGAGGTGGG - Intronic
1179872186 21:44248768-44248790 GCATATGGGTGTCCAGGGGCTGG + Intronic
1180796128 22:18606658-18606680 GCAAATGGGGGGCCAGGGGAAGG - Exonic
1181225594 22:21388613-21388635 GCAAATGGGGGGCCAGGGGAAGG + Exonic
1181253040 22:21546200-21546222 GCAAATGGGGGGCCAGGGGAAGG - Exonic
1181690478 22:24556106-24556128 GCCTGTGAGGGGCCAGGGGCTGG + Intronic
1182023510 22:27100236-27100258 GCTTATGGGGGTACAGTGGGGGG + Intergenic
1182319894 22:29471901-29471923 GCTTAGGAGGGGGCAGGGGCTGG - Intergenic
1182353875 22:29713465-29713487 GGCTATGTGGGGCCAGGGGCAGG - Intergenic
1184275006 22:43405111-43405133 GCCTATGGTGGGCCAGGAGGGGG + Intergenic
1184348323 22:43926291-43926313 ATTTATGGCTGGCCAGGGGTTGG + Intronic
1184510951 22:44932821-44932843 TCCTCTGGAGGGCCAGGGGTTGG - Intronic
1184866117 22:47202606-47202628 GATGATGTGGGGCCAGGGTTGGG + Intergenic
949160133 3:872185-872207 GCTTATGGGGAGACTGGTGTTGG - Intergenic
950314690 3:11990792-11990814 TTTTTTGGGGGGACAGGGGTTGG - Intergenic
950464285 3:13144183-13144205 GCTAAAGAGGGGACAGGGGTTGG - Intergenic
950468310 3:13168840-13168862 GAATCTGGGGGGCCAGGGGAGGG - Intergenic
950781876 3:15399208-15399230 GTTTTTTGGGGGCGAGGGGTTGG - Intronic
951447756 3:22802076-22802098 GCTGCTCGGGGGTCAGGGGTCGG - Intergenic
951751725 3:26043374-26043396 GCTTATGGGGGACTAGGATTAGG - Intergenic
952764440 3:36943052-36943074 GATTACGGGGGGCCGGGGGTGGG - Intronic
952860797 3:37810807-37810829 GCGTAGGTGGGGCCAGGGGCTGG - Intronic
953351483 3:42219610-42219632 GCTTTGGGGTGGGCAGGGGTGGG + Intronic
953432934 3:42854535-42854557 GCAAATGGGGGGCCGGGGATTGG - Intronic
953685905 3:45078268-45078290 GATTTGGAGGGGCCAGGGGTGGG + Intergenic
954398006 3:50303231-50303253 GCTCATGGGGAAGCAGGGGTGGG - Exonic
955265256 3:57436811-57436833 GCCACTGGGGGGCCAGGGGGCGG + Intronic
956386523 3:68725304-68725326 TCTTATGAGGTGCCATGGGTGGG + Intergenic
956902505 3:73731115-73731137 GCCTATTGGGGGCAGGGGGTGGG - Intergenic
956985435 3:74693984-74694006 GCACATGGGAGGCCAAGGGTGGG - Intergenic
957564211 3:81864321-81864343 CCTCATAGGGGGCCAGGGGAAGG - Intergenic
959476818 3:106821849-106821871 GTTTATGGGTAGCCATGGGTGGG - Intergenic
959603500 3:108216451-108216473 TATTTTGGGGGGCGAGGGGTTGG - Intronic
959848624 3:111062663-111062685 TGTTATGGGGGGCCAGGGGAAGG + Intergenic
959863780 3:111243302-111243324 GCTCTTGGGGGGCCAGGAGCAGG - Intronic
960976450 3:123179485-123179507 GCTTAGGGGAGGCCAGAGGGAGG + Intronic
961630702 3:128296370-128296392 GCTTATGGGTGGCCAGGATGAGG - Intronic
961735757 3:129001424-129001446 GCTTTGGAGGGGCCTGGGGTAGG - Intronic
962211998 3:133487102-133487124 GCCTATGGGCGGCCATGGGTGGG + Intergenic
963238837 3:142982868-142982890 GCAGATGTGGGGGCAGGGGTTGG - Intronic
