ID: 1077306885

View in Genome Browser
Species Human (GRCh38)
Location 11:1872525-1872547
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 105
Summary {0: 3, 1: 3, 2: 2, 3: 7, 4: 90}

Found 11 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1077306885_1077306894 9 Left 1077306885 11:1872525-1872547 CCTGGTGCACGCTGGTAGAGTTG 0: 3
1: 3
2: 2
3: 7
4: 90
Right 1077306894 11:1872557-1872579 TGGCTGGCGTGGGCACTTTTGGG 0: 3
1: 3
2: 4
3: 16
4: 120
1077306885_1077306897 14 Left 1077306885 11:1872525-1872547 CCTGGTGCACGCTGGTAGAGTTG 0: 3
1: 3
2: 2
3: 7
4: 90
Right 1077306897 11:1872562-1872584 GGCGTGGGCACTTTTGGGAGGGG 0: 3
1: 3
2: 5
3: 12
4: 154
1077306885_1077306890 -7 Left 1077306885 11:1872525-1872547 CCTGGTGCACGCTGGTAGAGTTG 0: 3
1: 3
2: 2
3: 7
4: 90
Right 1077306890 11:1872541-1872563 AGAGTTGGGGTCTGTCTGGCTGG 0: 6
1: 4
2: 1
3: 22
4: 230
1077306885_1077306899 24 Left 1077306885 11:1872525-1872547 CCTGGTGCACGCTGGTAGAGTTG 0: 3
1: 3
2: 2
3: 7
4: 90
Right 1077306899 11:1872572-1872594 CTTTTGGGAGGGGGTGTGTGTGG 0: 2
1: 3
2: 10
3: 59
4: 655
1077306885_1077306898 15 Left 1077306885 11:1872525-1872547 CCTGGTGCACGCTGGTAGAGTTG 0: 3
1: 3
2: 2
3: 7
4: 90
Right 1077306898 11:1872563-1872585 GCGTGGGCACTTTTGGGAGGGGG 0: 3
1: 3
2: 5
3: 19
4: 169
1077306885_1077306896 13 Left 1077306885 11:1872525-1872547 CCTGGTGCACGCTGGTAGAGTTG 0: 3
1: 3
2: 2
3: 7
4: 90
Right 1077306896 11:1872561-1872583 TGGCGTGGGCACTTTTGGGAGGG 0: 4
1: 7
2: 1
3: 10
4: 141
1077306885_1077306895 12 Left 1077306885 11:1872525-1872547 CCTGGTGCACGCTGGTAGAGTTG 0: 3
1: 3
2: 2
3: 7
4: 90
Right 1077306895 11:1872560-1872582 CTGGCGTGGGCACTTTTGGGAGG 0: 3
1: 2
2: 0
3: 10
4: 119
1077306885_1077306893 8 Left 1077306885 11:1872525-1872547 CCTGGTGCACGCTGGTAGAGTTG 0: 3
1: 3
2: 2
3: 7
4: 90
Right 1077306893 11:1872556-1872578 CTGGCTGGCGTGGGCACTTTTGG 0: 3
1: 3
2: 4
3: 16
4: 121
1077306885_1077306900 28 Left 1077306885 11:1872525-1872547 CCTGGTGCACGCTGGTAGAGTTG 0: 3
1: 3
2: 2
3: 7
4: 90
Right 1077306900 11:1872576-1872598 TGGGAGGGGGTGTGTGTGGCAGG 0: 3
1: 5
2: 11
3: 175
4: 1567
1077306885_1077306891 -2 Left 1077306885 11:1872525-1872547 CCTGGTGCACGCTGGTAGAGTTG 0: 3
1: 3
2: 2
3: 7
4: 90
Right 1077306891 11:1872546-1872568 TGGGGTCTGTCTGGCTGGCGTGG 0: 5
1: 4
2: 3
3: 36
4: 295
1077306885_1077306892 -1 Left 1077306885 11:1872525-1872547 CCTGGTGCACGCTGGTAGAGTTG 0: 3
1: 3
2: 2
3: 7
4: 90
Right 1077306892 11:1872547-1872569 GGGGTCTGTCTGGCTGGCGTGGG 0: 5
1: 7
2: 1
3: 25
4: 254

