ID: 1077306132

View in Genome Browser
Species Human (GRCh38)
Location 11:1869432-1869454
Sequence TCCCCCTCCCTCCTCCTTCA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 963
Summary {0: 1, 1: 1, 2: 9, 3: 112, 4: 840}

Found 14 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1077306132_1077306137 -2 Left 1077306132 11:1869432-1869454 CCTTGAAGGAGGAGGGAGGGGGA 0: 1
1: 1
2: 9
3: 112
4: 840
Right 1077306137 11:1869453-1869475 GAGCAGAAGCGGGTGCAGGGTGG 0: 1
1: 0
2: 5
3: 67
4: 418
1077306132_1077306140 9 Left 1077306132 11:1869432-1869454 CCTTGAAGGAGGAGGGAGGGGGA 0: 1
1: 1
2: 9
3: 112
4: 840
Right 1077306140 11:1869464-1869486 GGTGCAGGGTGGTGGCAGGATGG 0: 1
1: 1
2: 11
3: 140
4: 1071
1077306132_1077306144 21 Left 1077306132 11:1869432-1869454 CCTTGAAGGAGGAGGGAGGGGGA 0: 1
1: 1
2: 9
3: 112
4: 840
Right 1077306144 11:1869476-1869498 TGGCAGGATGGGAAGGGCAGAGG 0: 1
1: 2
2: 7
3: 117
4: 1049
1077306132_1077306143 15 Left 1077306132 11:1869432-1869454 CCTTGAAGGAGGAGGGAGGGGGA 0: 1
1: 1
2: 9
3: 112
4: 840
Right 1077306143 11:1869470-1869492 GGGTGGTGGCAGGATGGGAAGGG 0: 1
1: 0
2: 7
3: 108
4: 904
1077306132_1077306142 14 Left 1077306132 11:1869432-1869454 CCTTGAAGGAGGAGGGAGGGGGA 0: 1
1: 1
2: 9
3: 112
4: 840
Right 1077306142 11:1869469-1869491 AGGGTGGTGGCAGGATGGGAAGG 0: 1
1: 3
2: 4
3: 127
4: 1236
1077306132_1077306139 5 Left 1077306132 11:1869432-1869454 CCTTGAAGGAGGAGGGAGGGGGA 0: 1
1: 1
2: 9
3: 112
4: 840
Right 1077306139 11:1869460-1869482 AGCGGGTGCAGGGTGGTGGCAGG 0: 1
1: 0
2: 9
3: 51
4: 582
1077306132_1077306145 22 Left 1077306132 11:1869432-1869454 CCTTGAAGGAGGAGGGAGGGGGA 0: 1
1: 1
2: 9
3: 112
4: 840
Right 1077306145 11:1869477-1869499 GGCAGGATGGGAAGGGCAGAGGG 0: 1
1: 1
2: 10
3: 151
4: 1292
1077306132_1077306148 27 Left 1077306132 11:1869432-1869454 CCTTGAAGGAGGAGGGAGGGGGA 0: 1
1: 1
2: 9
3: 112
4: 840
Right 1077306148 11:1869482-1869504 GATGGGAAGGGCAGAGGGAGGGG 0: 1
1: 0
2: 48
3: 319
4: 2462
1077306132_1077306146 25 Left 1077306132 11:1869432-1869454 CCTTGAAGGAGGAGGGAGGGGGA 0: 1
1: 1
2: 9
3: 112
4: 840
Right 1077306146 11:1869480-1869502 AGGATGGGAAGGGCAGAGGGAGG 0: 1
1: 2
2: 36
3: 436
4: 2915
1077306132_1077306141 10 Left 1077306132 11:1869432-1869454 CCTTGAAGGAGGAGGGAGGGGGA 0: 1
1: 1
2: 9
3: 112
4: 840
Right 1077306141 11:1869465-1869487 GTGCAGGGTGGTGGCAGGATGGG 0: 1
1: 0
2: 5
3: 72
4: 542
1077306132_1077306138 1 Left 1077306132 11:1869432-1869454 CCTTGAAGGAGGAGGGAGGGGGA 0: 1
1: 1
2: 9
3: 112
4: 840
Right 1077306138 11:1869456-1869478 CAGAAGCGGGTGCAGGGTGGTGG 0: 1
1: 0
2: 0
3: 42
4: 453
1077306132_1077306135 -6 Left 1077306132 11:1869432-1869454 CCTTGAAGGAGGAGGGAGGGGGA 0: 1
1: 1
2: 9
3: 112
4: 840
Right 1077306135 11:1869449-1869471 GGGGGAGCAGAAGCGGGTGCAGG 0: 1
1: 0
2: 0
3: 62
4: 766
1077306132_1077306147 26 Left 1077306132 11:1869432-1869454 CCTTGAAGGAGGAGGGAGGGGGA 0: 1
1: 1
2: 9
3: 112
4: 840
Right 1077306147 11:1869481-1869503 GGATGGGAAGGGCAGAGGGAGGG 0: 1
1: 2
2: 70
3: 595
4: 3888
1077306132_1077306136 -5 Left 1077306132 11:1869432-1869454 CCTTGAAGGAGGAGGGAGGGGGA 0: 1
1: 1
2: 9
3: 112
4: 840
Right 1077306136 11:1869450-1869472 GGGGAGCAGAAGCGGGTGCAGGG 0: 1
1: 0
2: 3
3: 29
4: 412

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1077306132 Original CRISPR TCCCCCTCCCTCCTCCTTCA AGG (reversed) Intronic
900096946 1:943676-943698 CCTCCCTCCCTCCCCCTTCCAGG + Exonic
900226172 1:1534562-1534584 CCCTCCTCCCTCCTCTCTCAGGG - Exonic
900511536 1:3063176-3063198 TCCCCCTCCCCCGGCCTTCCCGG - Intergenic
900611464 1:3546362-3546384 CGCCCCTCCTTCCTCCTGCATGG + Intronic
900680058 1:3911713-3911735 GCTCCCTCCTTCCTCCTTCCAGG + Intergenic
900782313 1:4626157-4626179 TCCACCTCCCACCTCCTCCTCGG - Intergenic
900900004 1:5509809-5509831 CCCTCCTCCCTCCTCCATCCAGG - Intergenic
901053825 1:6439541-6439563 TACCCATCCCTCCTCCATGAGGG - Intronic
901672888 1:10866454-10866476 CCCCCCTCCCCACTCCTGCACGG - Intergenic
901730196 1:11273454-11273476 GCCCCGTCCTTCCTCCTTCCCGG + Exonic
901785567 1:11622327-11622349 GTCCCCTCCCTCCTACTTCCAGG + Intergenic
901787566 1:11634853-11634875 CCCTCCTCCCTCCTCCTGGAGGG - Intergenic
901807200 1:11746004-11746026 TCTCCCTCCCAGCTCCTGCAGGG - Intronic
902346309 1:15820695-15820717 AGCCCTTCCCTCCTACTTCAGGG + Intergenic
902480471 1:16708788-16708810 TACCCATCCCTCCTCCATGAGGG + Intergenic
902618194 1:17635302-17635324 TCTTCCTCCCTCCTCCTACCTGG + Intronic
902632626 1:17714450-17714472 TCCCGCTCTGTCCTCGTTCAGGG + Intergenic
902694804 1:18133133-18133155 TCCCCCTCCCTCTTCCTTTATGG - Intronic
902890238 1:19438072-19438094 TCCCACTACCTCCTACGTCAGGG + Intronic
902971327 1:20054079-20054101 TCCTCCTCCATGCTCCTCCATGG + Intronic
903182293 1:21611045-21611067 TCCTTCTCCCAGCTCCTTCACGG + Intronic
903455597 1:23484502-23484524 CCCCCATCCCTGCCCCTTCAGGG + Intronic
903961938 1:27063456-27063478 TCCCTCTCCCTCTCCCTCCACGG + Intergenic
904049893 1:27632813-27632835 GCCCCCTCCCTGGTCCCTCAGGG + Intronic
904295396 1:29516952-29516974 TTCTCCTCCTTCCTCCTTCCTGG + Intergenic
904801948 1:33099276-33099298 TCTCCCTCCCTCCTTCCTCCAGG + Intronic
905167690 1:36092548-36092570 TCTCCCTCTGTCGTCCTTCAGGG + Intronic
905238748 1:36568352-36568374 TCTCCTTCCCTCCTCCCTCAAGG + Intergenic
905245091 1:36607243-36607265 TCTCCTGCCCTCCACCTTCAAGG + Intergenic
905352259 1:37356087-37356109 GCTCCCTCCCTCCTCCTGAAAGG + Intergenic
905459434 1:38113003-38113025 TTCCTCTACCACCTCCTTCATGG - Intergenic
905477949 1:38242142-38242164 TCCCCTTCCCTCCACCCTCAGGG + Intergenic
905686600 1:39913155-39913177 TGACCCTCCCACCTCCTTCCCGG + Intergenic
906250140 1:44304908-44304930 TCAACCTCTCTCCTCCCTCAAGG + Intronic
906261923 1:44399098-44399120 TCCTCCTTGCTCCTCCTTCAGGG + Intergenic
906325618 1:44843444-44843466 TCCCCCTCCCTCCTCCTCCCTGG - Intergenic
906475651 1:46167616-46167638 TCCCCCTACCTGCTCCTTCTGGG + Intronic
906645060 1:47468945-47468967 TCACCCTCCCTCCTCCTGCAAGG + Intergenic
906765705 1:48430034-48430056 TCTCTCTCTTTCCTCCTTCATGG - Intronic
906873752 1:49513411-49513433 TCCCACTCCCTCCACCCTCTAGG + Intronic
907286148 1:53381082-53381104 TTCCCTTCCCTCCTTCTTAAAGG + Intergenic
907327435 1:53648819-53648841 CCTCCCTGCCTCCTTCTTCAAGG - Intronic
907460806 1:54604297-54604319 TACCCCACCCCCTTCCTTCAGGG - Intronic
907934293 1:59028355-59028377 TTCTACTCCCTCCTCCCTCATGG - Intergenic
908412214 1:63878204-63878226 TTCACCTCCCTGGTCCTTCACGG - Intronic
909369502 1:74867695-74867717 GCCCCCTTCCTCCATCTTCAAGG + Intergenic
911360700 1:96873022-96873044 TCCCCCTGCCACCTTCATCAGGG - Intergenic
911615351 1:100004845-100004867 TCCTCCTGCCTCATCCTTCCAGG + Intronic
911799953 1:102123571-102123593 TCCCCCACCCTCATCCTCCTGGG + Intergenic
912727780 1:112074898-112074920 CCCCCTTCCCTCCAACTTCAAGG + Intergenic
912751992 1:112294020-112294042 TCCCCCTCCCCCCTCCCGGACGG - Intergenic
912844820 1:113069349-113069371 ACCCCCCCCCACCTCCTTCCCGG - Intergenic
913994113 1:143638639-143638661 TCCCCCTCCCCCCTCCCGGACGG - Intergenic
914258465 1:145979259-145979281 TCCTCCTCCCTCCTCATACCTGG - Intergenic
914750815 1:150533894-150533916 CCTCCCTCTCTCCTCCTCCAAGG - Intergenic
914946904 1:152075292-152075314 TCCCCTTCCCTCCTCCCTAGTGG + Intergenic
915271922 1:154759502-154759524 TCCCCCACCCACCTCCTTGGAGG - Intronic
915309965 1:155001896-155001918 TCCCCCTCCCCCTCCCTTCTAGG + Intergenic
915526813 1:156481065-156481087 TTCCCCGACCTCCTTCTTCAGGG + Intronic
915584435 1:156836611-156836633 CCCTCCTCCCTCCTCTTTCATGG + Intronic
916007096 1:160672684-160672706 TCCTACTTCCTCCTCCTTGAAGG + Intergenic
916428867 1:164708545-164708567 TTTCCCTCCCTCCTCCTTTTTGG + Intronic
917629609 1:176879154-176879176 TCGCTCTCCCTCTTCCTACAGGG + Intronic
919656612 1:200202921-200202943 TCCCTCCCCTTCATCCTTCAAGG - Intergenic
919663930 1:200274301-200274323 AGTCCCTCTCTCCTCCTTCAGGG + Intergenic
919778320 1:201207974-201207996 TCCCAGACCCTCCTCCTGCAGGG - Exonic
919792974 1:201304206-201304228 TCCTCCCTCCTCCTCCTTCCTGG + Intronic
920092137 1:203462313-203462335 GCACCCTCCCTGCTCCATCAAGG - Intergenic
920259922 1:204682264-204682286 CCTCCCTGCCTCCTCATTCAGGG + Intronic
920446715 1:206023512-206023534 TCCTCCTGCCTCCACCTCCACGG - Intronic
920513206 1:206565831-206565853 TCCCCCTCCATCCTCCTCAGTGG - Intronic
920666273 1:207964725-207964747 TCCCCCGCCCTCCTCCCTCGGGG - Intergenic
920940052 1:210473620-210473642 TCCACTTCCTTCCTCCATCAGGG - Intronic
921199185 1:212789007-212789029 TCCCCATCCCTCTTCCTTCTAGG - Intronic
921332861 1:214057342-214057364 TCTCCCACCCTCTTGCTTCAGGG - Intergenic
921463826 1:215461651-215461673 TCTCACCCCCTCCTCCATCAGGG + Intergenic
922317858 1:224458381-224458403 TCCCCGTCCCTCATCCTACCAGG + Intronic
922427708 1:225514809-225514831 TAGCCCTCCCTCCTCCCCCAGGG - Exonic
922700750 1:227758840-227758862 TCCCTGTGCCTCCTGCTTCATGG + Intronic
