ID: 1077306786

View in Genome Browser
Species Human (GRCh38)
Location 11:1872150-1872172
Sequence CAACTCTACCAGCATGCACC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 155
Summary {0: 1, 1: 4, 2: 2, 3: 10, 4: 138}

Found 11 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1077306786_1077306803 28 Left 1077306786 11:1872150-1872172 CCTGGTGCATGCTGGTAGAGTTG 0: 1
1: 4
2: 2
3: 10
4: 138
Right 1077306803 11:1872201-1872223 TGGGACGGGGTGTGTGTGGTGGG 0: 1
1: 8
2: 18
3: 86
4: 634
1077306786_1077306791 -7 Left 1077306786 11:1872150-1872172 CCTGGTGCATGCTGGTAGAGTTG 0: 1
1: 4
2: 2
3: 10
4: 138
Right 1077306791 11:1872166-1872188 AGAGTTGGGGTCTGTCCGGCTGG 0: 4
1: 6
2: 1
3: 6
4: 137
1077306786_1077306797 13 Left 1077306786 11:1872150-1872172 CCTGGTGCATGCTGGTAGAGTTG 0: 1
1: 4
2: 2
3: 10
4: 138
Right 1077306797 11:1872186-1872208 TGGCGTGGGCACCTTTGGGACGG 0: 7
1: 4
2: 1
3: 16
4: 147
1077306786_1077306792 -2 Left 1077306786 11:1872150-1872172 CCTGGTGCATGCTGGTAGAGTTG 0: 1
1: 4
2: 2
3: 10
4: 138
Right 1077306792 11:1872171-1872193 TGGGGTCTGTCCGGCTGGCGTGG 0: 4
1: 6
2: 0
3: 10
4: 170
1077306786_1077306795 8 Left 1077306786 11:1872150-1872172 CCTGGTGCATGCTGGTAGAGTTG 0: 1
1: 4
2: 2
3: 10
4: 138
Right 1077306795 11:1872181-1872203 CCGGCTGGCGTGGGCACCTTTGG 0: 4
1: 3
2: 4
3: 3
4: 105
1077306786_1077306802 27 Left 1077306786 11:1872150-1872172 CCTGGTGCATGCTGGTAGAGTTG 0: 1
1: 4
2: 2
3: 10
4: 138
Right 1077306802 11:1872200-1872222 TTGGGACGGGGTGTGTGTGGTGG 0: 3
1: 8
2: 19
3: 141
4: 2718
1077306786_1077306799 15 Left 1077306786 11:1872150-1872172 CCTGGTGCATGCTGGTAGAGTTG 0: 1
1: 4
2: 2
3: 10
4: 138
Right 1077306799 11:1872188-1872210 GCGTGGGCACCTTTGGGACGGGG 0: 4
1: 4
2: 4
3: 6
4: 85
1077306786_1077306801 24 Left 1077306786 11:1872150-1872172 CCTGGTGCATGCTGGTAGAGTTG 0: 1
1: 4
2: 2
3: 10
4: 138
Right 1077306801 11:1872197-1872219 CCTTTGGGACGGGGTGTGTGTGG 0: 4
1: 3
2: 3
3: 30
4: 232
1077306786_1077306796 9 Left 1077306786 11:1872150-1872172 CCTGGTGCATGCTGGTAGAGTTG 0: 1
1: 4
2: 2
3: 10
4: 138
Right 1077306796 11:1872182-1872204 CGGCTGGCGTGGGCACCTTTGGG 0: 4
1: 4
2: 3
3: 5
4: 63
1077306786_1077306793 -1 Left 1077306786 11:1872150-1872172 CCTGGTGCATGCTGGTAGAGTTG 0: 1
1: 4
2: 2
3: 10
4: 138
Right 1077306793 11:1872172-1872194 GGGGTCTGTCCGGCTGGCGTGGG 0: 5
1: 5
2: 2
3: 14
4: 135
1077306786_1077306798 14 Left 1077306786 11:1872150-1872172 CCTGGTGCATGCTGGTAGAGTTG 0: 1
1: 4
2: 2
3: 10
4: 138
Right 1077306798 11:1872187-1872209 GGCGTGGGCACCTTTGGGACGGG 0: 4
1: 4
2: 4
3: 13
4: 102

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1077306786 Original CRISPR CAACTCTACCAGCATGCACC AGG (reversed) Intronic