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1077306885 Original CRISPR CAACTCTACCAGCGTGCACC AGG (reversed) Intronic
903780550 1:25817656-25817678 CAACTCTACCTGAGTGACCCTGG - Exonic
905309368 1:37038550-37038572 CTGCTCTACAAGCCTGCACCTGG + Intergenic
905966902 1:42105801-42105823 CAACTCTCCCACCCTGCATCTGG + Intergenic
915942768 1:160129379-160129401 CAACTCTACCAACAAGTACCAGG + Exonic
919687857 1:200500964-200500986 CAAGTCTTACAGCGTGCAGCTGG + Intergenic
922826652 1:228526175-228526197 CAATTCTCCCAGCATGCAGCTGG - Intergenic
1064244207 10:13656599-13656621 CAGGTCTTCCCGCGTGCACCTGG + Intronic
1066213236 10:33260577-33260599 CAACACTTCCAGCATGTACCCGG + Intronic
1071718322 10:88118898-88118920 CAACTCTTCCAGTGTGCATTAGG + Intergenic
1075524191 10:123168915-123168937 CAATTCTTCCAGTGTGGACCAGG + Exonic
1076571825 10:131438229-131438251 CAGCTCTGCCAGCGGGCATCTGG - Intergenic
1077306714 11:1871868-1871890 CAACTCTACCAGCGTGCGCCAGG - Intronic
1077306740 11:1871962-1871984 CAACTCTACCAGCGTGCGCCAGG - Intronic
1077306762 11:1872056-1872078 CAACTCTACCAGCGTGCACCAGG - Intronic
1077306786 11:1872150-1872172 CAACTCTACCAGCATGCACCAGG - Intronic
1077306811 11:1872244-1872266 CAACTCTACCAGCGTGTGCCAGG - Intronic
1077306835 11:1872338-1872360 CAACTCTACCAGCATGGGCTGGG - Intronic
1077306861 11:1872432-1872454 CAACTCTACCAGCACGCACCAGG - Intronic
1077306885 11:1872525-1872547 CAACTCTACCAGCGTGCACCAGG - Intronic
1077306908 11:1872619-1872641 CAACTCTACCAGCGTGCACCGGG - Intronic
1077306933 11:1872713-1872735 CAACTCTACCAGCGCAGGCCAGG - Intronic
1080839077 11:35967689-35967711 CAACTCTGGCATGGTGCACCCGG - Intronic
1084769955 11:71336181-71336203 CAATTTCACCACCGTGCACCTGG - Intergenic
1085467641 11:76735006-76735028 CCACACTACCGGCTTGCACCTGG - Intergenic
1096436754 12:51597536-51597558 CATTTCTACCAGCGTGAACTTGG + Intronic
1102950681 12:117028681-117028703 CAGCTCTACCAGCTTGCTACTGG - Intronic
1109359822 13:61281498-61281520 CAATTCTCCCAACGTGCCCCAGG + Intergenic
1113801411 13:113088386-113088408 CACCTCTACAAGCCTGCAGCTGG - Exonic
1123553086 15:21400539-21400561 CACCTCTGCAAGGGTGCACCTGG - Intergenic
1123553192 15:21401169-21401191 CACCTCTGCAAGGGTGCACCTGG - Intergenic
1123589116 15:21836647-21836669 CACCTCTGCAAGGGTGCACCTGG - Intergenic
1123589331 15:21837927-21837949 CACCTCTGCAAGGGTGCACCTGG - Intergenic
1123589438 15:21838557-21838579 CACCTCTGCAAGGGTGCACCTGG - Intergenic
1202961219 15_KI270727v1_random:126479-126501 CACCTCTGCAAGGGTGCACCTGG - Intergenic
