ID: 1077306348

View in Genome Browser
Species Human (GRCh38)
Location 11:1870326-1870348
Sequence GTGTATGTCCCCGGGTGCTG CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 122
Summary {0: 1, 1: 0, 2: 0, 3: 8, 4: 113}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1077306348_1077306355 -7 Left 1077306348 11:1870326-1870348 CCGCAGCACCCGGGGACATACAC 0: 1
1: 0
2: 0
3: 8
4: 113
Right 1077306355 11:1870342-1870364 CATACACCGGGGAGTCTCCTGGG 0: 1
1: 0
2: 0
3: 7
4: 173
1077306348_1077306359 12 Left 1077306348 11:1870326-1870348 CCGCAGCACCCGGGGACATACAC 0: 1
1: 0
2: 0
3: 8
4: 113
Right 1077306359 11:1870361-1870383 TGGGAAAGAAGTGCCGGCCCAGG 0: 1
1: 1
2: 1
3: 19
4: 163
1077306348_1077306357 6 Left 1077306348 11:1870326-1870348 CCGCAGCACCCGGGGACATACAC 0: 1
1: 0
2: 0
3: 8
4: 113
Right 1077306357 11:1870355-1870377 GTCTCCTGGGAAAGAAGTGCCGG 0: 1
1: 0
2: 2
3: 27
4: 214
1077306348_1077306354 -8 Left 1077306348 11:1870326-1870348 CCGCAGCACCCGGGGACATACAC 0: 1
1: 0
2: 0
3: 8
4: 113
Right 1077306354 11:1870341-1870363 ACATACACCGGGGAGTCTCCTGG 0: 1
1: 0
2: 0
3: 8
4: 80
1077306348_1077306361 14 Left 1077306348 11:1870326-1870348 CCGCAGCACCCGGGGACATACAC 0: 1
1: 0
2: 0
3: 8
4: 113
Right 1077306361 11:1870363-1870385 GGAAAGAAGTGCCGGCCCAGGGG 0: 1
1: 0
2: 0
3: 5
4: 187
1077306348_1077306360 13 Left 1077306348 11:1870326-1870348 CCGCAGCACCCGGGGACATACAC 0: 1
1: 0
2: 0
3: 8
4: 113
Right 1077306360 11:1870362-1870384 GGGAAAGAAGTGCCGGCCCAGGG 0: 1
1: 0
2: 3
3: 9
4: 154

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1077306348 Original CRISPR GTGTATGTCCCCGGGTGCTG CGG (reversed) Intronic
900833817 1:4984904-4984926 GTGTGCGTCCCCAGGGGCTGGGG + Intergenic
901926300 1:12568274-12568296 GGGTGTGTGCCCAGGTGCTGTGG + Exonic
902379451 1:16045752-16045774 GTGGATGTCGCCAGGTGCAGCGG + Intronic
902718604 1:18289799-18289821 CTGTATGTCCCCTGGTGGTTAGG + Intronic
902760400 1:18577081-18577103 GTGTATGGCCCCAGGGGGTGGGG - Intergenic
904566491 1:31431587-31431609 GTGCATGTGCCAGGGAGCTGTGG - Intronic
907525844 1:55053572-55053594 GTGTTTGACCCTGGGGGCTGGGG - Intronic
908628959 1:66080604-66080626 CAGTGTGTCCCCAGGTGCTGAGG + Intronic
910387927 1:86704966-86704988 GTGCAGGTACCCTGGTGCTGGGG + Exonic
914428228 1:147598861-147598883 CTGTGTGGCCCCGGTTGCTGCGG - Intronic
920028103 1:203016234-203016256 GTGTAGGTCCCAGGCTGCTAGGG + Intronic
920230971 1:204469359-204469381 CTCTATGTCCCCTGGTCCTGGGG + Exonic
922696483 1:227733519-227733541 GTGTGTGTCGCAGAGTGCTGGGG + Exonic