963302100 3:143610258-143610280 GCTAATGGGGAGCCTGAGGTGGG - Intronic
964878816 3:161400687-161400709 GATTGTGGGGCGGCAGGGGTCGG - Intergenic
965013931 3:163131710-163131732 GCTCATGGGTGGCCATGGGCGGG - Intergenic
966091548 3:176144307-176144329 GCCTATGAGGGGCCAGGCCTTGG + Intergenic
966528361 3:180944732-180944754 GCTACTTGGGGGCCTGGGGTAGG - Intronic
966951447 3:184822152-184822174 TTTTTTGGGGGGTCAGGGGTGGG + Intronic
968211230 3:196850511-196850533 ACTGAGTGGGGGCCAGGGGTGGG + Intergenic
969621138 4:8279508-8279530 GCTTGAGGGGGTCCAGGGGCTGG + Intronic
971026584 4:22594755-22594777 TTTTATGGGGGCCCTGGGGTGGG + Intergenic
971040249 4:22743857-22743879 GTTTATGGGGGCCCAGGGGTGGG + Intergenic
971279190 4:25227396-25227418 GCTTATGGAGGGACTGAGGTGGG - Intronic
971375496 4:26052745-26052767 GCTCAGGGTGGGGCAGGGGTGGG - Intergenic
972164166 4:36261891-36261913 GCTTGTGGGGGACCAGGAGGAGG + Intergenic
972825313 4:42751769-42751791 GCTTAGTGGCTGCCAGGGGTTGG - Intergenic
973233053 4:47864729-47864751 GCAAATGGTGGGGCAGGGGTAGG + Intronic
976035713 4:80817996-80818018 GCTTATCGGAGGCAGGGGGTTGG - Intronic
976160412 4:82192635-82192657 GGTAATGGAGGGACAGGGGTGGG - Intergenic
976230068 4:82833397-82833419 GCCTGTGGGGGGCTAGGGGAGGG + Intronic
977726046 4:100298020-100298042 GATTTTGGGGGGTGAGGGGTGGG + Intergenic
978663419 4:111154561-111154583 GTTCATGGGGGGCCATGGGCAGG + Intergenic
979145367 4:117239990-117240012 GCTCATGGGTGGCCCTGGGTGGG - Intergenic
980936122 4:139227416-139227438 ACTTATGGAGGGACAGGGCTAGG + Intergenic
981717558 4:147766322-147766344 GCATATGGGAGGACATGGGTGGG - Intronic
983236159 4:165181515-165181537 GGTTATCAGGGGCCGGGGGTGGG + Intronic
988420918 5:31005392-31005414 GCATCTGGGGGGCTAGGGGAGGG - Intergenic
989725270 5:44579642-44579664 GCTGCTTGGGGGTCAGGGGTCGG - Intergenic
990951090 5:61299130-61299152 GCTTATGGAAGGCCAGCGTTGGG + Intergenic
992360916 5:76037551-76037573 GCTGCTCGGGGGTCAGGGGTCGG + Intergenic
992442363 5:76808190-76808212 GTGTATGCTGGGCCAGGGGTGGG - Intergenic
994876052 5:105422203-105422225 GGTTATGGGGGGCGAGGGGCGGG - Intergenic
995724010 5:115166240-115166262 GCCCATGGGTGGCCATGGGTGGG - Intronic
995745057 5:115394167-115394189 GCTCTTGGGGGGCCAGGAGCAGG - Intergenic
997277009 5:132601979-132602001 GCTGGTGGGGGGCTAGGGGAGGG + Intronic
997476667 5:134146435-134146457 GCCTGTGGGGGCCCTGGGGTTGG - Exonic
997596089 5:135108231-135108253 GCAGCTGGGGGGCCAGGGCTGGG + Intronic
998817712 5:146030749-146030771 ATTTATTGGGGGGCAGGGGTGGG + Intronic
999020365 5:148158875-148158897 GCTTATTTGGGGCCAGGGCTAGG - Intergenic
999696495 5:154191707-154191729 CCTTATGGGAGTCCAGAGGTGGG + Intronic
999776084 5:154814116-154814138 GCTTGAGGGGGGAAAGGGGTAGG + Exonic