922717522 1:227885152-227885174 TCACCCACCCACCCCCTTCATGG + Intergenic
922724985 1:227918457-227918479 TCCCCCTTCCTCCTCCTCCCTGG + Intergenic
922799840 1:228360160-228360182 TTCCTCTCCCGCCTCCTCCATGG - Intronic
922992313 1:229924850-229924872 GCCCCCTCCCTTCCCCTTGAGGG + Intergenic
923102241 1:230826002-230826024 TTGCCCTCCCTCCTCCAACAGGG - Intergenic
923134837 1:231108754-231108776 TCCCCCTCCCTGCAACTTCCTGG + Intergenic
923431013 1:233920409-233920431 TCACCATCTCTCCTCCTTCACGG - Intronic
923476756 1:234341047-234341069 TCCCTTTCCCCCCTCCCTCAGGG - Intergenic
923499199 1:234550563-234550585 TCCTCCGCCCTCCTCCTGCCTGG - Intergenic
924179113 1:241423964-241423986 TCCCCCACCCTCCTGCAGCAGGG + Intergenic
924352001 1:243123830-243123852 TCCCCTTCCTTCCTGCTTCAAGG - Intergenic
924381566 1:243470247-243470269 TCCCCCTCACTCCGCCTTTTGGG + Intronic
924469955 1:244334192-244334214 TCCCCTTCCCTCCTTCTCCAGGG + Intergenic
1063084842 10:2806978-2807000 TCCCCCTCCCTCTCCCTCCACGG - Intergenic
1063276966 10:4579980-4580002 CCCCAACCCCTCCTCCTTCATGG - Intergenic
1064982634 10:21179779-21179801 TTCCCCTTCCTCCGTCTTCAAGG - Intergenic
1066492300 10:35905624-35905646 TCTCCCTCCCTCCACCCTTAAGG + Intergenic
1067248373 10:44565688-44565710 TCTCCCTCCCTCCTCAACCATGG - Intergenic
1067428967 10:46229537-46229559 TCTCCCTCCCCCCGCCTTGAGGG - Intergenic
1067840159 10:49669308-49669330 TGCTCCTCCCACCTCCTTCTGGG + Intergenic
1068100910 10:52551832-52551854 TCTCCCGCCCTCCTCCCTTATGG + Intergenic
1068544533 10:58330996-58331018 TCCCCCTTATTCCTTCTTCAAGG - Intergenic
1068969429 10:62947035-62947057 TCCCTCTCCCTCTCCCTCCACGG + Intergenic
1069642419 10:69964316-69964338 TCCACCTCTTTCCTCCTCCAAGG - Intergenic
1069867891 10:71515005-71515027 GCCCCCTCCCTGCTCCTCCCAGG + Intronic
1069964378 10:72101981-72102003 CCTCCCTCCCTCCACCCTCAAGG - Intronic
1070391916 10:75978383-75978405 TCCTCCTCCCTGCTTCTTGAGGG - Intronic
1070456989 10:76626979-76627001 TCCCCACCCCACCTCCTTCCAGG - Intergenic
1070544668 10:77442922-77442944 TCACCTTCCCTCCTCCTACCTGG + Intronic
1071880890 10:89897343-89897365 TCCCCCAGCCTCCTCTGTCAAGG - Intergenic
1072211481 10:93250421-93250443 TCCCTGCCCCTCCTCCCTCATGG - Intergenic
1072663658 10:97379109-97379131 TCTCCCTCCCTGCTGCTCCAAGG - Intronic
1072999833 10:100277591-100277613 ACCCCCTCCCACCTCCCTCCCGG - Intronic
1073204668 10:101762567-101762589 TCCCCCTCCCGCCCTCTGCAAGG - Intergenic
1073340010 10:102737239-102737261 TCTCCCTGCTTCCTCCTTCTTGG - Intronic
1073453293 10:103622073-103622095 TCCCACTCCCCCATCCTCCATGG - Intronic
1073479920 10:103779935-103779957 TTCCCCTTCCCCCTTCTTCAGGG - Intronic
1073542370 10:104324373-104324395 TGTCCCTCCCTCCCCTTTCAGGG - Intronic
1073662300 10:105489860-105489882 TCCTCCTCCTATCTCCTTCAGGG - Intergenic
1073881071 10:107980683-107980705 TCCCCCTACCTCCTTCTTCCTGG + Intergenic
1074043942 10:109819754-109819776 TTCCACTTTCTCCTCCTTCAGGG + Intergenic
1074346603 10:112692391-112692413 TTCCCCTCCCTGCACCTTCATGG + Intronic
1074403101 10:113157931-113157953 TCCTCCTGCCTTCTCCTTCCAGG + Intronic
1074421133 10:113309667-113309689 TCCCCCCACCTCCTCCCACAGGG + Intergenic
1074914395 10:117941536-117941558 TGGCCCTTCCTCCACCTTCAAGG + Intergenic
1075090232 10:119440176-119440198 TCCACCACCCTCTTCCTTCTGGG - Intronic
1075545557 10:123351955-123351977 TCCCGCTGCCTCCTGCTGCAGGG + Intergenic
1075558091 10:123447733-123447755 CCCTCCTCCCTCCTCCTTGTTGG - Intergenic
1075633314 10:124014379-124014401 TTCCTCTCCATCCTCCTCCATGG - Intronic
1075648851 10:124114517-124114539 TTCCCCCTCCTCCTCCTTCAAGG - Intergenic
1075724642 10:124605040-124605062 TCTCCCTGCCGCCTCCTCCAGGG - Intronic
1075818235 10:125282977-125282999 TCCCCGTCTCTCTTCCTTTAGGG - Intergenic
1075951501 10:126481727-126481749 TCCCCGTTCATCCTCCTCCAGGG + Intronic
1076109673 10:127851106-127851128 TGCCTCTCCCTCCTTCTCCACGG - Intergenic
1076291453 10:129349086-129349108 GCCCCCTCCCTCCTCCTCACTGG - Intergenic
1076346142 10:129780173-129780195 TTCCCCTCCCTCCTCCAGGAAGG + Intergenic
1076393556 10:130121703-130121725 TCCACCTCTCTCCTCCTGCGAGG + Intergenic
1076863848 10:133157870-133157892 CCACCCTCCCTCCTCCATGAGGG - Intergenic
1077094906 11:795169-795191 TCCCATTCCCTCATCCTTCTAGG - Exonic
1077210705 11:1369858-1369880 TTCCCCTCGCTCCTGCTTCCAGG - Intergenic
1077306132 11:1869432-1869454 TCCCCCTCCCTCCTCCTTCAAGG - Intronic
1077672520 11:4168641-4168663 TCTCCTTCCCTTCTCCTTCCTGG + Intergenic
1077904221 11:6516653-6516675 TCTCTCTCCCTCCTCCTGGAGGG + Intronic
1078069303 11:8097841-8097863 TCCCACTCCCGCCTGCTTCCTGG - Intronic
1078332960 11:10441029-10441051 TCCACCCTCCTCCTTCTTCAGGG - Intronic
1078451127 11:11441775-11441797 GCCATCTCCCTCCTCCTCCAGGG + Intronic
1078545272 11:12242486-12242508 TTCCCCTCCCTCCTCCTACCCGG + Intronic
1078628814 11:12983282-12983304 TCCCCATCCCTTCTCCATCTTGG + Intergenic
1078755543 11:14205330-14205352 TCCTCCTCCATCTTCCTCCAGGG + Intronic
1078916971 11:15787454-15787476 TCCCTCTACTTGCTCCTTCAGGG - Intergenic
1080304756 11:30824317-30824339 TCCCTGCCCCTCCTCCTCCAGGG + Intergenic
1080661630 11:34301009-34301031 TCCCCCAGCCTCCTCATTAATGG - Intronic
1081703552 11:45166748-45166770 TGCCCCTTCCACCTCCTTCCTGG + Intronic
1081795135 11:45813489-45813511 TCCTCCTGCCTCTTCCTTCCTGG - Intergenic
1082706039 11:56496534-56496556 TCCCTCTCCCTCTCCCTCCACGG + Intergenic
1083047066 11:59746678-59746700 TCCCCCACCCTCCTCCAAGAAGG - Intronic
1083171505 11:60926136-60926158 GGCACCTCCCTCCTCATTCAGGG - Intronic
1083230744 11:61317054-61317076 ACCCCCTCTCTGCTCCTTCTTGG + Intronic
1083334217 11:61913412-61913434 TCTCCCCCACTCCTCCTCCATGG - Intronic
1083552359 11:63599393-63599415 TCCCCATGCCTCATCCTTGATGG - Intronic
1083642193 11:64151444-64151466 TCGACCTCCCTCCACCTCCAGGG + Intronic
1083808392 11:65088353-65088375 TCCACCTGCCAGCTCCTTCATGG - Exonic
1083829517 11:65222489-65222511 TCCCGCTGGCTCCTCCTGCATGG + Intergenic
1083900299 11:65640361-65640383 TGCCCCTCCCACTTCCTTCAGGG - Intronic
1083983166 11:66191182-66191204 ACCCCCTCCCTCCATCTTCAAGG + Intronic
1084008025 11:66333468-66333490 TCCCCTTCCCTGCTTATTCAGGG + Intronic
1084020504 11:66414457-66414479 TCCCTCTCCCACCCCCTCCATGG + Intergenic
1084166165 11:67375643-67375665 TCTCCCTCTCCCCTCCTTCTTGG - Intronic
1084178421 11:67435105-67435127 TCCCCATCCGTCCCCCCTCAGGG + Exonic
1084334553 11:68449037-68449059 GCCCCCTCCGTCCCCCTGCACGG + Exonic
1084468418 11:69340941-69340963 TCCCTCTGCCTCCCCCTGCAGGG + Intronic
1084513971 11:69625727-69625749 ACCCCCTCTCTGCTCCTGCAGGG - Intergenic
1084564944 11:69923364-69923386 TGTCCCTGCCTCCTCCCTCACGG - Intergenic
1084654382 11:70506673-70506695 GGGCCCTCCCTCCTGCTTCATGG + Intronic
1084769604 11:71334230-71334252 TCCTCCTCCCTCCTTCTCCTGGG - Intergenic
1084857497 11:71998297-71998319 TCCCCCTACCTCCTGCCCCAGGG - Intergenic
1084903080 11:72324793-72324815 TCCCCCTCTCTCCTCCTGTAGGG + Intronic
1085084164 11:73655761-73655783 CCTCCCTCCCTCCTCCTTCTTGG + Intronic
1085172552 11:74461673-74461695 ATCCTTTCCCTCCTCCTTCAAGG + Intronic
1085480706 11:76820812-76820834 TCCCTCTCCCTCTCCCTCCACGG + Intergenic
1085516246 11:77113433-77113455 CCCTCCTCCCTCCTCCCTCCTGG - Intronic
1086045285 11:82524972-82524994 ACCCCCCTCCACCTCCTTCAGGG + Intergenic
1086064697 11:82733030-82733052 TCTGCCTCCGTCCTTCTTCACGG - Exonic
1086083878 11:82935313-82935335 TCTCCTTGCCTCCTACTTCATGG + Intronic
1086671759 11:89556516-89556538 TTCCCCTCCCTTCCCCTTGATGG - Intergenic
1088332745 11:108670304-108670326 TCCCTCTCCTTCAGCCTTCACGG - Intronic
1088685793 11:112283640-112283662 TCCCCCTCCCCTGCCCTTCAAGG - Intergenic
1088987840 11:114925706-114925728 CCCCCCTCCTTCCTCTCTCAGGG - Intergenic
1089059075 11:115611437-115611459 TCTCCCTCTCTCCACATTCAAGG - Intergenic
1089157536 11:116413937-116413959 TTCCCCTCCCTCATCCTGCCTGG + Intergenic
1089209800 11:116792204-116792226 TCTCCCTCCCTCCCATTTCATGG + Intronic
1089211603 11:116807781-116807803 TTCCCCTCGGTCCTCCTGCATGG - Intergenic
1089257753 11:117202969-117202991 TGCCCCTCCCTCCTCCACCCTGG + Exonic
1089361024 11:117886651-117886673 ACCCTCCTCCTCCTCCTTCACGG - Intergenic
1089649875 11:119905772-119905794 TTCCCCTTCTTCCTCCCTCATGG - Intergenic
1089880157 11:121765983-121766005 TCCCCCTACCCTCACCTTCATGG + Intergenic
1090269613 11:125376955-125376977 TGCCTCTCCCTCCTCTTTCTGGG + Intronic
1090751279 11:129748424-129748446 TCCCCAGCCCTCTCCCTTCAAGG - Intergenic
1091162134 11:133433723-133433745 TCCCACTCTCTCCTTCTGCAAGG + Intronic
1091176431 11:133562562-133562584 TCCCCCTACCCCCACCTTCAGGG + Intergenic
1091802211 12:3331375-3331397 TTCCCCTCCCTTTTCCTCCACGG - Intergenic
1092256083 12:6927649-6927671 TCCCCCTCTCTCCCCCCTCGCGG + Intronic
1092913790 12:13171608-13171630 TGCCCACCCCTCCTCATTCAGGG + Intergenic
1092916538 12:13194550-13194572 TCTCCCTCCCACCTCCTTCTCGG - Intergenic
1093160979 12:15746151-15746173 TCCCCCTGACTCCTGCTTCAAGG - Intronic