1064074572 10:12258580-12258602 GAGTATATGGCCGGGTGCTGTGG - Intergenic
1067066111 10:43105194-43105216 GTGCTTGTCCGCGCGTGCTGTGG + Intronic
1069688373 10:70333860-70333882 GTGTTTCTGGCCGGGTGCTGTGG + Intronic
1069958205 10:72064267-72064289 GGGACTGTCCCCTGGTGCTGGGG + Intronic
1073194580 10:101678713-101678735 GTGTATCTCGCCGGGCGCGGTGG - Intronic
1076042450 10:127262278-127262300 GTGTGTGTACCTGTGTGCTGAGG + Intronic
1076191000 10:128483421-128483443 GTGTATGCCCCCGGGAGCCTGGG + Intergenic
1077306348 11:1870326-1870348 GTGTATGTCCCCGGGTGCTGCGG - Intronic
1080430741 11:32196664-32196686 GTGTATGTTCCAGGGGGCAGGGG - Intergenic
1083102868 11:60328107-60328129 GTCTATGTCCCAGGGTTTTGTGG + Intergenic
1085586353 11:77711380-77711402 GTGTATGTGGCCAGGTGCAGTGG + Intronic
1089498751 11:118920875-118920897 CTGCATGTCCCAGGGAGCTGTGG + Intronic
1093804688 12:23417721-23417743 GTGAAAGTCGCCGGGTGCGGTGG - Intergenic
1094813492 12:34163472-34163494 GTGTATGTCCGGGGGTCCTGGGG + Intergenic
1101649259 12:106660085-106660107 ATGGATGAACCCGGGTGCTGAGG - Intronic
1102838359 12:116089343-116089365 GTGAAAATCGCCGGGTGCTGTGG - Intronic
1103012577 12:117468543-117468565 GCAGATGTCCCCGGGGGCTGTGG - Intronic
1104662396 12:130620607-130620629 GTGCCTGTCCCCGGCTTCTGTGG + Intronic
1104752240 12:131247105-131247127 GTGTGTGTGTCCGGGTCCTGTGG - Intergenic
1104779682 12:131412025-131412047 GTGTGTGTGTCCGGGTCCTGTGG + Intergenic
1105755497 13:23459911-23459933 GTGTATGTCCCAGGGTCCAAAGG - Intergenic
1106132120 13:26949192-26949214 GTGTGTGTTCCTGTGTGCTGGGG - Intergenic
1108339309 13:49481680-49481702 GTGTTTGGCCCTGGGGGCTGTGG - Intronic
1110168114 13:72468214-72468236 TTGTAGGTCCCTGGGGGCTGTGG - Intergenic
1111390725 13:87591624-87591646 GGGTGTGTCTCTGGGTGCTGAGG + Intergenic
1113952297 13:114078879-114078901 GGGTGTGGCTCCGGGTGCTGCGG - Intronic
1120033388 14:79668024-79668046 TTGTATGTCAGGGGGTGCTGAGG + Intronic
1122364670 14:101187507-101187529 GTGCCAGTCCCCTGGTGCTGAGG + Intergenic
1122803690 14:104245909-104245931 GTGAATGTCCCAGGGCCCTGAGG - Intergenic
1122848030 14:104511311-104511333 GTGCAGGTCCCCGGGTGGCGAGG - Intronic
1124875197 15:33585384-33585406 GTGTATGTGCCAGGCTGCAGAGG + Intronic
1129284136 15:74510122-74510144 GTATATGGGGCCGGGTGCTGTGG - Intergenic
1129675163 15:77629261-77629283 ATGAATATCCCTGGGTGCTGTGG - Intronic
1129682210 15:77664322-77664344 GTGAAAGTCCCTGGATGCTGGGG + Intronic
1131734997 15:95322569-95322591 GTGTATGTAGCCGGGTGTGGTGG + Intergenic
1132684163 16:1155331-1155353 GTGGGTGTCCCCGGGAGCCGAGG + Intronic