999859919 5:155633863-155633885 GCTCATGGGTGGCCACGGGCAGG - Intergenic
1001586560 5:172836751-172836773 GCTTATGGGGTCCCAGGAGTGGG + Intronic
1002316896 5:178349511-178349533 GCCTAGGGAGGGCCAGGTGTGGG - Intronic
1005887413 6:30107351-30107373 GTGTATGGGGGGCTGGGGGTTGG + Intronic
1006110081 6:31739206-31739228 GCCTATTTTGGGCCAGGGGTTGG - Intronic
1006459105 6:34148044-34148066 GCTGGTGGGGGGCGGGGGGTGGG - Intronic
1007097899 6:39225534-39225556 GTTTTTGGTGGGACAGGGGTTGG + Intronic
1009493509 6:64322298-64322320 GCATATGTGGGGCTAGGTGTTGG + Intronic
1013988617 6:116227133-116227155 GGTTATGTGAGGCTAGGGGTAGG - Intronic
1015200332 6:130572419-130572441 GGGCATGGGGGGCCAGGGGAGGG + Intergenic
1015328963 6:131954998-131955020 CCTTATGGTGGGTCAGGGGGAGG + Intergenic
1017520265 6:155195761-155195783 GCTTGTGGGAGGTCAGGGATGGG + Intronic
1017950271 6:159130240-159130262 GCTGATGGTGGGGCAGGGGCAGG - Intergenic
1018706980 6:166470410-166470432 GCTCAGGGGTGGCCAGGTGTGGG - Intronic
1018710688 6:166496477-166496499 GTTTCTGGGGGGACAGGGGGAGG - Intronic
1019487203 7:1294809-1294831 GCTTATGTGGGTGCATGGGTGGG + Intergenic
1022468361 7:30666235-30666257 GCCTATGGGAGGCCTGGGGTGGG + Intronic
1023474941 7:40566997-40567019 GCTTTTGGGGGGACAGGCGAGGG - Intronic
1024457810 7:49629158-49629180 AATTATGAGGGGCCAGGAGTAGG - Intergenic
1024526955 7:50357202-50357224 GCTTGTGGGGGTCCTGTGGTGGG - Intronic
1025212973 7:57031583-57031605 ACTGCTGGGGGGCCGGGGGTGGG - Intergenic
1025658980 7:63545241-63545263 ACTGCTGGGGGGCCGGGGGTGGG + Intergenic
1025912553 7:65840080-65840102 GCTTGTGGGGGGCCACGGTGAGG - Intergenic
1027426615 7:78067897-78067919 GGTTATTGGTTGCCAGGGGTGGG + Intronic
1027779849 7:82507686-82507708 GTTCATGGGGTGCCATGGGTGGG + Intergenic
1029206216 7:98870527-98870549 GCTTAAGGTGCGCCAGGCGTTGG + Intronic
1029258935 7:99288218-99288240 GCTTTTGAGAGGCCAGGAGTTGG + Intergenic
1029402200 7:100353307-100353329 GGGTAGGGGGGGCCAGGGCTGGG + Intronic
1029458844 7:100684216-100684238 AGGTATGGGGGGCCTGGGGTGGG - Exonic
1031299639 7:120047859-120047881 TCTTATGGGGGGTGGGGGGTGGG - Intergenic
1031784959 7:126018141-126018163 GCTTCTGGGGTCCCAGGGGTAGG - Intergenic
1032382942 7:131503239-131503261 GCTGATGGGGGGCCCCGGGAAGG + Intronic
1033259513 7:139830628-139830650 GATTATTGGGGGCTGGGGGTAGG - Intronic
1034436947 7:151066963-151066985 GCTTGTGGGGGGCCCGGGGTCGG - Exonic
1035063118 7:156084098-156084120 GCTTACCAGGGGCCAGGGGATGG - Intergenic
1036222461 8:6932026-6932048 GCTAGTGGGTGGCCATGGGTTGG + Intergenic
1037608516 8:20457392-20457414 GCTTTTGGGCAGCCAGGAGTTGG - Intergenic
1037841483 8:22248330-22248352 GCTTCTGGGGAGCCAGGTGAGGG + Intronic