1093564623 12:20588118-20588140 TGCCCCTACCGCCTTCTTCATGG - Intronic
1093877619 12:24369135-24369157 CCCCCTTCCCTCCTCATTGATGG + Intergenic
1094092175 12:26662502-26662524 TCCCACACCATCCTTCTTCATGG + Intronic
1094103075 12:26784348-26784370 TCCCTCTCCCTCTCCCTCCACGG + Intronic
1094205688 12:27838108-27838130 TCCCCTCACCTCCACCTTCAGGG + Intergenic
1095929309 12:47609753-47609775 GACCCCTCCTTCCTCCTTCCAGG - Intergenic
1096225617 12:49865141-49865163 TCCCTCTCCGTCCTCCTAGAAGG - Intergenic
1096244324 12:49975734-49975756 TCCCCCTCCCGCCACCCCCAGGG - Exonic
1096493837 12:52027692-52027714 TCCCCATGCCTCCTGTTTCACGG + Intronic
1096668541 12:53183395-53183417 GACCCCTCCCTCCACCTTCTGGG - Intronic
1096908302 12:54956822-54956844 TCCCCCTCCATCTTCCGCCATGG - Intronic
1097030809 12:56087958-56087980 TACCCCTACCTCCTCCTCAAAGG - Intronic
1097170526 12:57110327-57110349 CCTCCCTCCCTTCCCCTTCAAGG - Intronic
1097192758 12:57227191-57227213 CCCCCCTCCCTCCTCCAGCCAGG - Intergenic
1097364936 12:58701726-58701748 TCCCCCTGCCTGCTGCCTCACGG - Intronic
1097694685 12:62764827-62764849 TCTCCCTCCATCCTTCTCCATGG - Intronic
1098379709 12:69854330-69854352 TCCCTCCCCCTCCCCCTCCACGG - Intronic
1098412430 12:70201141-70201163 TCCCTCTCCCTCTCCCTCCACGG + Intergenic
1099054690 12:77824480-77824502 TCTACCTCCCTCTTCCTTCTAGG - Intergenic
1101208199 12:102510112-102510134 TTCCCCTCCCTCCCTCTTTAAGG + Intergenic
1102027216 12:109720344-109720366 TGGACCTCCCTCCTCCTCCAAGG - Intronic
1102073152 12:110038346-110038368 TTCCCCTAGCTGCTCCTTCAGGG - Exonic
1102119911 12:110431827-110431849 TCCGCCTCGCTCCGCCTTCCGGG - Intergenic
1102150824 12:110688470-110688492 TCCCCGGGGCTCCTCCTTCAGGG + Exonic
1102173021 12:110856455-110856477 TCCCCCGCCCGCCTCCTTCCAGG + Intronic
1102509213 12:113402866-113402888 GCTCCCTCCCTCCTCCTCCCCGG - Intronic
1102940409 12:116936550-116936572 GGCCCCTTCCTCCACCTTCAAGG - Intronic
1102982849 12:117256070-117256092 TCCCTCTCACCCCTCCTTCAGGG - Intronic
1103057129 12:117830348-117830370 TCCCCTTCCCTCCCCCTTCTAGG - Intronic
1103237531 12:119385812-119385834 TCCCCCTCCGTGCCCCTTCAGGG + Intronic
1103457218 12:121076537-121076559 ACCCCCCCCCACCTCCTTCCCGG - Intergenic
1103688803 12:122753455-122753477 TCCCTCTGCCCCATCCTTCATGG + Intronic
1104026711 12:125032833-125032855 ACCCACTCCCTCCTCCTCCTCGG - Intergenic
1104088431 12:125494895-125494917 TCCCTCTCCCCCCTCCTCCCTGG + Intronic
1104926475 12:132316593-132316615 TCCTCATCCCTCCTCCTGCCAGG + Intronic
1105446826 13:20464529-20464551 TCCTCCTTCTTCCTCCTTAAAGG - Intronic
1106027307 13:25967437-25967459 TCACCCACCCTCCACCTTCAAGG - Intronic
1108304249 13:49115171-49115193 CCCCCCCCCCTCATCCCTCAGGG - Intronic
1108732876 13:53253269-53253291 GCCCCCTTCCTCCTTCCTCATGG - Intergenic
1109073765 13:57806390-57806412 TACCCCTGCCCTCTCCTTCAGGG + Intergenic
1110356772 13:74575910-74575932 GCACCCTCCCCCCTCCTCCACGG - Intergenic
1111692650 13:91583692-91583714 TCCTCCTGCCTCTTTCTTCAAGG - Intronic
1111936692 13:94565210-94565232 TCCCCCTCCCTCCTCACCCCAGG - Intergenic
1113007815 13:105727209-105727231 CCCTCCACCCTCCTCCATCAAGG + Intergenic
1113188991 13:107722092-107722114 TCTCCCTCCCTCCTCCTTTCTGG - Intronic
1113504056 13:110800847-110800869 TGCCCCTCCCCTCTCCTTCAAGG + Intergenic
1114083319 14:19219777-19219799 TACCTCTGCCTCCTCCTCCAGGG + Intergenic
1114198925 14:20505311-20505333 TCCCTCTCCCTCTCCCTCCACGG + Intergenic
1114427496 14:22636421-22636443 TCCCTCTCCCTCTCCCTCCAGGG + Intergenic
1114553039 14:23545093-23545115 TCCCTCTCCCCCGCCCTTCACGG + Intronic
1115004623 14:28467635-28467657 TCCCCCTGCCACCTCCATTAGGG - Intergenic
1115348287 14:32365924-32365946 TCCACCTCTCTCCTGCTTCCTGG + Intronic
1115703920 14:35978618-35978640 TCCCCCTCCCCCTCCCTCCACGG - Intergenic
1115924014 14:38410907-38410929 TCCCCCTCCTTCCTTCCTCATGG + Intergenic
1117515054 14:56492462-56492484 CCCCCCTCTGGCCTCCTTCAAGG + Intronic
1118672439 14:68143923-68143945 TCTCCCTCCCTTCATCTTCAGGG + Intronic
1118780224 14:69003047-69003069 TTCTCCTCCCTCCTCCTTCATGG + Intergenic
1118884243 14:69853283-69853305 TCCCCCTCCCCCAACCTTAAAGG - Intergenic
1118887654 14:69879840-69879862 TCCCCCTCCTCCTTCCCTCAGGG - Intronic
1118985852 14:70754002-70754024 TCCCCAGCCCACCTCATTCAAGG - Intronic
1119154888 14:72400888-72400910 TCCTCCTCACTCCTCCTGCTTGG - Intronic
1119443869 14:74647839-74647861 TCTCCCTCCCTCCCTCTTCCTGG + Intergenic
1119474660 14:74920145-74920167 GCTCCCTTCCTCCTCCTTCCTGG - Intronic
1119626038 14:76176729-76176751 CCCCTCTGCCTCCTCCTCCAAGG - Intronic
1120023390 14:79554895-79554917 CGGCCCTTCCTCCTCCTTCAGGG + Intronic
1120491345 14:85182247-85182269 TGCCTCTCTCTCTTCCTTCAGGG - Intergenic
1120885469 14:89448531-89448553 TCTCCCTCTCTCCTCCCACAGGG + Intronic
1121001363 14:90454145-90454167 GCCCCCACCCTCCTCCCTCCTGG + Intergenic
1121270294 14:92633138-92633160 TCCCCCTGCTCCCTCCCTCAGGG - Intronic
1121584317 14:95052404-95052426 TCCCCCGCCCTCCTCCTCGTCGG + Intergenic
1121862879 14:97336050-97336072 TCCCCCTCCCACCTCTTCCAGGG - Intergenic
1122112245 14:99510628-99510650 TCCCCCCTCATCCTCCTCCAGGG + Exonic
1122298540 14:100718949-100718971 TCCCCCTCAAACCTCCTCCAGGG - Intergenic
1122354772 14:101116214-101116236 TGCCTCTCTCACCTCCTTCATGG - Intergenic
1122602046 14:102926474-102926496 TCCCCTTCACTCCTGCTCCAAGG + Intronic
1122775415 14:104114794-104114816 TCCCCGTCTATCCTACTTCATGG + Exonic
1122950862 14:105043864-105043886 CCCCTTTCCCTCCTCCTTGAGGG + Intergenic
1122954884 14:105065985-105066007 CCCGCCTCCCTCTTCCTACATGG + Intergenic
1123121253 14:105918084-105918106 CCTCCCTCCTCCCTCCTTCAGGG - Intronic
1123934852 15:25189154-25189176 TCCCCCACCCCCTTCCTGCATGG + Intergenic
1124108858 15:26767731-26767753 TCCTCCTTCCCCCTACTTCAGGG - Intronic
1124440391 15:29681604-29681626 TCGCCCTACCTGCTGCTTCATGG + Intergenic
1124693658 15:31845869-31845891 TCCCCAGACCTCCTCCTGCATGG - Intronic
1125868500 15:43076760-43076782 ACCCCCTCCCACCTCCCTCCCGG - Intronic
1125911604 15:43444806-43444828 TTCCCCTCCCAACTTCTTCAGGG + Intronic
1126598474 15:50405158-50405180 TGCACCTCCTTCCTCCTTCAAGG + Intergenic
1127584082 15:60365859-60365881 TCCCCCTCCCTCTCCCTCCACGG + Intronic
1127856173 15:62955470-62955492 TCCCCCTTCCTCCTCCTCAGAGG - Intergenic
1128155463 15:65389043-65389065 CCTCCCTTCTTCCTCCTTCATGG + Intronic
1128211996 15:65909384-65909406 TCCCCCTGCCTCCTCCCTGGTGG - Intronic
1128254856 15:66189064-66189086 TCCCCATCCCTCCTCCCCCATGG - Intronic
1128647404 15:69387715-69387737 TCCCCTGCCTTCCTCCATCACGG + Intronic
1128649284 15:69398685-69398707 TTCCCCTCACTCCTTCCTCAAGG + Intronic
1128660651 15:69498702-69498724 TCCCTCCTTCTCCTCCTTCAAGG + Intergenic
1128774594 15:70309860-70309882 TCCCCCTCCCCACTCCCCCATGG - Intergenic
1128783255 15:70376656-70376678 TCTCCATCCCTCCCTCTTCAAGG + Intergenic
1128798109 15:70479507-70479529 TGCCCATGCCTCCTCCTCCAGGG + Intergenic
1129254400 15:74325923-74325945 TCGCCATTCCTCCTCCTTCGTGG + Intronic
1129334590 15:74844425-74844447 TCCCCCTGCACCCTCCTGCAGGG - Exonic
1129380029 15:75158855-75158877 TCCCTCTCCCTCCTGCCTGATGG + Intergenic
1129659566 15:77545504-77545526 TCCTCCTCCCTGCTCCCTCTTGG + Intergenic
1129920173 15:79312845-79312867 TCCCCCTCCCCCCACCAGCAAGG - Intronic
1129981365 15:79874322-79874344 TCCCCCTCTCCCCAGCTTCATGG + Intronic
1130216686 15:81978347-81978369 TCCCCTTTCCTCCTTCTTCAGGG + Intergenic
1130223661 15:82043042-82043064 CCCCTCTCCCTTCTCCTTCCCGG - Exonic
1130880168 15:88048147-88048169 TCTCCCTGCCTCCTTCCTCAGGG + Intronic
1132599474 16:767509-767531 TCCCACTCGCCCCTCCTCCACGG - Intronic
1132733894 16:1376220-1376242 TGCTCCTCCCTCCTCCCTCCAGG + Intronic
1132733941 16:1376362-1376384 TCCTCTTCCCTCCTCCCTCCAGG + Intronic
1132746794 16:1439540-1439562 CCCCCCTCCCCTCCCCTTCAGGG - Intronic
1133112100 16:3554185-3554207 CCCTTCTCCCTCCTCCTCCAAGG - Intronic
1133121464 16:3611341-3611363 TCCGCCACCCTCCTCCCTCCAGG + Intronic
1133305600 16:4806265-4806287 TTCCTCTCCCTCATCCTTTAAGG - Intronic
1133311799 16:4852988-4853010 TGCCCCAGCCTCCTCCTTCCGGG - Exonic
1133365211 16:5203728-5203750 TCCCTCTCCCTCTCCCTCCACGG - Intergenic
1133697282 16:8276782-8276804 TCTCCTTCCCACCTCATTCATGG - Intergenic
1133980591 16:10630481-10630503 TCCTCCTCCCTCCGCCTCCCAGG + Intronic
1133988908 16:10689891-10689913 TGGCCTTCCCGCCTCCTTCAGGG + Intronic
1134304635 16:13021173-13021195 CCTCCCTCCTACCTCCTTCAGGG + Intronic
1134567076 16:15261011-15261033 CCTCCCTCCCTCCTCCTCCGGGG - Intergenic
1134735417 16:16495689-16495711 CCTCCCTCCCTCCTCCTCCGGGG + Intergenic
1134860145 16:17553607-17553629 TACCCATCCCTTCTCCTTCTTGG - Intergenic
1135141690 16:19927535-19927557 TCCCCATCTCCCCTCCTTCTAGG - Intergenic
1135721581 16:24822554-24822576 CCCACCTCCCTCCTCCCTCAGGG + Intronic
1136229781 16:28879480-28879502 TCCCCTTGCCTCCTCCCCCAGGG + Exonic