904417125 1:30369989-30370011 CAACTCTACCCTCATGGAGCTGG + Intergenic
905309368 1:37038550-37038572 CTGCTCTACAAGCCTGCACCTGG + Intergenic
905966902 1:42105801-42105823 CAACTCTCCCACCCTGCATCTGG + Intergenic
908168426 1:61481632-61481654 CAGCTCTTGCAGCAAGCACCTGG - Intergenic
912735974 1:112149799-112149821 CAACACTTGCACCATGCACCTGG + Intergenic
912839742 1:113028559-113028581 CAACGCAACCAGCATGTATCAGG + Intergenic
913188535 1:116392967-116392989 CAACTCCACCAACAAGTACCAGG + Exonic
915805625 1:158845947-158845969 CAACTTTACAAGCAAGCATCTGG + Exonic
915942768 1:160129379-160129401 CAACTCTACCAACAAGTACCAGG + Exonic
922826652 1:228526175-228526197 CAATTCTCCCAGCATGCAGCTGG - Intergenic
922848868 1:228713843-228713865 CAGTTCTAACAGCATCCACCTGG - Intergenic
924917638 1:248590212-248590234 CAGCGCAACCAGCATGCACTGGG - Intergenic
1064472649 10:15652836-15652858 GAACCCTACTACCATGCACCAGG - Intronic
1065448036 10:25823095-25823117 CAACTTTATCATCATGCACTGGG + Intergenic
1066095104 10:32064866-32064888 AAACCCTACCAACATGCACAAGG - Intergenic
1066213236 10:33260577-33260599 CAACACTTCCAGCATGTACCCGG + Intronic
1074207630 10:111297709-111297731 CAACTCTCCCAGGAGGCAGCTGG + Intergenic
1076633639 10:131868557-131868579 CAATGCTCCCAGCATGCACAGGG + Intergenic
1076945834 10:133649094-133649116 CTACAATCCCAGCATGCACCAGG - Intergenic
1077306688 11:1871774-1871796 CAACTCTACCAGCACGGGCTGGG - Intronic
1077306714 11:1871868-1871890 CAACTCTACCAGCGTGCGCCAGG - Intronic
1077306740 11:1871962-1871984 CAACTCTACCAGCGTGCGCCAGG - Intronic
1077306762 11:1872056-1872078 CAACTCTACCAGCGTGCACCAGG - Intronic
1077306786 11:1872150-1872172 CAACTCTACCAGCATGCACCAGG - Intronic
1077306811 11:1872244-1872266 CAACTCTACCAGCGTGTGCCAGG - Intronic
1077306835 11:1872338-1872360 CAACTCTACCAGCATGGGCTGGG - Intronic
1077306861 11:1872432-1872454 CAACTCTACCAGCACGCACCAGG - Intronic
1077306885 11:1872525-1872547 CAACTCTACCAGCGTGCACCAGG - Intronic
1077306908 11:1872619-1872641 CAACTCTACCAGCGTGCACCGGG - Intronic
1080059260 11:27939706-27939728 CAGTTCTCCCAGCATGCAGCTGG + Intergenic
1085467641 11:76735006-76735028 CCACACTACCGGCTTGCACCTGG - Intergenic
1088200827 11:107331861-107331883 CAACTCTTCTAGCAAGCAGCAGG - Intronic
1092323378 12:7502880-7502902 CAATTCTCCCAGCAGGCACAGGG + Intronic
1096314474 12:50552017-50552039 CAATCCCACCAGCATGCACAAGG + Intronic
1100342188 12:93689950-93689972 CAAGTCTAACAGCATGCATATGG + Intronic
1100730277 12:97459054-97459076 CAACTCTAAGAACATGCACACGG - Intergenic
1102950681 12:117028681-117028703 CAGCTCTACCAGCTTGCTACTGG - Intronic
1104336531 12:127901017-127901039 CATGTCTTCCAGCATTCACCTGG - Intergenic
1113801411 13:113088386-113088408 CACCTCTACAAGCCTGCAGCTGG - Exonic