1134033113 16:11008496-11008518 GTGGACGTCCTTGGGTGCTGAGG + Intronic
1135620638 16:23952433-23952455 GTGTATGTGTGTGGGTGCTGGGG + Intronic
1135920139 16:26642355-26642377 GTATGGGTCCCAGGGTGCTGGGG - Intergenic
1136070283 16:27783259-27783281 GCATATGTCCCCAGGTGCTCTGG + Intergenic
1142144033 16:88485252-88485274 GGGCCTGTCCCCTGGTGCTGGGG + Intronic
1144214506 17:13043410-13043432 ATGAATGTCCCCGGGTGATAGGG - Intergenic
1147257712 17:39191947-39191969 GTCTATCTCAGCGGGTGCTGGGG - Intronic
1147744981 17:42689405-42689427 GTGTGTCTCACCGGGTTCTGGGG + Intronic
1152304561 17:79513098-79513120 GTGTGTGTCCCCTGGTTATGGGG - Intronic
1155756630 18:29506004-29506026 GTGTGTGTGGCCGGGTGCGGTGG - Intergenic
1156230939 18:35153430-35153452 GTGTCTGGGCCCGGGTGCGGTGG + Intergenic
1158282258 18:55840725-55840747 GTTGATGGCACCGGGTGCTGTGG + Intergenic
1160158403 18:76451338-76451360 ATGGATGTCCGCGGGTGCAGGGG + Intronic
1160317139 18:77858745-77858767 CTGTATGTCCCCAGGGGCTGGGG - Intergenic
1161072289 19:2269081-2269103 GGGTAGGCCCCCGGGTGCTTGGG - Intronic
1167645519 19:50703227-50703249 CTGTCTGTCCCCAGGGGCTGGGG + Intronic
1168334396 19:55589250-55589272 TTGTATGTCTCTGGGTGCAGGGG + Intergenic
925131280 2:1495847-1495869 CTGTGTGGCCCCGGGTGCTGGGG + Intronic
926300517 2:11598917-11598939 GTGGATGTTCCCGGGGGCTGAGG + Intronic
933032933 2:77354855-77354877 GTGTACCACCCAGGGTGCTGTGG - Intronic
937247588 2:120503507-120503529 GCGTGTCTCCTCGGGTGCTGGGG + Intergenic
942617920 2:177813776-177813798 GTTTTTGTCACTGGGTGCTGTGG + Intronic
946617702 2:221527564-221527586 GTGGACCTCCCCGGTTGCTGGGG - Intronic
948930452 2:241128524-241128546 GTGTCTGTCCCCGAGTGAGGTGG - Intronic
1170596766 20:17811405-17811427 GTGGATGTACCCAGGCGCTGTGG - Intergenic
1172911614 20:38413687-38413709 GAGAATGTGCCCGGGTGCGGTGG + Intergenic
1176012725 20:62908266-62908288 GTGTGTCTGGCCGGGTGCTGTGG - Intronic
1179612347 21:42560405-42560427 GTGTCTGCTCCCTGGTGCTGTGG - Intronic
1179675129 21:42975372-42975394 GTGTTTGGGGCCGGGTGCTGGGG + Intronic
1180243734 21:46531242-46531264 GTGAGTGTCCCCTGCTGCTGAGG - Intronic
1181551575 22:23641891-23641913 GGGAATGTCACCGGGTGCGGTGG - Intergenic
1182748893 22:32626251-32626273 GTGTGTGTCCCTGGGTGCAGAGG - Intronic
950509142 3:13415312-13415334 GTGCTTGTCCCCTGGTGCTCAGG + Intronic
950867371 3:16199878-16199900 TTGCATGTCCCCAGCTGCTGTGG - Intronic
963508124 3:146213608-146213630 GTGAATTTGGCCGGGTGCTGTGG - Intronic
966411987 3:179653770-179653792 GTGTGTGTCCCGGGGTGTGGGGG - Intronic
970383389 4:15531215-15531237 GTGGAGGTCCCCAGGGGCTGTGG - Intronic