1037887153 8:22601159-22601181 GCTTCTGGCTGGCCAGGAGTCGG - Exonic
1040725748 8:50379411-50379433 GCCGATGGGGGGTCAGGGGCAGG + Intronic
1042117164 8:65444823-65444845 GCTCATGGGGGGGCAGGGGGGGG - Intergenic
1042602659 8:70513323-70513345 GATTTGGAGGGGCCAGGGGTAGG + Intergenic
1042973473 8:74436781-74436803 GCTTATGGGGGGTAAAGGGCCGG - Intronic
1043552637 8:81392087-81392109 GGTGATGGGGGGCAAGGGGAGGG + Intergenic
1046992757 8:120478253-120478275 GGGTATGGGGGGCTAGGGGAGGG + Intronic
1049748253 8:144272079-144272101 GCTTATGAGATGCCAGGCGTTGG - Intronic
1049824003 8:144655250-144655272 GCTGATGGGTGGCCATGGGTGGG - Intergenic
1052974004 9:34398779-34398801 GATGATGGGGGCACAGGGGTTGG + Exonic
1053042277 9:34884943-34884965 GCCTGTGGGGGACCAGGGGAAGG + Intergenic
1055303597 9:74906099-74906121 GCTAAGGGTGGGCCAGGGCTGGG - Intergenic
1055466368 9:76570534-76570556 GCTTATAGGGTCCCATGGGTTGG - Intergenic
1056156648 9:83845118-83845140 ACTTATGGGGGGCCTGGGAGAGG - Intronic
1057444620 9:95104859-95104881 GCTTATGGGGGGCTGGGGAGGGG - Intronic
1059124452 9:111670828-111670850 GCTACTTGGGGGCCAGAGGTGGG - Intergenic
1059339066 9:113587218-113587240 GCTGATGAGGGGCCGGGGGTGGG + Intronic
1059401234 9:114071658-114071680 GCCCATGGGCGGCCATGGGTAGG - Intronic
1059814483 9:117896535-117896557 GGTTGTGGGGGCCTAGGGGTGGG + Intergenic
1060172221 9:121471209-121471231 GCTGCTGGGTGGGCAGGGGTGGG - Intergenic
1060483984 9:124035591-124035613 GCTGCTGTTGGGCCAGGGGTGGG + Intergenic
1060518129 9:124278594-124278616 TCCTATGGTGGGCCAGGGGTGGG - Intronic
1186223670 X:7375404-7375426 GCTTCTGGGTGGAAAGGGGTGGG - Intergenic
1186601515 X:11042442-11042464 GTGTATGGGGGGTCGGGGGTGGG - Intergenic
1189300611 X:39949604-39949626 GCATATGGTGGGGCTGGGGTGGG - Intergenic
1190116576 X:47629502-47629524 GGTTAGGGGGAGCCTGGGGTGGG - Exonic
1190542708 X:51495621-51495643 GTGTGTGGGGGGCGAGGGGTGGG - Intronic
1191108903 X:56789696-56789718 ACTCATAGGGGTCCAGGGGTTGG + Intergenic
1191596655 X:62951562-62951584 GGGTATGGGGGGCCTGGGGGAGG + Intergenic
1191753454 X:64568581-64568603 GGTTGTGGGGGGCTAGGGGAGGG - Intergenic
1192082715 X:68063857-68063879 CCTTGTGGTGGGCCAGGGGCCGG + Exonic
1192662864 X:73060364-73060386 GCTGTTCGGGGGTCAGGGGTCGG - Intergenic
1193244329 X:79211122-79211144 GCTGCTTGGGGGTCAGGGGTCGG + Intergenic
1194028804 X:88786847-88786869 GCTGCTTGGGGGTCAGGGGTCGG + Intergenic
1195362029 X:104092062-104092084 GCTTGTGGTGGGGCAGGGGGAGG - Intergenic
1200023012 X:153227505-153227527 GCTAATGCGGGGTAAGGGGTGGG + Intergenic
1200179847 X:154143651-154143673 GCTCATGGGGGGCAAGGGGGAGG + Intergenic
1200356836 X:155561486-155561508 ATTTGTGAGGGGCCAGGGGTGGG - Intronic
1201720358 Y:17089890-17089912 GCTTCTGGGTGGAAAGGGGTGGG + Intergenic