ID: 1077306714

View in Genome Browser
Species Human (GRCh38)
Location 11:1871868-1871890
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 93
Summary {0: 2, 1: 4, 2: 1, 3: 13, 4: 73}

Found 14 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1077306714_1077306731 27 Left 1077306714 11:1871868-1871890 CCTGGCGCACGCTGGTAGAGTTG 0: 2
1: 4
2: 1
3: 13
4: 73
Right 1077306731 11:1871918-1871940 TTGGGAGGGGGGGTGTGTGGCGG 0: 1
1: 2
2: 19
3: 240
4: 3561
1077306714_1077306727 15 Left 1077306714 11:1871868-1871890 CCTGGCGCACGCTGGTAGAGTTG 0: 2
1: 4
2: 1
3: 13
4: 73
Right 1077306727 11:1871906-1871928 GCGTGGGCACTTTTGGGAGGGGG 0: 3
1: 3
2: 5
3: 19
4: 169
1077306714_1077306726 14 Left 1077306714 11:1871868-1871890 CCTGGCGCACGCTGGTAGAGTTG 0: 2
1: 4
2: 1
3: 13
4: 73
Right 1077306726 11:1871905-1871927 GGCGTGGGCACTTTTGGGAGGGG 0: 3
1: 3
2: 5
3: 12
4: 154
1077306714_1077306720 -2 Left 1077306714 11:1871868-1871890 CCTGGCGCACGCTGGTAGAGTTG 0: 2
1: 4
2: 1
3: 13
4: 73
Right 1077306720 11:1871889-1871911 TGGGGTCTGTCTGGCTGGCGTGG 0: 5
1: 4
2: 3
3: 36
4: 295
1077306714_1077306732 28 Left 1077306714 11:1871868-1871890 CCTGGCGCACGCTGGTAGAGTTG 0: 2
1: 4
2: 1
3: 13
4: 73
Right 1077306732 11:1871919-1871941 TGGGAGGGGGGGTGTGTGGCGGG 0: 1
1: 3
2: 12
3: 176
4: 2010
1077306714_1077306728 16 Left 1077306714 11:1871868-1871890 CCTGGCGCACGCTGGTAGAGTTG 0: 2
1: 4
2: 1
3: 13
4: 73
Right 1077306728 11:1871907-1871929 CGTGGGCACTTTTGGGAGGGGGG 0: 1
1: 1
2: 0
3: 14
4: 188
1077306714_1077306721 -1 Left 1077306714 11:1871868-1871890 CCTGGCGCACGCTGGTAGAGTTG 0: 2
1: 4
2: 1
3: 13
4: 73
Right 1077306721 11:1871890-1871912 GGGGTCTGTCTGGCTGGCGTGGG 0: 5
1: 7
2: 1
3: 25
4: 254
1077306714_1077306730 24 Left 1077306714 11:1871868-1871890 CCTGGCGCACGCTGGTAGAGTTG 0: 2
1: 4
2: 1
3: 13
4: 73
Right 1077306730 11:1871915-1871937 CTTTTGGGAGGGGGGGTGTGTGG 0: 1
1: 2
2: 3
3: 115
4: 965
1077306714_1077306729 17 Left 1077306714 11:1871868-1871890 CCTGGCGCACGCTGGTAGAGTTG 0: 2
1: 4
2: 1
3: 13
4: 73
Right 1077306729 11:1871908-1871930 GTGGGCACTTTTGGGAGGGGGGG 0: 1
1: 0
2: 0
3: 26
4: 300
1077306714_1077306724 12 Left 1077306714 11:1871868-1871890 CCTGGCGCACGCTGGTAGAGTTG 0: 2
1: 4
2: 1
3: 13
4: 73
Right 1077306724 11:1871903-1871925 CTGGCGTGGGCACTTTTGGGAGG 0: 3
1: 2
2: 0
3: 10
4: 119
1077306714_1077306723 9 Left 1077306714 11:1871868-1871890 CCTGGCGCACGCTGGTAGAGTTG 0: 2
1: 4
2: 1
3: 13
4: 73
Right 1077306723 11:1871900-1871922 TGGCTGGCGTGGGCACTTTTGGG 0: 3
1: 3
2: 4
3: 16
4: 120
1077306714_1077306719 -7 Left 1077306714 11:1871868-1871890 CCTGGCGCACGCTGGTAGAGTTG 0: 2
1: 4
2: 1
3: 13
4: 73
Right 1077306719 11:1871884-1871906 AGAGTTGGGGTCTGTCTGGCTGG 0: 6
1: 4
2: 1
3: 22
4: 230
1077306714_1077306722 8 Left 1077306714 11:1871868-1871890 CCTGGCGCACGCTGGTAGAGTTG 0: 2
1: 4
2: 1
3: 13
4: 73
Right 1077306722 11:1871899-1871921 CTGGCTGGCGTGGGCACTTTTGG 0: 3
1: 3
2: 4
3: 16
4: 121
1077306714_1077306725 13 Left 1077306714 11:1871868-1871890 CCTGGCGCACGCTGGTAGAGTTG 0: 2
1: 4
2: 1
3: 13
4: 73
Right 1077306725 11:1871904-1871926 TGGCGTGGGCACTTTTGGGAGGG 0: 4
1: 7
2: 1
3: 10
4: 141

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1077306714 Original CRISPR CAACTCTACCAGCGTGCGCC AGG (reversed) Intronic