972149442 4:36070446-36070468 GTTCATGTCACAGGGTGCTGAGG + Intronic
974630443 4:64481005-64481027 GAGAATGTCTCTGGGTGCTGGGG - Intergenic
979366538 4:119831358-119831380 GTGTATGTTGCCTGGTGCTAAGG + Intergenic
982427251 4:155279657-155279679 GTGTGTGTCCTCTGGAGCTGAGG + Intergenic
985751975 5:1685866-1685888 GTGCATGTGCGCGTGTGCTGAGG + Intergenic
985906400 5:2840862-2840884 CTGTATCCCCACGGGTGCTGGGG - Intergenic
987093186 5:14525498-14525520 GTGTCTGTCCCCAGGAGCTGCGG + Intronic
991953594 5:71970622-71970644 GTGGATGTGGCCGGGTGCGGTGG - Intergenic
993694803 5:91048514-91048536 CTGTGTGTCCCCTGGAGCTGAGG - Intronic
995182988 5:109246193-109246215 GTGTATGTGCCAGGGGGGTGGGG + Intergenic
998899636 5:146839231-146839253 GTATATGTGGCCGGGTGCAGTGG + Intronic
999300606 5:150487864-150487886 GTGGCTGTCCCTGGGTGCTAGGG - Intronic
1001545633 5:172568982-172569004 GTGTAGGACCCCAGGTCCTGGGG + Intergenic
1010604500 6:77871636-77871658 GTGTATATTGCCTGGTGCTGAGG - Intronic
1029125462 7:98292232-98292254 GTGTGTGTTGCTGGGTGCTGGGG - Exonic
1029642538 7:101830075-101830097 GGCTATGCCCCTGGGTGCTGGGG + Intronic
1032858354 7:135855872-135855894 GTGTATGTCCACTGAGGCTGTGG - Intergenic
1035108385 7:156460655-156460677 GTGTCTGTCTTGGGGTGCTGAGG + Intergenic
1037349136 8:17930589-17930611 GTGAATGTGGCCGGGTGCGGTGG + Intronic
1041020534 8:53633751-53633773 GTGTATGTCCCGGGGTCCATAGG + Intergenic
1046730752 8:117723478-117723500 ATGTATGTGGCCGGGTGCAGTGG + Intergenic
1048040233 8:130720496-130720518 TTGTATGTGCCCGGGTGGTTAGG + Intergenic
1051062863 9:13065292-13065314 GTGGATGGCCCTGGCTGCTGTGG - Intergenic
1051346477 9:16155258-16155280 GTTTATGTCCTCTGGTGCTAGGG - Intergenic
1055930419 9:81554444-81554466 GAGTATGTGGCCGGGTGCGGTGG + Intergenic
1056248367 9:84721461-84721483 GAGTATGTGGCCGGGTGCAGTGG - Intronic
1059399521 9:114060183-114060205 GTGTCTGTCCCGGGGTCCTGTGG - Exonic
1061106093 9:128531542-128531564 GTGGATGTCGCCGGGTGTGGTGG + Intronic
1061681626 9:132245310-132245332 GAGTGTGTCCCCGGGGACTGGGG - Intergenic
1186355700 X:8787694-8787716 GTGTATGTGTCCGTGTGCTGGGG - Intergenic
1187375985 X:18755277-18755299 GTGTATGAGGCCGGGTGCAGTGG + Intronic
1187709802 X:22041683-22041705 GTTTATGTCACCTGGTGCTTTGG + Intronic
1187855982 X:23636691-23636713 GTGTGTGTGCCAGAGTGCTGGGG - Intergenic
1188957775 X:36454105-36454127 TGGTATGTCCCCTGTTGCTGGGG - Intergenic
1193191603 X:78578112-78578134 GAGTGTGTCTCTGGGTGCTGGGG + Intergenic
1194815655 X:98438499-98438521 GAGAGTGTCTCCGGGTGCTGGGG - Intergenic