1136288657 16:29258801-29258823 TCTCCCTGCCTCCCTCTTCAAGG + Intergenic
1136293908 16:29291167-29291189 TTCAGCTCCCTCCTCCTCCAGGG + Intergenic
1136403443 16:30030562-30030584 TCGGCCTCCCTGCCCCTTCACGG - Exonic
1136454062 16:30370413-30370435 GCCCCCTCCCTCCTGCTTGGGGG + Intergenic
1137261832 16:46836983-46837005 TCCCCTTCCCTCCTTCCTCTAGG - Intergenic
1137393368 16:48099701-48099723 TCCCCCTGGGTCCTCCTTCCTGG + Intronic
1137569652 16:49557294-49557316 CCCCCCTCCCTCCTCCTGCCAGG - Intronic
1137715118 16:50593907-50593929 GCCCCCTTCCTCCTTCTTCTGGG - Intronic
1137927452 16:52554105-52554127 TGCCCCTCCCTACCCCTTCTTGG + Intergenic
1138339261 16:56278145-56278167 TTCCCCTCCTTCCTACTTGAAGG - Intronic
1138576420 16:57910142-57910164 TCCGACCCCCTCTTCCTTCATGG - Intronic
1138595946 16:58029008-58029030 TCCCCCTACCCCCTCCTCCCAGG + Intronic
1139361196 16:66401223-66401245 TCCCACCCCCTCCTCCTCCCTGG - Intronic
1139920436 16:70456542-70456564 TTCCAGTCCTTCCTCCTTCAGGG + Intronic
1140297685 16:73725328-73725350 TCTCCCTCCCTGCTGCCTCAAGG - Intergenic
1141391814 16:83671072-83671094 TCCCCCAGTCTCCTCCTTCTGGG + Intronic
1141434212 16:83990004-83990026 CCTCCCTCCTTCCTCCTGCAAGG - Intronic
1141582870 16:85011998-85012020 GCCCCCGGCCTCCTCCTTGAGGG + Intergenic
1141659133 16:85432241-85432263 ACCCTCTCCCTCCTCCATCTGGG - Intergenic
1141696388 16:85621799-85621821 TCCCCTCCCCTGCTTCTTCAAGG - Intronic
1141850591 16:86642656-86642678 TGCCCCTCACACCTCATTCAGGG + Intergenic
1141931383 16:87206455-87206477 TCTCCCCCCCACCTCCTTCCTGG - Intronic
1142099811 16:88265213-88265235 TTCAGCTCCCTCCTCCTCCAGGG + Intergenic
1142120255 16:88383433-88383455 TCCCCCGACCTCCTCCTCCCGGG + Intergenic
1142818388 17:2446607-2446629 TCCCTCTCCCTCTCCCTCCACGG + Intronic
1143086359 17:4418971-4418993 TCCCCCTGCCTCAGCCTCCAGGG - Intergenic
1143090837 17:4448368-4448390 ACCCCCTCTCTCCACCTCCAGGG + Intronic
1143101673 17:4507944-4507966 TCCTCCTCCCTCCTCCAGCCAGG - Intronic
1143145680 17:4773651-4773673 TTCTACTCCCTCCTCCTGCATGG + Intronic
1143579997 17:7819878-7819900 TTCTCTTCCCTCTTCCTTCAGGG + Intronic
1143762783 17:9117002-9117024 TCTCCCACCCCCCTCATTCAGGG - Intronic
1143874134 17:9979206-9979228 TCCTTCTTCATCCTCCTTCATGG + Intronic
1143880653 17:10027099-10027121 TCTCCCAACCTCCTCCTTCCAGG - Intronic
1144087389 17:11823045-11823067 TCCCGCTCCTTCCACCTGCAGGG + Intronic
1144333624 17:14248760-14248782 CCCCCCTCCCACCTTCTTCTTGG + Intergenic
1144441644 17:15287893-15287915 TCCCTCTCTTTCCTCCTCCAGGG + Intergenic
1145211646 17:21017631-21017653 TCCCCCTTCCTCTTCCTCCATGG - Intronic
1145214548 17:21042323-21042345 TCCCCCTCCCTTATCCTTCTTGG - Intronic
1145261753 17:21358708-21358730 TCCCCCTCCCCCAGCCTCCAGGG - Intergenic
1145271348 17:21406505-21406527 TCCCCATCCCTCATCATTCTGGG - Intronic
1145309553 17:21693909-21693931 TCCCCATCCCTCATCATTCTGGG - Intronic
1145865730 17:28240479-28240501 TCCCCCTGCCCCAACCTTCAAGG + Intergenic
1145969935 17:28950783-28950805 TCCCCCTCCCTCGGCCATCTAGG + Intronic
1146047987 17:29526197-29526219 TCCACCTTCCTCCGCCTTCCGGG - Intronic
1146216596 17:30981345-30981367 TCCCTCTCCCTCTCCCTCCACGG - Intronic
1146444680 17:32923806-32923828 TCCCCCTCCCTCTCCCTCCACGG - Intergenic
1146466921 17:33093720-33093742 TGCTCCTGCCTCCTCCTACAGGG - Intronic
1146624624 17:34425824-34425846 TACCCCTTCCTCCTACTTTAAGG + Intergenic
1146660999 17:34665157-34665179 TCCCCCTTCACCTTCCTTCATGG - Intergenic
1146946285 17:36875950-36875972 TCCTCCTGCCTCCTCCATCTGGG - Intergenic
1147134259 17:38426058-38426080 CCACCCTCCCTCCTCCCCCATGG + Intergenic
1147339569 17:39745596-39745618 TCTTCCTCCCTCCTATTTCAGGG - Intronic
1147358986 17:39919458-39919480 TCCACCTACCTCCTTCTCCAGGG + Intronic
1147447898 17:40486054-40486076 TCCCCCTCCCTCGGCCATCGGGG - Intronic
1148124814 17:45231215-45231237 TCCCCACCCCTCCAGCTTCAAGG + Intronic
1148771875 17:50072092-50072114 CACCCCTCACTCCTTCTTCATGG + Exonic
1148901101 17:50877798-50877820 TGCCCCTCTCTCCTGCTTCCTGG - Intergenic
1149366969 17:55954405-55954427 TCTCTCACCCTCCTCCCTCAAGG + Intergenic
1149595271 17:57861541-57861563 TCCTGCTCCCTCCTCCCTCCCGG - Exonic
1150124489 17:62627642-62627664 GCCTCCTCCCTCCTCCTCCCCGG + Exonic
1150132564 17:62677248-62677270 TCTCCCTTCCCTCTCCTTCAGGG + Exonic
1150281262 17:63930877-63930899 TCCCCCTCTTCCCTCCTGCAGGG + Intronic
1150451244 17:65270914-65270936 TCCCCCTCTTTCCCCCTTCCTGG + Intergenic
1150686580 17:67325881-67325903 TCCCCATTCCTTCTCCTTAAAGG - Intergenic
1150780442 17:68116965-68116987 TCCCTCTCCCTCCCTCTCCACGG - Intergenic
1151036498 17:70806122-70806144 CCCCCCTCCGTCTTCATTCAGGG + Intergenic
1151401363 17:73857989-73858011 TAGCCCTCCCTCCTCCCTCAGGG + Intergenic
1151438891 17:74115487-74115509 TGCCCCTCACTCCTGCTTCCTGG - Intergenic
1151540776 17:74763637-74763659 TGCTCCCTCCTCCTCCTTCATGG + Intronic
1151683813 17:75635408-75635430 TCACCCTCCGTCCTGGTTCAGGG - Intronic
1152019934 17:77775675-77775697 TCCCCTTCCCTCTCCCTCCACGG + Intergenic
1152037873 17:77884328-77884350 TCCCCCCGCCTCCTCCTTGATGG - Intergenic
1152068926 17:78125718-78125740 TCACTCACCCTCCTCCTCCAGGG + Exonic
1152221761 17:79072634-79072656 TTCCTCTGCCTCCTCCTTCATGG - Intergenic
1152232013 17:79118433-79118455 TTCCCCCTCCTCCTCCCTCATGG - Intronic
1152320791 17:79608085-79608107 TCGCCCTCCCTCCTCTGACACGG - Intergenic
1152368331 17:79870252-79870274 TCCCTCGCCCCCCTCCTTCAAGG + Intergenic
1152551247 17:81031416-81031438 TCCCCCTCCCACCTTCTGCCTGG - Intergenic
1152744919 17:82034110-82034132 CCCCCCACCCTCCCCCTCCAGGG - Exonic
1152919142 17:83057087-83057109 GCCCCCTCCCCGCTCCTTCCTGG - Intergenic
1153196135 18:2598515-2598537 TCTCCTTCCTTCTTCCTTCAGGG - Intronic
1153927513 18:9847078-9847100 TTCCTCTCCCTTCTCCATCATGG + Intronic
1153997579 18:10455018-10455040 TTCCCGGCCCTCCTGCTTCACGG + Exonic
1154164677 18:12005795-12005817 CCACACTGCCTCCTCCTTCAGGG + Intronic
1154345383 18:13539541-13539563 CCCCCTTTCCTCCTCTTTCAAGG + Intronic
1155254565 18:23983379-23983401 TCCACCTCCCTCCTGCTTCTAGG + Intergenic
1156447020 18:37244646-37244668 ACCCCCTCCTTCCTGCCTCATGG - Exonic
1156676389 18:39531568-39531590 TCCCCCTCCTTTCTCTTTCAGGG - Intergenic
1157161122 18:45315379-45315401 TCCCCCACCCTCCTTCTGCTGGG - Intronic
1157306982 18:46524732-46524754 TCGCCCATCCTCCTTCTTCAGGG + Exonic
1157332634 18:46714694-46714716 ACCCCCTCACTCCACCTCCACGG + Intronic
1157470335 18:47983501-47983523 CCCCCCTCACTCCTCCTGGAAGG + Intergenic
1157527499 18:48395628-48395650 TCTCCTTCCCGCCTGCTTCATGG - Intronic
1159845952 18:73460200-73460222 TCCCCCTCCCTCCAGCATCTAGG + Intergenic
1159944855 18:74436821-74436843 ACCCCCACCCCCGTCCTTCAGGG + Intronic
1159950386 18:74478463-74478485 TCCCCATCACTCCTCCTTTGCGG - Intergenic
1160063775 18:75555663-75555685 TCCCTCTCCCAACTCCTTTATGG + Intergenic
1160180823 18:76634829-76634851 TCCCTCTCCCTGCTCCTTGGTGG + Intergenic
1160218845 18:76957657-76957679 CTCCTCTCCCTCCTCCCTCAAGG + Intronic
1160255813 18:77247901-77247923 TCTCCCTCCCTCCACATTCTTGG - Intergenic
1160626528 18:80211898-80211920 TCCTCATTCCTCCTCCCTCAAGG - Intronic
1160701681 19:510584-510606 TCCCCCTCCTGCCACCTTCCTGG + Intronic
1160722137 19:602415-602437 TCCTCCTCTCTCCTCCTGCGTGG + Intronic
1160870240 19:1274627-1274649 CCTCCCTTCCTCCTCCTTCCAGG + Intronic
1160916964 19:1501389-1501411 GCACCCTCTCTCCTCCCTCAGGG - Intergenic
1161105784 19:2443327-2443349 TCCGACGCCCTCCTCCTTCCTGG - Intronic
1161146792 19:2683732-2683754 TTTCCCTCCCTCCTCCTCCAGGG - Intronic
1161382104 19:3970936-3970958 TCTCCCTCCCTCGTCCTCCGCGG + Exonic
1161573103 19:5041029-5041051 AGCCCCTCCCGCCTCTTTCATGG + Intronic
1161590633 19:5127710-5127732 GCTCTCTCCCTCCTCCTCCAAGG - Intronic
1161618568 19:5286285-5286307 TCCCTCTGCCTCCTCCATGAAGG - Intronic
1162050704 19:8030850-8030872 GGCCCCTTCCTCCACCTTCACGG - Intronic
1162145096 19:8608651-8608673 TGCCCCATCCTCCTCCTTCAGGG + Intronic
1162321648 19:9974139-9974161 TCCCCCTCCCACCTTCCTCTGGG + Intronic
1162421659 19:10568943-10568965 TCACCCTCCCTCCTCCTCGCCGG + Exonic
1162524934 19:11201621-11201643 TCCCTCTGCCTCCTCTTTCTGGG + Intronic
1162683078 19:12361730-12361752 TCCCTCTCCCTCTCCCTCCACGG + Intronic
1163243237 19:16076870-16076892 TCCTCCGCCGTCCTCCTTCCTGG + Intronic
1163454005 19:17395286-17395308 TCTCCCTCCTTACACCTTCAAGG + Intergenic
1163700031 19:18782356-18782378 AGCCCCTCCCTCCTCCCTCAGGG + Intergenic
1163905932 19:20150148-20150170 CCCCCCCCCCACCTCCTTCCCGG + Intergenic
1164066690 19:21721720-21721742 CCCCCCTCCCCCCTCCTGGACGG - Intergenic
1164537957 19:29100441-29100463 TCCCCCTACCTCCTACCTGAAGG + Intergenic
1164698302 19:30263092-30263114 CCCTCCTCCCACCTCCTTCTCGG - Intronic
1165063429 19:33215972-33215994 TCCCCATCTCTCCCCCTGCAGGG - Exonic
1165064693 19:33222041-33222063 TCCCCAACCCTCCCCCGTCAGGG + Intronic
1165819328 19:38664678-38664700 TCCCCCAGCCCTCTCCTTCATGG - Intronic