903780550 1:25817656-25817678 CAACTCTACCTGAGTGACCCTGG - Exonic
907543016 1:55233741-55233763 CAACTCTCCCAGCGAGAGTCAGG - Intergenic
921966697 1:221098210-221098232 CAGCTCTACCACAGTGGGCCTGG + Intergenic
1077306688 11:1871774-1871796 CAACTCTACCAGCACGGGCTGGG - Intronic
1077306714 11:1871868-1871890 CAACTCTACCAGCGTGCGCCAGG - Intronic
1077306740 11:1871962-1871984 CAACTCTACCAGCGTGCGCCAGG - Intronic
1077306762 11:1872056-1872078 CAACTCTACCAGCGTGCACCAGG - Intronic
1077306786 11:1872150-1872172 CAACTCTACCAGCATGCACCAGG - Intronic
1077306811 11:1872244-1872266 CAACTCTACCAGCGTGTGCCAGG - Intronic
1077306835 11:1872338-1872360 CAACTCTACCAGCATGGGCTGGG - Intronic
1077306861 11:1872432-1872454 CAACTCTACCAGCACGCACCAGG - Intronic
1077306885 11:1872525-1872547 CAACTCTACCAGCGTGCACCAGG - Intronic
1077306908 11:1872619-1872641 CAACTCTACCAGCGTGCACCGGG - Intronic
1077306933 11:1872713-1872735 CAACTCTACCAGCGCAGGCCAGG - Intronic
1079428136 11:20363523-20363545 CAAGTCTACTAGCTGGCGCCTGG + Intergenic
1102950681 12:117028681-117028703 CAGCTCTACCAGCTTGCTACTGG - Intronic
1109359822 13:61281498-61281520 CAATTCTCCCAACGTGCCCCAGG + Intergenic
1114059551 14:19006948-19006970 CAACTCTGCCACGGTGTGCCAGG - Intergenic
1114102995 14:19394803-19394825 CAACTCTGCCACGGTGTGCCAGG + Intergenic
1120176928 14:81304411-81304433 CATCTCTAACAGCGTGAGCTTGG - Intronic
1123553148 15:21400945-21400967 CACCTCTGCAAGCGTGTGCCAGG + Intergenic
1123589394 15:21838333-21838355 CACCTCTGCAAGCGTGTGCCAGG + Intergenic
1124484129 15:30100838-30100860 CATGTCTACCAGCGTGGGCACGG + Intergenic
1124519453 15:30396386-30396408 CATGTCTACCAGCGTGGGCACGG - Intergenic
1124539202 15:30569835-30569857 CATGTCTACCAGCGTGGGCACGG + Intergenic
1124759448 15:32437737-32437759 CATGTCTACCAGCGTGGGCACGG - Intergenic
1128457312 15:67838934-67838956 GTACTCTACCAGCGGGCGCTGGG - Intergenic
1131343205 15:91622022-91622044 AAACTCTCCCAGAGTGTGCCAGG - Intergenic
1202961497 15_KI270727v1_random:128165-128187 CACCTCTGCAAGCGTGTGCCAGG + Intergenic
1136186640 16:28592302-28592324 CAACTACACCACCGTCCGCCGGG - Exonic
1144855150 17:18263405-18263427 CAACGCTACCACCTTGCTCCAGG - Intronic
1144971141 17:19110759-19110781 CAACCCTACCAGCGCCCGGCAGG + Intergenic
1144991443 17:19236922-19236944 CAACCCTACCAGCGCCCGGCAGG + Intronic
1146356226 17:32136743-32136765 CCACTCCACCAGAGTGGGCCTGG + Intergenic
1154123641 18:11671346-11671368 CCCCTCTACCAGTGTGGGCCCGG - Intergenic
1154256301 18:12783513-12783535 CAATTCTTCCAGCGTGGCCCAGG - Intergenic
1154453837 18:14503062-14503084 CAACTCTGCAAGCGTGTGCCAGG + Intergenic
1158264697 18:55649165-55649187 CGACTCTACAAGTGTGCACCAGG - Intronic
1164634463 19:29782139-29782161 CAAGGCTGCCAACGTGCGCCTGG + Intergenic
1165724303 19:38101873-38101895 CAACTCTGCCAGTGTGCACTGGG - Intronic
1166720375 19:44992834-44992856 CAGCTCTGCCAGCGAGCCCCAGG + Exonic
1167025445 19:46913307-46913329 CAGCTCTATCAGCATACGCCTGG - Intergenic
1167699640 19:51034925-51034947 CAACTCTACCACTCTGCACCTGG + Intronic
1168235097 19:55057942-55057964 CATCTCTACCAGAGTTAGCCAGG - Intronic
934553697 2:95276755-95276777 CACCTCTACCAGCCTGTTCCCGG - Intronic
937297627 2:120819117-120819139 CAACTCTACCAGCTGCAGCCAGG - Intronic
938280412 2:130060041-130060063 CACCTCTACAAGGGTGCGCCTGG - Intergenic