1115031579 14:28802099-28802121 CAACTTTGCCAGCAGGCACTGGG + Intronic
1202919942 14_KI270723v1_random:21687-21709 CTACAATCCCAGCATGCACCAGG - Intergenic
1202924978 14_KI270724v1_random:15951-15973 CTACAATCCCAGCATGCACCAGG + Intergenic
1123496068 15:20828242-20828264 CACCTCTGCAAGCATGCTCCTGG - Intergenic
1123552553 15:21397334-21397356 CACCTCTGCAAGCATGCTCCTGG - Intergenic
1123588799 15:21834722-21834744 CACCTCTGCAAGCATGCTCCTGG - Intergenic
1130956261 15:88629423-88629445 CCACTCTCCCACCACGCACCTGG - Exonic
1132304316 15:100800503-100800525 CTTCTCTGCCAGCATTCACCTGG - Intergenic
1132320494 15:100921204-100921226 TCACTCTACCACCATGCACGGGG - Intronic
1202960902 15_KI270727v1_random:124554-124576 CACCTCTGCAAGCATGCTCCTGG - Intergenic
1133686122 16:8167043-8167065 CAACTCTATCATCAGGCAACAGG - Intergenic
1136989874 16:35145576-35145598 CACCGGTCCCAGCATGCACCGGG + Intergenic
1141449662 16:84089739-84089761 CAGCTCTTCCAGCATGGACATGG - Intronic
1142175859 16:88645003-88645025 CATCTCTCCCACCATGCACTAGG - Intronic
1144441384 17:15285923-15285945 CAGCCCTCCCAGCATGCACATGG + Intergenic
1144855150 17:18263405-18263427 CAACGCTACCACCTTGCTCCAGG - Intronic
1148763302 17:50020750-50020772 CACCTCTGCCAGCCAGCACCAGG + Intergenic
1149443626 17:56696772-56696794 TCACTCTGCCAGCATGCAACAGG + Intergenic
1149635409 17:58164256-58164278 CAACTCTGCCAGCATTGTCCAGG + Intergenic
1151404871 17:73879749-73879771 CAACTCTTCCAGCCTCCACATGG - Intergenic
1151551769 17:74826526-74826548 CAACTCACCCACCATGCACTTGG - Intronic
1152660411 17:81539463-81539485 CAGCTCTCCCAGCAAGCACGGGG + Intergenic
1155412016 18:25556919-25556941 CAGCTCTTCCAGCAAGCACTGGG - Intergenic
1155571199 18:27195858-27195880 GAACACAACCAGCATCCACCGGG - Intergenic
1157272152 18:46284132-46284154 CACCTCTACCTCCAGGCACCGGG - Intergenic
1158264697 18:55649165-55649187 CGACTCTACAAGTGTGCACCAGG - Intronic
1158455646 18:57604909-57604931 CCACTCTCCCAGCATGCACTTGG - Intronic
1158845108 18:61433743-61433765 CAAATATAACAGCAAGCACCAGG - Intronic
1158911650 18:62069062-62069084 CAACTCTCCTAGCATACAGCTGG + Intronic
1160973742 19:1782150-1782172 CAAGTCAACCAGCATGCAGGGGG - Exonic
1161698701 19:5783834-5783856 CCCCACTACCAGCAGGCACCCGG - Exonic
1163060266 19:14755635-14755657 CAACTCCACCAGCACTCACACGG + Exonic
1164784553 19:30919675-30919697 CAACTCTACAATCACGTACCAGG - Intergenic
1165724303 19:38101873-38101895 CAACTCTGCCAGTGTGCACTGGG - Intronic
1167025445 19:46913307-46913329 CAGCTCTATCAGCATACGCCTGG - Intergenic
1167699640 19:51034925-51034947 CAACTCTACCACTCTGCACCTGG + Intronic
1168644526 19:58051561-58051583 CAACCCTACCTGGATGCACAGGG - Intronic
934553697 2:95276755-95276777 CACCTCTACCAGCCTGTTCCCGG - Intronic