1166163272 19:40967426-40967448 TCCCTCTCCCTCTCCCTCCACGG - Intergenic
1166203265 19:41252544-41252566 TCCTGCTCCCCGCTCCTTCAGGG + Intronic
1166343308 19:42151141-42151163 TCCCCCTCCCTCCTCCCATCTGG - Intronic
1166367361 19:42284364-42284386 TCCCTCTCCCTCCTCCCTCGCGG - Intronic
1166389158 19:42399445-42399467 TCACCCTACATCCTCCTTCCTGG + Intergenic
1166888542 19:45975540-45975562 TCCCCCTCCATCTTCCTGGAGGG + Intergenic
1167247610 19:48383157-48383179 TCCCCATCCCGCCTCCTGCCGGG - Exonic
1167348970 19:48963291-48963313 TCCCCCTCCCCTCTCTCTCAGGG + Intergenic
1167445554 19:49535089-49535111 TGCCCCTCCCTCCCCCTCCTGGG + Intronic
1167720591 19:51177510-51177532 TCCACGTCCCTCCTCCATGAAGG + Intergenic
1167747785 19:51362967-51362989 CCCTGCTCCCACCTCCTTCATGG + Intronic
1167792047 19:51689187-51689209 TCCCGCTCCCTCCTCCTCCCCGG + Intergenic
1167937277 19:52919178-52919200 TCCCTCTCCCTCTCCCTCCACGG + Intergenic
1167971229 19:53188567-53188589 TCCCTCTCCCTCTCCCTCCACGG - Intronic
1167987921 19:53334151-53334173 CCCACCTCCCTCCTCGTTCCAGG + Intronic
1168003628 19:53468230-53468252 CCCACCTCCCTCCTCCTGCCGGG + Intronic
1168252660 19:55149254-55149276 TCCCCCTCCCTCTCCCCTCGGGG - Exonic
1168276905 19:55283945-55283967 TCCCCCTCCCCCCTCCGAAAGGG + Intronic
1168294210 19:55370710-55370732 GTCCCCTCCCTCCACCTCCACGG + Intergenic
1168724949 19:58575934-58575956 TCCCCTTCCCTCCTCTGTCTTGG + Intergenic
1202714513 1_KI270714v1_random:34696-34718 TACCCATCCCTCCTCCATGAGGG + Intergenic
925445170 2:3920909-3920931 TCCCCTTCCCTTTTCTTTCAGGG + Intergenic
925751190 2:7091474-7091496 TCCACCTTCCTCCTCCTCCAGGG - Intergenic
925912247 2:8581548-8581570 TCCGCCTGCCACCTCCTGCAGGG + Intergenic
926436808 2:12846578-12846600 AACCCCTGCCTCCTCCTTCTAGG - Intergenic
926526458 2:13987214-13987236 GCCCCCTCACCCCTCGTTCATGG - Intergenic
927150759 2:20194455-20194477 ACCCCATCCCTTCTCCATCAGGG + Intergenic
927592761 2:24371055-24371077 TCCTCCTACCTCATCCTTCCAGG - Intergenic
928005617 2:27558886-27558908 TCCCTCTCCCTCTCCCTCCACGG - Intronic
928207226 2:29294255-29294277 TTCTCTTCCCTCTTCCTTCAGGG - Intronic
928627352 2:33153939-33153961 TCCCCCAGCCCCCTCCTGCAGGG + Intronic
928933377 2:36648624-36648646 TTTGCCTCCCTCCTGCTTCACGG + Intergenic
929557896 2:42936854-42936876 TACCCTTCCCTCCTCTTTCCTGG - Intergenic
929654418 2:43716208-43716230 TCCCCCTCCTCCCTTCTTCCAGG - Intronic
929956118 2:46460053-46460075 TCCCCCTCCTTCCACCTTCCAGG + Intronic
930000744 2:46859990-46860012 CCTCCCTCCTTCCTCCTTCTGGG - Intergenic
930136305 2:47906377-47906399 TCGTCCTTCCTCCTCCTTAAAGG + Intergenic
932166243 2:69510194-69510216 CCTCCCACCCTCCACCTTCAAGG + Intronic
932222578 2:70011101-70011123 CCCCCCACCCTCCACCCTCAAGG - Intergenic
933244339 2:79958431-79958453 TCTGCCTCCCTCCTCCTTTAAGG - Intronic
933321709 2:80783516-80783538 TCTGACTCCCTCCTCCTTCTAGG + Intergenic
934136141 2:88998015-88998037 TCCCCTTCCCACCTCCTCTATGG - Intergenic
935471133 2:103462288-103462310 TCCTCTTCCATGCTCCTTCAAGG + Intergenic
936249185 2:110854344-110854366 TCCACATCCTGCCTCCTTCATGG - Intronic
936469083 2:112781987-112782009 TCACCTTCCTTCCTCCTTCCAGG + Intronic
936525183 2:113236559-113236581 TCCCCCGCCCTCCACCTGCCAGG + Intronic
936663622 2:114569955-114569977 TCTCCCTCCTGCCTCCTACATGG - Intronic
936807652 2:116356181-116356203 TCCCCCTCCTTCATAGTTCACGG - Intergenic
937080446 2:119136471-119136493 TCCCAGGCCCTCCTCCTTCCAGG + Intergenic
937336785 2:121067160-121067182 TTCTCCACCCTTCTCCTTCAGGG - Intergenic
937356375 2:121200513-121200535 TGCCTCTCCCTCCTCCTTCAAGG - Intergenic
937361534 2:121233276-121233298 TCCACCTCCCTCCGCCTCCCGGG + Intronic
937707282 2:124935656-124935678 ACCCCCTCCCTTCCCCTTGAAGG - Intergenic
938128382 2:128690678-128690700 ACCCCCTTCTTGCTCCTTCATGG + Intergenic
938320588 2:130359677-130359699 CCCTCCTCCCTCCTCCCACAAGG - Intronic
938493265 2:131776854-131776876 TACCTCTGCCTCCTCCTCCAGGG - Intergenic
938494037 2:131782709-131782731 TTCACCTCCCTCCTGCTTCTTGG + Intergenic
938499217 2:131821799-131821821 TACCTCTGCCTCCTCCTCCAGGG + Intergenic
938534111 2:132221851-132221873 TCCCCCTCCCCCCTCCCGGACGG - Intronic
938983102 2:136545309-136545331 ACCCACTCCCTTCTACTTCAGGG + Intergenic
939490776 2:142874005-142874027 TCCCTCTCCCTCCTACAACAGGG - Intergenic
939516986 2:143181640-143181662 TCCACCTCTCTCAGCCTTCAAGG + Intronic
939894653 2:147776840-147776862 GGCCCCCACCTCCTCCTTCAGGG + Intergenic
939956964 2:148535279-148535301 CCTTCCTCCTTCCTCCTTCATGG + Intergenic
942375192 2:175329203-175329225 TTCCCCTCCCTCCTTCCTTAAGG - Intergenic
942452924 2:176119720-176119742 TCCCCCTCCCTCCAACTTGTGGG - Exonic
942607796 2:177710324-177710346 TCACCTTGCCTCCTACTTCACGG - Intronic
942899941 2:181103340-181103362 TTCCCCTTCCTCCTCCTCCAGGG + Intergenic
943481097 2:188418873-188418895 TCCCCATTTCTCCTCCTGCAGGG + Intronic
944488299 2:200230434-200230456 TCACCCCTCCTTCTCCTTCATGG - Intergenic
944514339 2:200496734-200496756 TCCACCTGCCTCGGCCTTCAAGG + Intronic
944763904 2:202844976-202844998 TCCCCCTTCCTCCATCTTTAAGG + Intronic
944911325 2:204313316-204313338 TCCTCCTCTCTCTTCCTGCAAGG + Intergenic
945232776 2:207609808-207609830 TCCCTCTCCCTCTCCCTCCACGG + Exonic
945492841 2:210476494-210476516 TCCCCCTTCCTCCAGCTCCAGGG + Exonic
945653297 2:212591835-212591857 TCTAACTCCCTCCTCCCTCAAGG + Intergenic
945835988 2:214836340-214836362 TCCCTCTCCCTCTCCCTCCACGG - Intergenic
946163825 2:217851778-217851800 TCAGCCTCCCTCATCCTACAGGG - Intronic
946175348 2:217919082-217919104 TCTCCCTCCCTCCCTATTCAGGG - Intronic
946313335 2:218894929-218894951 TCCACCGCCCTCCTCCTTGAGGG - Intronic
946361056 2:219219567-219219589 TCGCCCTTCATCCCCCTTCAGGG + Exonic
946673074 2:222127389-222127411 TCCCCATCTCTTCTCCTTCCTGG - Intergenic
946751144 2:222896431-222896453 TCCCCCTCCCCCCTCCCGGACGG + Intronic
946845769 2:223857620-223857642 ATCTCCTCTCTCCTCCTTCAGGG + Intronic
946894545 2:224310018-224310040 GCTCCCTCCCTCCTTCCTCACGG + Intergenic
947595600 2:231409735-231409757 TCCCTCTGCCTCATCCTTCAGGG - Intergenic
947797965 2:232906204-232906226 ACCCCCCCCCACCTCCTTCCCGG - Intronic
947976284 2:234368958-234368980 CCACCCTCCCTCCTCCTTGCTGG + Intergenic
948187249 2:236031210-236031232 TCCTCCTCCCTCCTTCTTAGGGG - Intronic
948338998 2:237233938-237233960 ACCCCCTCCCTGCACCTTCCTGG - Intergenic
948586109 2:239020767-239020789 TCCCCCTCCTGCCTCCCTCTGGG + Intergenic
948600809 2:239106579-239106601 TCCTCCTCCCTCCTCCCAGAGGG + Intronic
948731707 2:239968262-239968284 GCCTCCTCCCTCCTCCTGAATGG - Intronic
948833605 2:240613207-240613229 TCCCCTCTCCTCCTCCTTCTGGG - Intronic
1168855188 20:1002866-1002888 TCCCCTTCTCCCCTCCTGCAGGG + Intergenic
1169010074 20:2243197-2243219 TCCCTCTCCCTCCACCTTCTTGG + Intergenic
1169134659 20:3190092-3190114 CCCCCCGCCCTCCTTCTTAAAGG + Intergenic
1169140133 20:3223145-3223167 TACCCCTCCATGCTCATTCATGG + Intronic
1169267799 20:4177264-4177286 TCCCCCTCCTTCCTCCAAGAGGG - Intronic
1169379612 20:5095358-5095380 TCCCCTTCCCTGAGCCTTCAGGG + Intronic
1169521902 20:6382983-6383005 TCCCGCTCACTCCTCTTCCAAGG - Intergenic
1170441998 20:16388772-16388794 TCTCCCTCCCTCCTTCTTTATGG - Intronic
1171049056 20:21838651-21838673 TCCCGCTCAATCCTCCTCCAGGG - Intergenic
1171455534 20:25269911-25269933 TCTCCCTCCATCCTTCTCCATGG + Intronic
1172107647 20:32526346-32526368 TCCCCGCCCCTCCTGCTTCTCGG - Intronic
1172109873 20:32538490-32538512 CCTCCCTCCCTCCTCCTTCATGG + Intronic
1172229736 20:33328614-33328636 TCCTCCTCCCTCCATCTTCCTGG - Intergenic
1172468716 20:35175515-35175537 TCCCCCTTCCCCCACCATCATGG + Intronic
1173331643 20:42080393-42080415 GCCCCCTGCAACCTCCTTCAGGG - Exonic
1173402391 20:42736988-42737010 TCCCCCTCCCAACTCCTTTTGGG - Intronic
1174281937 20:49445798-49445820 TCCCCCTCCCTGCTCTGGCAGGG + Intronic
1175203075 20:57291202-57291224 TCCCGCTCCCTGCACCTGCAGGG - Intergenic
1175374716 20:58516057-58516079 TCCCCCTCCCTCCTCCTTCCTGG - Intergenic
1175615451 20:60394403-60394425 TGCCCTTTCCTCCACCTTCAAGG + Intergenic
1175689268 20:61054031-61054053 TCCCCCTCCCTCCACCCACAAGG + Intergenic
1175790814 20:61738795-61738817 TCCTCCTCTCACCACCTTCACGG + Intronic
1175921029 20:62450801-62450823 CCCCCCTCCATCCTCCTCCCAGG + Intergenic
1175954579 20:62602818-62602840 TCCCCTGCTCTCCTCCTTCCAGG + Intergenic
1175954592 20:62602857-62602879 TCCCCCACTCTCCCCCTTCTGGG + Intergenic
1176268005 20:64220762-64220784 CCCCCCTCATTCCTCCTTGAGGG - Intronic
1176710576 21:10146340-10146362 TACCTCTTCCTCCTCCTCCAGGG - Intergenic
1177614847 21:23503583-23503605 TTCCCCTAGCTCCTGCTTCATGG - Intergenic
1178394709 21:32232737-32232759 TCCCTCTCCTTCCACCTTCCTGG - Intergenic
1178580010 21:33830520-33830542 ACTCCCTCCCTCCTCCCTCCCGG - Intronic
1178829655 21:36045263-36045285 TCTCCCTCGTTCCTCCTTCCGGG - Intronic
1179351715 21:40617484-40617506 ACCCCCTCCCAGCTCCTTCTAGG + Intronic