1202961434 15_KI270727v1_random:127759-127781 CACCTCTGCAAGGGTGCACCTGG - Intergenic
1202961541 15_KI270727v1_random:128389-128411 CACCTCTGCAAGGGTGCACCTGG - Intergenic
1202961601 15_KI270727v1_random:128804-128826 CACCTCTGCAAGGGTGCACCTGG + Intergenic
1133462806 16:6001737-6001759 CAACTCTATAAGAGTGCAGCTGG + Intergenic
1134442589 16:14308085-14308107 CACCTGTACCAGTGAGCACCCGG - Intergenic
1144855150 17:18263405-18263427 CAACGCTACCACCTTGCTCCAGG - Intronic
1148763302 17:50020750-50020772 CACCTCTGCCAGCCAGCACCAGG + Intergenic
1151404871 17:73879749-73879771 CAACTCTTCCAGCCTCCACATGG - Intergenic
1154256301 18:12783513-12783535 CAATTCTTCCAGCGTGGCCCAGG - Intergenic
1154453837 18:14503062-14503084 CAACTCTGCAAGCGTGTGCCAGG + Intergenic
1154453878 18:14503286-14503308 CACCTCTGCAAGGGTGCACCTGG - Intergenic
1156975104 18:43212031-43212053 CACCTCTTCCTTCGTGCACCTGG - Intergenic
1158264697 18:55649165-55649187 CGACTCTACAAGTGTGCACCAGG - Intronic
1158455646 18:57604909-57604931 CCACTCTCCCAGCATGCACTTGG - Intronic
1165724303 19:38101873-38101895 CAACTCTGCCAGTGTGCACTGGG - Intronic
1166720375 19:44992834-44992856 CAGCTCTGCCAGCGAGCCCCAGG + Exonic
1167699640 19:51034925-51034947 CAACTCTACCACTCTGCACCTGG + Intronic
926795691 2:16617291-16617313 CTCCTCTGCCAGTGTGCACCTGG + Intronic
934553697 2:95276755-95276777 CACCTCTACCAGCCTGTTCCCGG - Intronic
934673839 2:96235301-96235323 CAAATCTACCAGCCTATACCTGG + Intergenic
936451399 2:112636411-112636433 CAGGCCTACCAGCCTGCACCTGG + Intergenic
938280412 2:130060041-130060063 CACCTCTACAAGGGTGCGCCTGG - Intergenic
938281128 2:130064371-130064393 CACCTCTACAAGGGTGCGCCTGG - Intergenic
938281567 2:130067115-130067137 CACCTCTACAAGGGTGCGCCTGG - Intergenic
938331340 2:130450580-130450602 CACCTCTACAAGGGTGCGCCTGG - Intergenic
938358611 2:130670923-130670945 CACCTCTACAAGGGTGCGCCTGG + Intergenic
938434250 2:131272970-131272992 CACCTCTACAAGGGTGCACCTGG + Intronic
938434572 2:131274960-131274982 CACCTCTACAAGGGTGCACCTGG + Intronic
938434998 2:131277589-131277611 CACCTCTACAAGGGTGCGCCTGG + Intronic
1169710186 20:8552387-8552409 CAAATCTACCACGGTGCAACTGG - Intronic
1173503723 20:43571301-43571323 AAACTCCACCAGCCTCCACCTGG - Intronic
1174274569 20:49394405-49394427 AAACTCTCCCAGCCTGCACTGGG + Intronic
1176820291 21:13650010-13650032 CACCTCTGCAAGGGTGCACCTGG + Intergenic
1176820402 21:13650649-13650671 CACCTCTGCAAGGGTGCACCTGG + Intergenic
1180067501 21:45419934-45419956 CAAAGCTACCTGCGTCCACCGGG - Intronic