934673839 2:96235301-96235323 CAAATCTACCAGCCTATACCTGG + Intergenic
936451399 2:112636411-112636433 CAGGCCTACCAGCCTGCACCTGG + Intergenic
938201814 2:129378305-129378327 CAACCCTCCCCGCATGCTCCTGG + Intergenic
938434250 2:131272970-131272992 CACCTCTACAAGGGTGCACCTGG + Intronic
938434572 2:131274960-131274982 CACCTCTACAAGGGTGCACCTGG + Intronic
941619142 2:167757155-167757177 GCACTCTATCAGCATTCACCAGG + Intergenic
943641962 2:190369464-190369486 AATTTCTACCAGCATGCACTTGG - Intronic
944131451 2:196351922-196351944 CAAATTTACCAGCAAGTACCAGG + Intronic
945273130 2:207961807-207961829 CAACACTGACAGCATCCACCTGG - Intronic
948834209 2:240616961-240616983 AAACTCTACCAACAGCCACCTGG + Intronic
948834224 2:240617075-240617097 AAACTCTACCAACAGCCACCTGG + Intronic
948834241 2:240617189-240617211 AAACTCTACCAACAGCCACCTGG + Intronic
1173437927 20:43049159-43049181 CTGCTCTACCACCATGGACCTGG - Intronic
1173503723 20:43571301-43571323 AAACTCCACCAGCCTCCACCTGG - Intronic
1174274569 20:49394405-49394427 AAACTCTCCCAGCCTGCACTGGG + Intronic
1176090371 20:63315891-63315913 CAGCGCTGCCAGCAGGCACCGGG - Intronic
1176336210 21:5602261-5602283 CTACAATCCCAGCATGCACCTGG + Intergenic
1176336480 21:5603995-5604017 CTACAATCCCAGCATGCACCCGG + Intergenic
1176342343 21:5710165-5710187 CTACAATGCCAGCATGCACCGGG - Intergenic
1176391277 21:6216953-6216975 CTACAATCCCAGCATGCACCCGG - Intergenic
1176391547 21:6218687-6218709 CTACAATCCCAGCATGCACCTGG - Intergenic
1176469872 21:7097487-7097509 CTACAATCCCAGCATGCACCTGG + Intergenic
1176470142 21:7099221-7099243 CTACAATCCCAGCATGCACCCGG + Intergenic
1176474597 21:7142317-7142339 CTACAATGCCAGCATGCACCGGG - Intergenic
1176493433 21:7479265-7479287 CTACAATCCCAGCATGCACCTGG + Intergenic
1176493703 21:7480999-7481021 CTACAATCCCAGCATGCACCCGG + Intergenic
1176502484 21:7614291-7614313 CTACAATGCCAGCATGCACCGGG + Intergenic
1176506939 21:7657384-7657406 CTACAATCCCAGCATGCACCCGG - Intergenic
1176507209 21:7659118-7659140 CTACAATCCCAGCATGCACCTGG - Intergenic
1176536664 21:8108234-8108256 CTACAATGCCAGCATGCACCGGG - Intergenic
1183921888 22:41176419-41176441 CAGCTCCACCAGCATGCACATGG - Exonic
1185072918 22:48667105-48667127 CACCCCTCCCAGCATGCAGCAGG + Intronic
1203241611 22_KI270733v1_random:24645-24667 CTACAATGCCAGCATGCACCGGG - Intergenic
953821597 3:46211824-46211846 CTTCTCCACCAGCAAGCACCTGG + Intronic
957081646 3:75641376-75641398 CTACAATCCCAGCATGCACCAGG + Intergenic
970065654 4:12090619-12090641 CAGTTCTCCCAGCATGCAGCTGG + Intergenic
970902701 4:21178005-21178027 CAAATCTATTAGCATGCCCCAGG + Intronic
971324776 4:25634856-25634878 ACACTCTACCAGCATGGACTGGG + Intergenic
971353028 4:25869588-25869610 CCTCCCCACCAGCATGCACCTGG - Intronic