1179519661 21:41933767-41933789 TCCCCTCCCCTCCCCTTTCACGG - Intronic
1179580964 21:42343687-42343709 ACCCCCTTCCTCCTCCTTTGGGG - Intergenic
1179926835 21:44539373-44539395 TGCCCCTGCCTCCTCCTGCCAGG - Exonic
1179932549 21:44579834-44579856 TGCCCCTGCCTCCTCCTACCAGG - Exonic
1180180642 21:46117379-46117401 TCCTGCCCCCTTCTCCTTCAGGG + Exonic
1180201456 21:46227282-46227304 CCCACCTTCCTCCTCCCTCAAGG + Intronic
1180294656 22:10873490-10873512 TACCTCTGCCTCCTCCTCCAGGG - Intergenic
1180497462 22:15902904-15902926 TACCTCTGCCTCCTCCTCCAGGG - Intergenic
1180874905 22:19170677-19170699 TACACCTGCCTCCTCCTCCATGG + Intergenic
1181464404 22:23102990-23103012 CTCTCCTCCCTCCTCCCTCAAGG - Intronic
1181585939 22:23853825-23853847 TCCCTCTCCCTCTCCCTCCACGG + Intergenic
1181604148 22:23969994-23970016 TCCCTGTCCCTCCTCCTGCCAGG - Intronic
1181680844 22:24494956-24494978 TCCCCCTCCCGCCTCCCTCAGGG - Intronic
1181711881 22:24696230-24696252 TCCCCCTCCCCCCGGCTTCCTGG + Intergenic
1181959943 22:26615886-26615908 TCCTCCTCCCTCCTCCTTCTGGG - Intronic
1181960976 22:26621747-26621769 TCCACCTCTCTCCTTCTTCGTGG + Intergenic
1182520930 22:30884232-30884254 TCCCCCTGCCTCAACCTGCAGGG + Intronic
1182616811 22:31593135-31593157 ACCCCCCCCCACCTCCTTCCCGG + Intronic
1183093639 22:35540130-35540152 TCCAGCGCCCTCCTCCTTCGCGG - Intergenic
1183345648 22:37306172-37306194 TCCCCCTCCCACAGCCCTCAGGG - Intronic
1183573915 22:38674970-38674992 TCGCCTGCCCTCCTGCTTCATGG + Intergenic
1184119055 22:42438496-42438518 CCCCTCTCCCTCCTCCTTGTAGG + Intergenic
1184201192 22:42971096-42971118 TCCCTCTCCCTCTCCCTCCACGG + Intronic
1184465440 22:44666728-44666750 TCTCCCTCCCTCCTCCCTCCTGG - Intergenic
1184678102 22:46054292-46054314 TCCCCCCTCCTCCTGCTTCGCGG + Intronic
1184757784 22:46526632-46526654 TCGCCCTCCCTCAGCCTCCAGGG + Intronic
1184797756 22:46741674-46741696 TCCTCTGCCCTCCACCTTCAAGG + Intergenic
1185178046 22:49341650-49341672 TCTCCCTCTCTCAGCCTTCATGG - Intergenic
949938314 3:9134673-9134695 TCCTGCTGCCTCCTCTTTCAAGG + Intronic
950090470 3:10290989-10291011 CCTCCCTCCCTCCTCCACCAGGG - Exonic
950173502 3:10855455-10855477 TCTCCCACCCTCATCCTTCTTGG + Intronic
950482731 3:13254680-13254702 TTTTCCTCCCTCCTCCTCCATGG + Intergenic
950488896 3:13290166-13290188 CCCCCCTCCCTCCATCTTCCTGG - Intergenic
950667343 3:14505576-14505598 TGTGACTCCCTCCTCCTTCACGG + Intronic
951664151 3:25103377-25103399 TTCCCCTTCCTCCTCTTTCATGG + Intergenic
951722856 3:25720191-25720213 TCCCCATCCCTACTCCTTATAGG - Exonic
951847201 3:27097222-27097244 TTCACCACCCTCCTCCTTCTGGG - Intergenic
951864231 3:27289361-27289383 TGCCACTACCTCCTCCTTTAAGG + Intronic
952171380 3:30810869-30810891 TCCCTCCCCCTCCTGCTACAAGG + Intronic
952250317 3:31647188-31647210 TCCTGCTCCCTCCTACTTGAGGG - Intergenic
952762830 3:36930224-36930246 TCCTCCCCGCTCCGCCTTCAAGG - Intronic
953071941 3:39529655-39529677 TCCTCCTGCCACCTCCTTCGGGG - Intergenic
953250623 3:41243423-41243445 TCTCCCTGTCTCCTCCTGCAAGG - Intronic
953305079 3:41821570-41821592 TCCCCATCCTCCCTTCTTCAGGG + Intronic
953796872 3:45992685-45992707 CCCCTTTCCCACCTCCTTCAAGG - Intronic
954199319 3:49014804-49014826 ACCCTCTTCCTCTTCCTTCAGGG + Exonic
954257465 3:49416611-49416633 ACCCCATCCCTGCTCCTCCAGGG - Intergenic
954294401 3:49666124-49666146 TCTCCCTCCTTGCCCCTTCAGGG + Intronic
954413636 3:50382233-50382255 TGTGCCTCCTTCCTCCTTCAGGG + Intronic
954486140 3:50853458-50853480 TCTCCCTCCTTCCTGCTTCTTGG + Intronic
954613734 3:51959197-51959219 TCCCCCTGCCTCCTTGTGCAGGG + Intronic
954716032 3:52527434-52527456 CCCCCATCCCTCCTCCGTAAAGG + Intronic
954750563 3:52811157-52811179 TGGCCCTCCCTCCCCTTTCACGG + Intergenic
954752533 3:52821709-52821731 ACCTGCTCCCTCCTCCCTCAGGG + Intronic
954873804 3:53787556-53787578 TCCCTCTCCCTCCTCCACCTGGG + Intronic
955458234 3:59149332-59149354 TCACTCTCCATCCTCCTTCTGGG + Intergenic
955549130 3:60064527-60064549 TCCCTGTCCCTCATCATTCAGGG - Intronic
956124464 3:65998175-65998197 TCCTCCTCCCCCAGCCTTCATGG + Intronic
956178080 3:66493077-66493099 CCCTCCTCCCTCCTCCCTCAAGG + Intronic
957358646 3:79125516-79125538 TCCCCCTCTCTACATCTTCAGGG + Exonic
958268113 3:91463953-91463975 TCTCCCACCCTCCACCCTCAAGG + Intergenic
958432569 3:94059818-94059840 TCCTCCTGCCTCGGCCTTCAGGG - Exonic
958461126 3:94397261-94397283 TCCTACTCCCTCATCCTTCTGGG - Intergenic
960033822 3:113083114-113083136 TCTCCCACCCTCCACCCTCAAGG - Intergenic
960780802 3:121314580-121314602 TCCCTCTCCCTCTCCCTCCACGG - Intronic
960999977 3:123367626-123367648 GCCCCCTCCCTCCACCTACACGG - Intronic
961092889 3:124130244-124130266 TTTCACTCTCTCCTCCTTCATGG - Intronic
961108556 3:124263467-124263489 TCCCCCTGCCTCAGCCTTCCAGG - Intronic
961333952 3:126159032-126159054 TTCCCCTTCTTCCTCCATCAGGG - Intronic
961565152 3:127758245-127758267 TGCCCCGCCCTCCTCCTCCAAGG + Intronic
961617566 3:128194982-128195004 CCCTCCTCGCTCCTCCTTCTTGG + Intronic
961786253 3:129348815-129348837 TCCCTCCCGCACCTCCTTCAGGG - Intergenic
962280534 3:134048709-134048731 TCCCTCTCCCTCATCCTTCCAGG + Intronic
962537472 3:136342860-136342882 TCCCCACCCCTCTTCCTACAGGG - Intronic
962708092 3:138064014-138064036 TGCCCGTCTCTCCTCCATCAGGG - Intronic
962846164 3:139275560-139275582 TCATCCTCCCTCCTGCTTCAGGG - Intronic
963205912 3:142634220-142634242 TGTTCCTCCCTCCTCCTTCAGGG - Intronic
965159033 3:165106988-165107010 TCTCCCTCCCTCCCCCTTCTAGG - Intergenic
965302004 3:167017476-167017498 TCCCTCTCCCTCTCCCTCCACGG + Intergenic
965302028 3:167017563-167017585 TCCCTCTCCCTCTCCCTCCACGG + Intergenic
965302038 3:167017594-167017616 TCCCTCTCCCTCTCCCTCCACGG + Intergenic
965302046 3:167017619-167017641 TCCCTCTCCCTCTCCCTCCACGG + Intergenic
965302104 3:167017836-167017858 TCCCTCTCCCTCTCCCTCCACGG + Intergenic
965302114 3:167017867-167017889 TCCCTCTCCCTCTCCCTCCACGG + Intergenic
965302122 3:167017892-167017914 TCCCTCTCCCTCTCCCTCCACGG + Intergenic
966784148 3:183608776-183608798 TCCCCCTCCCCCCTCCCGGACGG - Intergenic
967149738 3:186637586-186637608 TGCCTCTCCCTCCTCACTCAGGG + Intronic
967596108 3:191328550-191328572 TCCCCCTTCCTCCACCGACATGG - Intronic
968066695 3:195762945-195762967 GCCCCCTCCCATCTCCTTCCAGG - Exonic
968081229 3:195848040-195848062 TCACCCTCTCCCCTCCTCCATGG + Intergenic
968285185 3:197504508-197504530 TCCCCATCCCTCCGTCTGCAGGG + Intergenic
968462498 4:732373-732395 TTCCCCTCCCTCTCCCTTCCTGG + Intronic
968506982 4:975340-975362 TCCCTCTCCCTCTCCCTCCACGG + Intronic
968680544 4:1915880-1915902 TCCCCCTCCCTCCTCTCACCTGG + Intronic
969032692 4:4227061-4227083 TGCCCCTTCGTCCTCCGTCAAGG + Intergenic
969215519 4:5719317-5719339 TCTCTCTTCCTCCTCCTTGATGG - Exonic
969319579 4:6403618-6403640 TCCCCCTGCCTCGTCCTCCCAGG - Intronic
969345082 4:6564914-6564936 ACCCCCTCCCTCTTCCTTCTTGG + Intergenic
969391239 4:6892582-6892604 TCCTGCTCCCTCCTCCCACAGGG - Intergenic
969842063 4:9889985-9890007 TCGCCACCCCTCCTCCTTCATGG + Intronic
969847812 4:9933364-9933386 TCACCCTCCCTCCCCTTTCCAGG - Intronic
970012888 4:11480000-11480022 TCCCTCTCCTATCTCCTTCAGGG - Intergenic
970542588 4:17094753-17094775 TCTCCCTCCCACCTCCTAAATGG + Intergenic
971049821 4:22849040-22849062 TCCGCCTCCCTCCACCTCCCAGG + Intergenic
971422912 4:26490366-26490388 ACTCCCTCCCTGCTCCTCCACGG - Exonic
972691813 4:41406508-41406530 TCCCCCTCCCTCCCTCTCCAGGG + Intronic
973607129 4:52599234-52599256 TCCCCCTGCCATTTCCTTCAGGG - Intronic
973752170 4:54032276-54032298 TCCCCCTCCCTCTCCCTCTACGG + Intronic
974890865 4:67880737-67880759 TCCTCCTACCTCGGCCTTCAGGG + Intronic
975814780 4:78206283-78206305 GGCCCCTTCCTCCACCTTCATGG - Intronic
976088116 4:81427163-81427185 TTCTCCTCCCTCCTCCTACAAGG - Exonic
976265717 4:83185584-83185606 TCCCCCTCCCCCCTCCCGGACGG + Intergenic
976335594 4:83881908-83881930 TCCTCCTGCCTCAGCCTTCAGGG - Intergenic
979249939 4:118556693-118556715 TCCCCTTCCTTCCTGCTTCAAGG + Intergenic
979598003 4:122555723-122555745 TCTCCCTCACTCCTGCTTCCTGG + Intergenic
979692278 4:123572825-123572847 TCTCCCTGCCTCCTCCCTCTAGG - Intergenic
980159416 4:129141332-129141354 TCTCTGTCCCTCCTACTTCAAGG - Intergenic
980847712 4:138343789-138343811 TCCCCTTCCTTCCTCCTGCTTGG - Intergenic
980969352 4:139555397-139555419 TCCCCCTCCCCCTTCCTGCTTGG - Intronic
981044348 4:140252346-140252368 TGCCTCTCCCTCCTCCTGCAAGG + Intergenic
981534906 4:145789072-145789094 TCACTCTGCCTCCTCCTTCTTGG + Intronic
982232824 4:153224310-153224332 TCCACCTCCCTTCTCCCTTAGGG + Intronic
983129305 4:163995436-163995458 ACCCTCTCCCTCCTCCTTGGAGG + Intronic
983383551 4:167027807-167027829 ACCCCCTTCCTCCTCCTCCTCGG - Intronic
984671211 4:182489889-182489911 TCCTCCTCTCTCCCCCTTCTGGG + Intronic
984804415 4:183737793-183737815 TCCCTCTCCCTCTCCCTCCACGG - Intergenic
985044060 4:185922409-185922431 TCCCCATCCCTGATCCTTCATGG + Intronic
985084148 4:186295940-186295962 GGCCTCTCCCTCCTCCTTCTCGG + Intergenic