1181958558 22:26606082-26606104 CAATTCTTCCAGCGTGGGCCAGG + Intronic
1183610654 22:38901823-38901845 TAAGTCAACCAGAGTGCACCTGG + Intergenic
1183921888 22:41176419-41176441 CAGCTCCACCAGCATGCACATGG - Exonic
967436008 3:189447131-189447153 CAACTATATCAGCGTGCATAAGG + Intergenic
969533862 4:7744053-7744075 CAGCTCAACCAGGGAGCACCTGG + Intergenic
973539100 4:51917805-51917827 CAATTTTAACAGCGTGCACCTGG - Intergenic
978994248 4:115130620-115130642 CTACACTACCAGCTTGCACAGGG + Intergenic
991279885 5:64901060-64901082 CAATTCTTCCAGCGTGACCCAGG + Intronic
997079857 5:130725493-130725515 CAATTCTTCCAGTGTGCCCCAGG + Intergenic
1000193969 5:158940085-158940107 AAACTCTCCCAGAATGCACCAGG - Intronic
1000349168 5:160339654-160339676 CAACTTTATCAGCGTGTTCCAGG + Intronic
1003336757 6:5180681-5180703 CTGCTCTGCCAGCGTGGACCTGG + Intronic
1013191406 6:107806911-107806933 CAACTCTGCCAGCGGGCAGGCGG - Intronic
1014684966 6:124485719-124485741 AAGCTCTACCAGTGTGCAGCAGG + Intronic
1015369884 6:132438664-132438686 CCACTCTACCAGCGTCCTCCTGG + Intergenic
1016703257 6:147077633-147077655 CAACACAACCAGCCTGCCCCAGG + Intergenic
1024172807 7:46808186-46808208 CACCTCTACCAGCGTCCTGCTGG - Intergenic
1026482409 7:70790243-70790265 CTCCTCGTCCAGCGTGCACCCGG + Exonic
1028170857 7:87593821-87593843 GAACTCTAGGAGCTTGCACCTGG + Intronic
1033479299 7:141723246-141723268 CAACTCTAGCATGGTACACCTGG + Exonic
1039944277 8:42116552-42116574 CAGCTCTAACACCCTGCACCTGG + Intergenic
1049215882 8:141407965-141407987 CAATTCTTCCAGCGTGGCCCAGG + Intronic
1050801855 9:9625371-9625393 CCACTCTAACAGCATGCGCCAGG - Intronic
1052990839 9:34518667-34518689 CAACTCTGCCAGCTTCAACCTGG - Intronic
1053631244 9:39941499-39941521 CAACCCTACCAGCTTAAACCAGG - Intergenic
1053774523 9:41522006-41522028 CAACCCTACCAGCTTAAACCAGG + Intergenic
1054212643 9:62309199-62309221 CAACCCTACCAGCTTAAACCAGG + Intergenic
1057202851 9:93152133-93152155 CAACTCTGGCAGCGTGCCCAAGG - Intergenic
1060757823 9:126225776-126225798 CACCTCTACCTTCGTGCACAAGG - Intergenic
1061568209 9:131458389-131458411 CAACTCTTCCAGTGTGGCCCAGG - Intronic
1061726196 9:132583136-132583158 CTACTCTAGCAGCGGGCAGCCGG + Exonic
1062320702 9:135989319-135989341 CTGCTCTGCCAGCGTGCTCCAGG + Intergenic
1203526848 Un_GL000213v1:98272-98294 CACCTCTGCAAGGGTGCACCTGG - Intergenic
1203526968 Un_GL000213v1:98911-98933 CACCTCTGCAAGGGTGCACCTGG - Intergenic
1203527069 Un_GL000213v1:99541-99563 CACCTCTGCAAGGGTGCACCTGG - Intergenic
1187015097 X:15318714-15318736 CAAATCTTCCAGCGTGGCCCAGG - Intergenic