972287783 4:37665325-37665347 TAAATATACCAGCATGCTCCTGG + Intronic
973539100 4:51917805-51917827 CAATTTTAACAGCGTGCACCTGG - Intergenic
977032541 4:91904550-91904572 CAACTCCACCAGCATGACTCTGG + Intergenic
977302146 4:95280160-95280182 GAGCTCTACCAGAAAGCACCTGG + Intronic
978994248 4:115130620-115130642 CTACACTACCAGCTTGCACAGGG + Intergenic
979309122 4:119181428-119181450 TAACTCTCCCAGAATGCACAGGG - Intronic
985449224 4:190049604-190049626 CTACAATCCCAGCATGCACCAGG - Intergenic
987742363 5:21926789-21926811 CAGTTCTACCTGCATGCACTCGG - Intronic
994737834 5:103578061-103578083 GTACTATACAAGCATGCACCTGG - Intergenic
1000193969 5:158940085-158940107 AAACTCTCCCAGAATGCACCAGG - Intronic
1000769207 5:165330724-165330746 CCACTCTACCAGCATCCATATGG - Intergenic
1010799037 6:80152791-80152813 CAAAGGTACCAGCATGAACCTGG - Intronic
1015369884 6:132438664-132438686 CCACTCTACCAGCGTCCTCCTGG + Intergenic
1016703257 6:147077633-147077655 CAACACAACCAGCCTGCCCCAGG + Intergenic
1020144729 7:5633725-5633747 CCACCCTACCTGCATGCAGCAGG - Intronic
1021155376 7:17203467-17203489 CATCTTTACCAGCATGAACATGG - Intergenic
1028170857 7:87593821-87593843 GAACTCTAGGAGCTTGCACCTGG + Intronic
1030078796 7:105759510-105759532 CACCACTCCCAGCATCCACCTGG - Intronic
1036756605 8:11475288-11475310 CAACTCTGTGAGCATGCACAAGG - Intergenic
1037110507 8:15159523-15159545 CAACTCTGGCAGCATCTACCTGG - Intronic
1037261288 8:17011717-17011739 CACCTCTACCACCATGTAGCTGG - Intergenic
1039944277 8:42116552-42116574 CAGCTCTAACACCCTGCACCTGG + Intergenic
1042332504 8:67595375-67595397 CAGTTCTCCCAGCATGCAGCTGG - Intronic
1045145615 8:99340719-99340741 CACATCTACTAGCATGCCCCAGG - Intronic
1047461187 8:125066912-125066934 GAAGTCTACCAGGATGCAACAGG + Intronic
1049745373 8:144261020-144261042 CAACACCACCTGCAAGCACCTGG + Exonic
1050801855 9:9625371-9625393 CCACTCTAACAGCATGCGCCAGG - Intronic
1051296371 9:15600624-15600646 CAGTTCTCCCAGCATGCAGCTGG - Intronic
1052990839 9:34518667-34518689 CAACTCTGCCAGCTTCAACCTGG - Intronic
1053631244 9:39941499-39941521 CAACCCTACCAGCTTAAACCAGG - Intergenic
1053774523 9:41522006-41522028 CAACCCTACCAGCTTAAACCAGG + Intergenic
1054212643 9:62309199-62309221 CAACCCTACCAGCTTAAACCAGG + Intergenic
1062382323 9:136292398-136292420 CAACACTCCCAGAAGGCACCGGG + Intronic
1203425167 Un_GL000195v1:30907-30929 CTACAATCCCAGCATGCACCCGG - Intergenic
1203425433 Un_GL000195v1:32641-32663 CTACAATCCCAGCATGCACCTGG - Intergenic
1203457934 Un_GL000220v1:7720-7742 CTACAATGCCAGCATGCACCGGG - Intergenic
1189264124 X:39700521-39700543 CCACTCTGCCTGCATGCAGCAGG - Intergenic
1192262387 X:69513271-69513293 CAGCTCTACCAGCATGTGCAAGG - Intronic
1193618895 X:83726242-83726264 CACATCTACCAGCATGAAACTGG + Intergenic