985510568 5:311038-311060 TCCCACTCACTCCTCCTTCCGGG + Intronic
985527866 5:416135-416157 TCCCCCTGCGTCCTCCACCAGGG - Intronic
986114203 5:4753485-4753507 TCCCTCTGCCTCCTCCTACAAGG - Intergenic
986312133 5:6558499-6558521 TTCCCCTTCCTCCTCCTTTAGGG - Intergenic
986315896 5:6586166-6586188 ACCCCCTCCCTCCTCCTCCCTGG + Intergenic
986690295 5:10308073-10308095 CCTCCCTGCCTCCTCCCTCAAGG - Intergenic
986786360 5:11117822-11117844 TCCCCCACCCTCCACGGTCATGG - Intronic
988722407 5:33892041-33892063 TTCCCCTCCCTCCTCCTAAAAGG + Exonic
989587659 5:43087554-43087576 TCCCCCTCCCCCCTCCCGGACGG + Intronic
990352602 5:54933825-54933847 TCCTTCTCCCTCCTCATTCAGGG + Intergenic
990382713 5:55232550-55232572 CCCGCCTCCCCCCTCCTTCCCGG - Intronic
990447073 5:55903356-55903378 AGCCCCTCCCTGCTTCTTCAAGG + Intronic
990683247 5:58269807-58269829 TCTCATTCCCTCCTGCTTCATGG + Intergenic
990760886 5:59127951-59127973 TAGCCCTCTCTTCTCCTTCAGGG - Intronic
990888822 5:60625692-60625714 TCTACCCCCCTCCTCCTTCAGGG + Intronic
991563715 5:67982801-67982823 TCCCCCTCCCAAATCCTCCAAGG + Intergenic
992688965 5:79224666-79224688 TCTCCCTCCCTCCTTGCTCAGGG - Intronic
992876969 5:81065921-81065943 TCCCCCTCCCTGCGCTTCCAAGG - Intronic
993934908 5:93987227-93987249 TCTCCCACCCTACTCCTTCTAGG - Intronic
994915706 5:105975937-105975959 TTCCCTTTTCTCCTCCTTCAGGG + Intergenic
995522791 5:113026867-113026889 TCCTCTTTCCTCCTGCTTCATGG - Intronic
995744875 5:115392993-115393015 TTCCCCTCACTTCTGCTTCATGG + Intergenic
997002382 5:129776955-129776977 ACCCCCACTCTCCTCCTTCGTGG - Intergenic
997329030 5:133045704-133045726 TCCCCCTGCCTCAGCCTTCCAGG - Intergenic
997337457 5:133118310-133118332 TCCCTCTCCCTCCTGCCCCAGGG - Intergenic
997661400 5:135591852-135591874 GCTCCCTCCCTCCTGCTTCCTGG + Intergenic
997746938 5:136307610-136307632 TCCCCCTCCCCCTTCCTCCAAGG + Intronic
997813331 5:136993404-136993426 AGCCCCTCCCTCTTCCCTCAGGG + Intronic
998151757 5:139761571-139761593 TCCCCTTCACTCCTCCTCCGTGG + Intergenic
998405478 5:141872128-141872150 ACCCCCCCCCTCCACCTGCATGG + Intronic
998658082 5:144204984-144205006 CCCTCCCCCCTCCTCGTTCACGG - Intronic
999057603 5:148596669-148596691 CCCCCCTCCCTCCACCACCAGGG - Intronic
999331705 5:150677907-150677929 TCCCCCTCACACCCCCTTCATGG - Exonic
999575105 5:152967387-152967409 CCCACCTCCCGCCACCTTCATGG + Intergenic
999854533 5:155579826-155579848 TGCCCCATCCTCCTCCTTGAGGG - Intergenic
1000248276 5:159468472-159468494 GCCCCCTTCCTCCATCTTCAAGG - Intergenic
1001080738 5:168665478-168665500 TGGCCCTCTCTCCTCCTTCCAGG - Intronic
1001595421 5:172895759-172895781 TCATCATCCCTCCTCCTCCATGG - Intronic
1001763689 5:174227852-174227874 TCCCACTCCTTCCTCCGGCAGGG - Intronic
1001866901 5:175113969-175113991 TTCCCTTCCCTTCTCTTTCACGG - Intergenic
1002089817 5:176797884-176797906 GCCCCTTCCCTCCTCCATCGCGG - Intergenic
1002176673 5:177404733-177404755 GCACTCTCCCTCCTCCTTCCTGG + Intronic
1002340511 5:178513768-178513790 GGCCCCTCCCTCCATCTTCACGG + Intronic
1002529546 5:179835671-179835693 TCCCTCTCCCTCTTTCTCCACGG - Intronic
1003514373 6:6805891-6805913 TCCCCCTTCCTCTTGCTTCCTGG + Intergenic
1003561394 6:7183682-7183704 TCCCCCTCCTTTCTTCTCCAGGG + Intronic
1003975730 6:11342236-11342258 TCTCTCTCTCTCCTCCTTCTGGG - Intronic
1003993058 6:11506861-11506883 TCTCCCTCCCTCCACCCTCAAGG - Intergenic
1004041789 6:11986395-11986417 TCCCCTTCCCTCCTCTACCAAGG + Intergenic
1004199033 6:13531068-13531090 TCCCTCTTCTTCCTCCTTAAAGG - Intergenic
1004285746 6:14318912-14318934 CCTCTTTCCCTCCTCCTTCAAGG + Intergenic
1004495286 6:16157125-16157147 TCCCCCTCTCTCCTCACTCCTGG + Intergenic
1004536591 6:16509091-16509113 TCCCCCTTCCCCCTCCCTCCTGG - Intronic
1004587090 6:17013033-17013055 TCCCACTCCCACCTCCTCTAAGG - Intergenic
1005995943 6:30931545-30931567 TCCTCCTCCATCTCCCTTCAGGG - Exonic
1006401600 6:33821028-33821050 GCCCCCTCCCTCCTCCTCCATGG - Intergenic
1006514137 6:34536696-34536718 CCCCCCACCCTCCTCCTACAAGG + Intergenic
1006860573 6:37169736-37169758 TCCCCATCCTTCCTCCCTCGCGG + Intergenic
1007175572 6:39894539-39894561 CCCCCCTCCCTCCTCTCTAAAGG + Intronic
1007307907 6:40921492-40921514 TCCCCCTTCCTCCCTCTGCAGGG - Intergenic
1007528507 6:42519352-42519374 TCCACCTCCCTCCGCCTCCTAGG + Intergenic
1007717585 6:43866174-43866196 GCCCCTTCCCTGCTCCTGCATGG - Intergenic
1007808873 6:44472502-44472524 TCCCCTCCCATCCTGCTTCAGGG + Intergenic
1008164630 6:48120982-48121004 ACTCCCTTCCTTCTCCTTCATGG - Intergenic
1008433117 6:51444223-51444245 TCTCCCTCACTTCTCCTTCTGGG + Intergenic
1008480526 6:51981356-51981378 TCCCTCTCCCTCTCCCTCCACGG + Intronic
1008801966 6:55379309-55379331 TCCTCCTCCCTCCCCCATCAGGG + Intronic
1009702640 6:67202766-67202788 TGCCCCTCTCTCCTCCATGAAGG + Intergenic
1009803070 6:68567337-68567359 TCTCCCTCCCTCCTCCCTTTTGG + Intergenic
1010026738 6:71227391-71227413 GCCCCTTCCCTCTTACTTCAAGG + Intergenic
1010252986 6:73727543-73727565 TCCTACTCTATCCTCCTTCAGGG - Intronic
1010541671 6:77099413-77099435 TTCTCCTCTGTCCTCCTTCATGG + Intergenic
1011277356 6:85643515-85643537 TCCCCCTCCCTCTCCCCTCCAGG + Intronic
1012123835 6:95401052-95401074 TCCCCCTCCCACCACCATGACGG + Intergenic
1012406164 6:98901247-98901269 TCACCCTCTCGCTTCCTTCAGGG - Intronic
1012420709 6:99061837-99061859 TCTCCCTCTCTCTTCCTTCAAGG - Intergenic
1013287329 6:108692730-108692752 TGGCCCTCCCTCCGTCTTCAAGG - Intergenic
1013376357 6:109518957-109518979 TCCCCAACCCTCCTCCTTCTAGG + Intronic
1013466977 6:110426487-110426509 CACCCCTCCCTCCTCCTGGAGGG + Intronic
1014557100 6:122849407-122849429 ACCCCCTCCCACCTCCCTCCCGG + Intergenic
1016287928 6:142493963-142493985 CCTCCCACCCTCCTCCCTCAGGG - Intergenic
1017256193 6:152336432-152336454 TCCCCCTCCAGCCCCATTCACGG - Intronic
1017793551 6:157822818-157822840 GCCCCCTCCCGCCTCATGCACGG + Intronic
1017967468 6:159278627-159278649 TCCCCCTATCTCCTCCTACTGGG - Intergenic
1018313851 6:162537550-162537572 TCCCACTGCCACCTCCTCCAAGG + Intronic
1018735720 6:166685935-166685957 TCCCCCTCCCTCCTAGGGCATGG - Intronic
1019323108 7:424570-424592 TCTCCCTCCTACCTCCTTCCTGG + Intergenic
1019459308 7:1147947-1147969 TCCCTCTCCCTCTCCCTCCACGG - Intergenic
1019521924 7:1464761-1464783 CCCCCCCCCCCCCACCTTCAAGG + Intergenic
1019568693 7:1697672-1697694 CCCCCACCCCTCCTCCTTCCGGG + Intronic
1019603342 7:1896122-1896144 TCCGCCTGCCTCCTCCTCCTGGG + Intronic
1019659079 7:2213768-2213790 TCACCCTCCCTCATGCTCCAGGG - Intronic
1019777824 7:2923018-2923040 TCCAGCTCCCTCCTCCTGCCCGG + Intronic
1019860386 7:3653271-3653293 TCCCCTTCCCTCCTCACTCCAGG + Intronic
1019879135 7:3842749-3842771 TCTCCCTCACTTCTTCTTCACGG + Intronic
1020083575 7:5298966-5298988 TCCCACTCCATCCTCCCTCCAGG + Exonic
1021876554 7:25054867-25054889 TCCCCATCCCTCCTTCTCCTGGG + Intergenic
1022108532 7:27213730-27213752 TCCCCCTCCCTCCTCTATGATGG + Intergenic
1022993861 7:35733860-35733882 TGCCCCTGCATCCCCCTTCATGG - Intergenic
1023043596 7:36193480-36193502 TCCCTCTGCCTCTGCCTTCAGGG - Intronic
1023264777 7:38393470-38393492 GCCCCCTCCCGCCTCATGCACGG + Intronic
1023859203 7:44207250-44207272 TCCCCCTCATTCCTCCTTCCTGG + Intronic
1024306382 7:47932730-47932752 TCAGCCTCCCTCCTCCCACATGG + Intronic
1024325162 7:48103761-48103783 TCCTCCTCCCTAATCCTGCAGGG + Intronic
1024538958 7:50460347-50460369 TGACCCTCCCACCTCCTTCCTGG - Intronic
1025210708 7:57018227-57018249 TCCCACTCCATCCTCCCTCCAGG - Intergenic
1025661248 7:63558620-63558642 TCCCACTCCATCCTCCCTCCAGG + Intergenic
1025821365 7:64967665-64967687 CCCCCCCCCCACCTCCTTCCCGG + Intergenic
1025979694 7:66395057-66395079 TCCCCCTCCCTCTCCCTCCACGG - Intronic
1026161863 7:67876495-67876517 ACCCCTACCCTCCTCCCTCAAGG + Intergenic
1026166817 7:67917514-67917536 TCCCCCTCCCGCCCCCTGCCAGG - Intergenic
1026360822 7:69599555-69599577 GAGCCCTCCCTCCCCCTTCACGG - Exonic
1027140172 7:75651102-75651124 TGCCCCTCCCTCCTCCTGTGTGG - Intronic
1027581799 7:80005936-80005958 ATCTCCTCCCTCCTCCTTCAGGG - Intergenic
1028223109 7:88219768-88219790 TCCCCGTCCCTTCTCCTGGATGG - Intronic
1029068264 7:97873865-97873887 TCCCTTGCCCTCCTCTTTCAGGG + Intergenic
1029419804 7:100466770-100466792 AAGCCCTCCCTCCTCCATCAAGG + Exonic
1029445168 7:100607915-100607937 AACCCCTCCCTCCTTCTTCCAGG + Exonic
1029469481 7:100745227-100745249 TTCCCTTCCCTCTTCCTTCCCGG + Intronic
1030022875 7:105293047-105293069 CCCCCCTCCCTCCTCCCCCTTGG - Intronic
1030068616 7:105679444-105679466 TCCCACTCCCTCTTCGCTCAGGG + Intronic
1030148474 7:106379680-106379702 TCCCCATGCCTCCCCCATCACGG + Intergenic
1030183182 7:106732065-106732087 TTCCCCTCCCTGCTCTTTCAAGG + Intergenic
1030685237 7:112479684-112479706 TCCATTTCCTTCCTCCTTCAGGG + Intronic
1031545339 7:123045369-123045391 TCTTCCTCCTTCTTCCTTCATGG + Intergenic
1031586235 7:123534754-123534776 TCTGCCGCCCTCCTCCTTCCCGG - Intronic
1031995767 7:128229875-128229897 TCAGCCTCCCTCCTCCTGAAAGG - Intergenic