938280998 2:130063554-130063576 CAACTCTGCAAGGGTGTGCCAGG - Intergenic
938281128 2:130064371-130064393 CACCTCTACAAGGGTGCGCCTGG - Intergenic
938281567 2:130067115-130067137 CACCTCTACAAGGGTGCGCCTGG - Intergenic
938281694 2:130067925-130067947 CACCTCTGCAAGGGTGCGCCTGG - Intergenic
938331298 2:130450356-130450378 CACCTCTGCAAGGGTGCGCCAGG + Intergenic
938331340 2:130450580-130450602 CACCTCTACAAGGGTGCGCCTGG - Intergenic
938331703 2:130452805-130452827 CACCTCTGCAAGGGTGCGCCAGG + Intergenic
938331996 2:130454483-130454505 CACCTCTTCAAGGGTGCGCCTGG - Intergenic
938332315 2:130456474-130456496 CACCTCTGCAAGGGTGCGCCTGG - Intergenic
938357492 2:130664194-130664216 CACCTCTGCAAGGGTGCGCCTGG + Intergenic
938358016 2:130667356-130667378 CACCTCTGCAAGGGTGCGCCTGG + Intergenic
938358611 2:130670923-130670945 CACCTCTACAAGGGTGCGCCTGG + Intergenic
938433927 2:131270981-131271003 CACCTCTGCAAGGGTGCGCCTGG + Intronic
938434250 2:131272970-131272992 CACCTCTACAAGGGTGCACCTGG + Intronic
938434572 2:131274960-131274982 CACCTCTACAAGGGTGCACCTGG + Intronic
938434998 2:131277589-131277611 CACCTCTACAAGGGTGCGCCTGG + Intronic
938435041 2:131277813-131277835 CACCTCTGCAAGGGTGCGCCAGG - Intronic
938474638 2:131596901-131596923 CAACTCTATCAGCGTGAGGTGGG + Intergenic
938477967 2:131633627-131633649 CACCTCTGCAAGGGTGCGCCTGG + Intergenic
938478318 2:131635779-131635801 CACCTCTGCAAGGGTGCGCCTGG + Intergenic
1176820332 21:13650234-13650256 CACCTCTGCAAGCGTGTGCCAGG - Intergenic
1180478031 22:15729563-15729585 CAACTCTGCCACGGTGTGCCAGG - Intergenic
1181958558 22:26606082-26606104 CAATTCTTCCAGCGTGGGCCAGG + Intronic
952014274 3:28938519-28938541 CAATTCTTCCAGTGTGGGCCAGG + Intergenic
973539100 4:51917805-51917827 CAATTTTAACAGCGTGCACCTGG - Intergenic
991279885 5:64901060-64901082 CAATTCTTCCAGCGTGACCCAGG + Intronic
997079857 5:130725493-130725515 CAATTCTTCCAGTGTGCCCCAGG + Intergenic
1000349168 5:160339654-160339676 CAACTTTATCAGCGTGTTCCAGG + Intronic
1013928643 6:115503041-115503063 CAACACTTGCACCGTGCGCCTGG + Intergenic
1015369884 6:132438664-132438686 CCACTCTACCAGCGTCCTCCTGG + Intergenic
1016703257 6:147077633-147077655 CAACACAACCAGCCTGCCCCAGG + Intergenic
1019054653 6:169214287-169214309 CAACTCTCAGAGCGTGGGCCTGG + Intergenic
1019546639 7:1580676-1580698 ATCCTCTACCTGCGTGCGCCTGG - Intergenic
1024172807 7:46808186-46808208 CACCTCTACCAGCGTCCTGCTGG - Intergenic
1035523241 8:292034-292056 CACATCTGCCAGCCTGCGCCTGG - Intergenic
1044281672 8:90363790-90363812 CAAGTCTACCAGGGTGTGCATGG + Intergenic
1049152504 8:141044373-141044395 CAACTCAGCCAGTGTGAGCCTGG - Intergenic
1049215882 8:141407965-141407987 CAATTCTTCCAGCGTGGCCCAGG + Intronic
1050801855 9:9625371-9625393 CCACTCTAACAGCATGCGCCAGG - Intronic
1057202851 9:93152133-93152155 CAACTCTGGCAGCGTGCCCAAGG - Intergenic
1058176016 9:101737681-101737703 CTCCCCAACCAGCGTGCGCCCGG + Exonic
1061568209 9:131458389-131458411 CAACTCTTCCAGTGTGGCCCAGG - Intronic
1062320702 9:135989319-135989341 CTGCTCTGCCAGCGTGCTCCAGG + Intergenic
1203527028 Un_GL000213v1:99317-99339 CACCTCTGCAAGCGTGTGCCAGG + Intergenic
1187015097 X:15318714-15318736 CAAATCTTCCAGCGTGGCCCAGG - Intergenic
1192262387 X:69513271-69513293 CAGCTCTACCAGCATGTGCAAGG - Intronic