1032075379 7:128833447-128833469 TCCCTCTCCCTCCTCCCTCTCGG - Intronic
1032163253 7:129526525-129526547 TCCCCGTCCCTCATCCTCCCTGG - Intergenic
1032787483 7:135211914-135211936 TCCCCTGCCCTCCTCCTACACGG + Intergenic
1033535483 7:142308283-142308305 CCTCCCTCCCTGCTCCTTCCCGG - Intergenic
1034251227 7:149692586-149692608 TCTCCCTGGCTGCTCCTTCAGGG - Intergenic
1034313957 7:150112634-150112656 CCTCCCTCCCTCCTCCATCAAGG + Intergenic
1034411707 7:150945550-150945572 CTCCCCTTCCTCCTCCTCCATGG - Intronic
1034699318 7:153082942-153082964 TCCAGCTGCCTCCTCCTCCATGG - Intergenic
1034792939 7:153988158-153988180 CCTCCCTCCCTCCTCCGTCAAGG - Intronic
1035253904 7:157614091-157614113 TCCTCCTCCCACCTCTTTCATGG - Exonic
1035347110 7:158208189-158208211 TCTCTCTCCCTCCTCTTTAAGGG - Intronic
1035519936 8:267189-267211 GCCCCCTACATCCTCCTCCAGGG - Intergenic
1036223692 8:6941203-6941225 TCCCACTCACTCCTCCCTGAAGG - Intergenic
1036494566 8:9258522-9258544 TCCTCCTCCCTCCAGCTTCCAGG - Intergenic
1036589038 8:10151079-10151101 TCCCCTAACCTCCTCCTTTACGG - Intronic
1036593342 8:10189855-10189877 TCCCCCTTCCTCTTTTTTCAAGG + Intronic
1036630534 8:10511147-10511169 CCCTCCTCCCACCTCCTACACGG + Intergenic
1037876269 8:22550245-22550267 TCCCCATCTCTCCGCCTTCCTGG + Intronic
1037946104 8:22990602-22990624 ACCCTCTTCCTCCTCCTTCTGGG - Intronic
1038238051 8:25781107-25781129 CCCCCTTCTCTCCTCCTTCTTGG + Intergenic
1038930420 8:32187894-32187916 TCCCACTCCCACCTCCTCCTTGG + Intronic
1039053049 8:33512308-33512330 TCCACCTTCCTCCTCCTTGGAGG + Exonic
1039405620 8:37309968-37309990 TCTCCCCCACTCATCCTTCAGGG + Intergenic
1039469301 8:37803565-37803587 TCCCCTTCCTCCCTCCTCCAGGG + Intronic
1040070185 8:43181078-43181100 TCCCTCTCCCTCTCCCTCCACGG - Intronic
1040356013 8:46619073-46619095 TCCCTTGCCCTCCTCTTTCAGGG + Intergenic
1040818477 8:51533504-51533526 TCCCTCTCCCTCTCCCTCCACGG + Intronic
1041174765 8:55183953-55183975 TCCCCCTGCCAGCTCCATCAAGG + Intronic
1041914035 8:63121687-63121709 CCTCCCACCCTCCTCCCTCAAGG + Intergenic
1042094251 8:65194915-65194937 TCCCTCTGCCTCCTCTTTTAAGG - Intergenic
1042212237 8:66392336-66392358 TTCCCCTCCCTTCTCCTAGAAGG + Intergenic
1042289738 8:67157074-67157096 TCCCCCTTCTTCCTACTCCATGG - Intronic
1042377226 8:68065891-68065913 TCCCCTTCCCTCCAGCTTTATGG + Intronic
1042850374 8:73210756-73210778 TCCCCCTCCTTCATCCCCCATGG + Intergenic
1043009130 8:74859806-74859828 GGCTCCTGCCTCCTCCTTCAAGG + Intergenic
1043870472 8:85426211-85426233 TCCAGCTCCCTCCTCATTAAAGG - Intronic
1044253631 8:90033969-90033991 TCTACATCCCTCCTCTTTCATGG + Intronic
1044493397 8:92847345-92847367 TACCCCTCCTTCCTCCCTTATGG + Intergenic
1044880123 8:96715211-96715233 TCCCCCAGCCTCCTCTATCAAGG - Intronic
1046541461 8:115589085-115589107 TTCCCCTTCCTCATCCTCCAAGG - Intronic
1047259197 8:123241076-123241098 CCGCCGTCCCTCCTCCTCCACGG - Intronic
1048065631 8:130965329-130965351 TCCCCCTCCATCCTCCCTTTTGG - Intronic
1048295554 8:133211116-133211138 TCCTCATCCCTGGTCCTTCAAGG + Intronic
1048301082 8:133251863-133251885 TCCCTCTCCTTCCTCTTTTAAGG - Intronic
1048315524 8:133359008-133359030 TCCACCTCCCACCTCCCTCCTGG - Intergenic
1048443409 8:134476407-134476429 TCCCTCACACTCCTCCCTCAAGG - Intergenic
1048701253 8:137092199-137092221 CTCCCCTCCATCCTCCTTCCTGG - Intergenic
1049157427 8:141075521-141075543 CCACCCTCCTTCCTCCTTCTTGG + Intergenic
1049353799 8:142177916-142177938 TCCTCCTTCCTCCTCCAACAGGG - Intergenic
1049416420 8:142497573-142497595 TCCTCCTCCCTCCTCAATCATGG - Intronic
1050552927 9:6763150-6763172 TCCCCCCTGCTCCTGCTTCAAGG + Intronic
1051592664 9:18792172-18792194 TCATCCTCCCTCCTCCCTCATGG + Intronic
1051907608 9:22114494-22114516 TTCCTCTCCTTTCTCCTTCATGG - Intergenic
1052835074 9:33244433-33244455 TCAACTTCCCTCATCCTTCATGG - Intronic
1052995985 9:34551865-34551887 TGGCCCTCCTTCCTCCCTCAGGG - Exonic
1053033004 9:34798362-34798384 TCTCCCTCCCTCCTGCTTTTTGG + Intergenic
1053468087 9:38324979-38325001 TGCCCCCCCCACCTCCTTCCCGG - Intergenic
1053647556 9:40132036-40132058 TACCTCTGCCTCCTCCTCCAGGG - Intergenic
1053758175 9:41331807-41331829 TACCTCTGCCTCCTCCTCCAGGG + Intergenic
1053781230 9:41608940-41608962 ACCCCCTCCCTCACCTTTCAGGG + Intergenic
1054169176 9:61819093-61819115 ACCCCCTCCCTCACCTTTCAGGG + Intergenic
1054328534 9:63729990-63730012 TACCTCTGCCTCCTCCTCCAGGG - Intergenic
1054537023 9:66244134-66244156 TACCTCTGCCTCCTCCTCCAGGG + Intergenic
1054668356 9:67761723-67761745 ACCCCCTCCCTCACCTTTCAGGG - Intergenic
1055441249 9:76338641-76338663 TGCCCATCCCCCATCCTTCAAGG + Intronic
1055679180 9:78697012-78697034 TCCCCCGCCCTCCAACTTCAAGG - Intergenic
1055829668 9:80363126-80363148 CCCCCCTCCCTCTCCCTTCTAGG + Intergenic
1056103997 9:83328982-83329004 TAACCCTCTCTCCTTCTTCATGG + Intronic
1056188417 9:84160602-84160624 TGTCCTTCCCTCCTCCCTCATGG + Intergenic
1056507697 9:87272963-87272985 CCTCCCACCCTCCACCTTCAAGG - Intergenic
1056959155 9:91106362-91106384 TCCCCCCATCTCCTCCCTCATGG + Intergenic
1057122192 9:92586432-92586454 TCCCCCAGCCTCCTCCTTCGAGG - Intronic
1057217427 9:93236781-93236803 TCCCCACACCTCCTCCTTGAGGG - Intronic
1057350518 9:94293261-94293283 TCCATCTCCTTCCTCCATCAGGG + Intronic
1058281064 9:103115400-103115422 GCCCCTTCCCTAGTCCTTCAGGG - Intergenic
1058863517 9:109140445-109140467 TCCCCTTCCCTCCTCTCCCAGGG - Intronic
1059336530 9:113572566-113572588 CCCACTGCCCTCCTCCTTCAGGG - Intronic
1059801149 9:117750737-117750759 TCCTCTTCCCTCAGCCTTCAAGG + Intergenic
1059958897 9:119545998-119546020 TTCCACTCCTTCCTCCTTGAGGG - Intergenic
1060104618 9:120865959-120865981 CTCCCCTCCCTCCTCCCTCCTGG - Intronic
1060337162 9:122736106-122736128 TTCCCCTCCCTCTTCCATCAGGG + Intergenic
1060788680 9:126470514-126470536 CCCCCCCACCTCCTCCTTCAGGG - Intronic
1060976101 9:127766130-127766152 TCCCCACCCCTTCTCCTACAGGG - Intronic
1061159492 9:128885016-128885038 ACCCCCGCCCTCCTCCTTCCTGG + Intronic
1061213363 9:129206197-129206219 TCCCCAACCCTCCTCCCACAGGG - Intergenic
1061263103 9:129490758-129490780 TCACAGTCCCACCTCCTTCAAGG + Intergenic
1061600581 9:131667400-131667422 TCCCACACCCTCTTCCTACACGG + Intronic
1061662070 9:132136822-132136844 AGCCCCTCCTTCCTCCCTCATGG + Intergenic
1061714426 9:132509933-132509955 TGCTGCTCCTTCCTCCTTCATGG + Intronic
1062041773 9:134407678-134407700 TCCCCAGCCCTCCTCCGTCCTGG + Intronic
1062050980 9:134446905-134446927 CCCCTGCCCCTCCTCCTTCACGG - Intergenic
1062117911 9:134818979-134819001 TCCCCCTGCCTCCTCCCACAGGG + Exonic
1062280604 9:135750077-135750099 TGCCCCTCTCTGCTTCTTCAGGG + Exonic
1062711519 9:137977716-137977738 CACTCCTCCCTCCTCCCTCAGGG - Intronic
1202795337 9_KI270719v1_random:115335-115357 TACCTCTTCCTCCTCCTCCAGGG - Intergenic
1185884040 X:3766196-3766218 TCCCCCTCTCTCCCCCTTGTAGG + Intergenic
1186105253 X:6198700-6198722 TCTCTCTCTCTCCTCTTTCAAGG - Intronic
1186151474 X:6678986-6679008 ATCCCCTCTATCCTCCTTCAGGG - Intergenic
1186230615 X:7449822-7449844 TCTCCTTCCCTCCACCTTCCAGG + Intergenic
1186466419 X:9786942-9786964 TCCCCCTCCCTCCTCCGGGCAGG + Intronic
1186624513 X:11278408-11278430 GCCCCCTTCCTCCAGCTTCAAGG - Intronic
1186830030 X:13380990-13381012 TCCAACCCCCTCCTCCATCATGG + Intergenic
1187269261 X:17765053-17765075 TCCCCACCCCTGCTCCTCCAGGG - Intergenic
1187734764 X:22292359-22292381 GGCCCCTCCCTCCACATTCATGG + Intergenic
1188297139 X:28463308-28463330 TCTCTTTCCCTCTTCCTTCATGG + Intergenic
1188485138 X:30674303-30674325 TAACCCTACCTCCTGCTTCATGG + Intronic
1188604909 X:32016271-32016293 TCCCTTTCCCTCCTGCTTCCGGG + Intronic
1190298714 X:49043474-49043496 TCCCCCTCCTCCCTCCTCCCAGG + Exonic
1190572196 X:51794708-51794730 TCCCCCACCCCCATCATTCAGGG + Intergenic
1190808607 X:53862664-53862686 TGATCTTCCCTCCTCCTTCACGG + Intergenic
1190874034 X:54447066-54447088 TCCCCATCTCTACTCCTTCCAGG + Intronic
1191629569 X:63307404-63307426 ATTCTCTCCCTCCTCCTTCAAGG - Intergenic
1194581445 X:95676918-95676940 CCACCCTACCTCCTCCTCCATGG - Intergenic
1195905497 X:109840364-109840386 TCCCCTTCCCCCGTCCTCCAGGG - Intergenic
1197238781 X:124099437-124099459 TCCCCTTCCCGCATGCTTCAGGG - Intronic
1197553395 X:127923041-127923063 CCTCCCTCCATCCACCTTCAAGG - Intergenic
1197720666 X:129742468-129742490 CCCTCCTCCCTCCTCCTAGAGGG - Intronic
1197754374 X:129983934-129983956 TCCCTCTCCCTCCTTCTCCAAGG - Intronic
1198804258 X:140477917-140477939 TTCCCCTCCCTCCACCATCAGGG + Intergenic
1199415845 X:147582351-147582373 TCCCCCACCCTCTTGCTTAAAGG - Intergenic
1199629018 X:149763131-149763153 TCCCCCTCACTGCCACTTCAGGG - Intergenic
1199899240 X:152156926-152156948 TCTCCCACCCACCTCCTTGAGGG - Intergenic
1200171937 X:154083326-154083348 TCCCCCGCCCTCTTCCTTCCTGG - Intronic
1200175127 X:154108782-154108804 TCCCTCTCCCTCACCCTGCAGGG - Intergenic
1200231600 X:154446486-154446508 TCCCTCTTCTTCCTCCTCCAGGG - Exonic
1200286767 X:154830209-154830231 TTCCCCTCCTTCTTTCTTCAGGG - Intronic