ID: 1077307006

View in Genome Browser
Species Human (GRCh38)
Location 11:1872977-1872999
Sequence GTGGGGGTATAGGGGGAAGC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 470
Summary {0: 1, 1: 0, 2: 3, 3: 41, 4: 425}

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1077307001_1077307006 -10 Left 1077307001 11:1872964-1872986 CCAGCGGTGGGGGGTGGGGGTAT 0: 1
1: 0
2: 3
3: 52
4: 408
Right 1077307006 11:1872977-1872999 GTGGGGGTATAGGGGGAAGCAGG 0: 1
1: 0
2: 3
3: 41
4: 425
1077306985_1077307006 19 Left 1077306985 11:1872935-1872957 CCTATCCCATCCCAAGTTGGACA 0: 1
1: 0
2: 0
3: 10
4: 150
Right 1077307006 11:1872977-1872999 GTGGGGGTATAGGGGGAAGCAGG 0: 1
1: 0
2: 3
3: 41
4: 425
1077306984_1077307006 20 Left 1077306984 11:1872934-1872956 CCCTATCCCATCCCAAGTTGGAC 0: 1
1: 0
2: 0
3: 9
4: 101
Right 1077307006 11:1872977-1872999 GTGGGGGTATAGGGGGAAGCAGG 0: 1
1: 0
2: 3
3: 41
4: 425
1077306986_1077307006 14 Left 1077306986 11:1872940-1872962 CCCATCCCAAGTTGGACAGCAGT 0: 1
1: 0
2: 1
3: 7
4: 130
Right 1077307006 11:1872977-1872999 GTGGGGGTATAGGGGGAAGCAGG 0: 1
1: 0
2: 3
3: 41
4: 425
1077306988_1077307006 9 Left 1077306988 11:1872945-1872967 CCCAAGTTGGACAGCAGTCCCAG 0: 1
1: 0
2: 1
3: 18
4: 182
Right 1077307006 11:1872977-1872999 GTGGGGGTATAGGGGGAAGCAGG 0: 1
1: 0
2: 3
3: 41
4: 425
1077306987_1077307006 13 Left 1077306987 11:1872941-1872963 CCATCCCAAGTTGGACAGCAGTC 0: 1
1: 0
2: 2
3: 17
4: 119
Right 1077307006 11:1872977-1872999 GTGGGGGTATAGGGGGAAGCAGG 0: 1
1: 0
2: 3
3: 41
4: 425
1077306989_1077307006 8 Left 1077306989 11:1872946-1872968 CCAAGTTGGACAGCAGTCCCAGC 0: 1
1: 0
2: 0
3: 12
4: 148
Right 1077307006 11:1872977-1872999 GTGGGGGTATAGGGGGAAGCAGG 0: 1
1: 0
2: 3
3: 41
4: 425
1077307000_1077307006 -9 Left 1077307000 11:1872963-1872985 CCCAGCGGTGGGGGGTGGGGGTA 0: 1
1: 0
2: 3
3: 47
4: 421
Right 1077307006 11:1872977-1872999 GTGGGGGTATAGGGGGAAGCAGG 0: 1
1: 0
2: 3
3: 41
4: 425

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1077307006 Original CRISPR GTGGGGGTATAGGGGGAAGC AGG Intronic
900330622 1:2132807-2132829 GTGTGTGTATGGTGGGAAGCGGG + Intronic
900512237 1:3066276-3066298 GTGGGGAAAAAGGGTGAAGCAGG - Intergenic
900525756 1:3127811-3127833 GTGGGGGGACAGTGGGAGGCGGG + Intronic
900526265 1:3130274-3130296 GTGGGGTTCTGGGGAGAAGCTGG + Intronic
901670912 1:10856067-10856089 GTGGGGTGTTAGGGGGAAGTGGG + Intergenic
901881989 1:12199389-12199411 GTGGGGGTTCCTGGGGAAGCTGG + Intronic
901926351 1:12568561-12568583 GTGGGGGTTTGGGGAGAAACTGG - Intronic
902048491 1:13543435-13543457 GTGGGGGTCTGAGGAGAAGCAGG + Intergenic
902396021 1:16132850-16132872 GTGCAGGTATGGGGGGAAGGTGG + Intronic
902396059 1:16132979-16133001 GTGCAGGTATGGGGGGAAGGTGG + Intronic
902994042 1:20210059-20210081 GTGGGGGCAGAGAGGGGAGCTGG + Intergenic
903178756 1:21595129-21595151 GTGGGGCTAAGGGGGGAATCGGG - Intergenic
903231064 1:21922633-21922655 GTGGAGGTGTGGGGGGAAGGAGG + Intronic
903277820 1:22232973-22232995 CTTGGGGGACAGGGGGAAGCTGG - Intergenic
904605692 1:31696447-31696469 GTGGGGCTAAAGGAGGAACCAGG + Intronic
904616153 1:31751012-31751034 CTGGGCGTCTTGGGGGAAGCAGG - Intronic
904910500 1:33930895-33930917 GTGGGGGAATAGGGAACAGCTGG - Intronic
905187910 1:36209953-36209975 GTGGAGGTAGAGAGGGAAGTGGG + Intergenic
905300408 1:36982813-36982835 GTGGGGGTGGTGGGGGAAGGAGG + Intronic
905302202 1:36993060-36993082 GTGGGGGTAAAGGGGGCAAGGGG + Intronic
906039580 1:42777867-42777889 GAGGGGACAGAGGGGGAAGCAGG - Intronic
906313951 1:44774232-44774254 GTGGGAGGGTAGGGGGAAGTGGG + Intergenic
908775042 1:67631700-67631722 CTGGGCGTGTAGAGGGAAGCTGG + Intergenic
908914449 1:69109654-69109676 GTGGGGGTAGAGAGGGAAAGAGG - Intergenic
910223963 1:84917366-84917388 GTGTGGGTATAGGGGTAATGGGG + Intergenic
910352978 1:86320898-86320920 GTGGAGGCCTAGGGGTAAGCTGG + Intergenic
910362393 1:86426546-86426568 GTGGGGGAACTGGGGTAAGCTGG + Intronic
911087125 1:93988374-93988396 GTGGGGCTGATGGGGGAAGCAGG + Intergenic
911535748 1:99098150-99098172 GTCGGGGGATAGGGGGAATGGGG + Intergenic
912502187 1:110129977-110129999 GTGGGAGCATATGGGGAAGGTGG + Intergenic
913129518 1:115827247-115827269 GTGGGGGGGTTGGGGGAGGCCGG - Intergenic
913264945 1:117034851-117034873 ATGGAGGTGTAGGGGGAAGCAGG - Intronic
914713554 1:150235829-150235851 TTGGGGGTATTGGGGAAGGCAGG - Exonic
914949209 1:152097220-152097242 GTGAGGGTACAGGGAGAAGATGG - Intergenic
915512373 1:156393155-156393177 GTGGGGGTTGAGAGGGAGGCTGG - Intergenic
915808181 1:158876836-158876858 GTAGGGGTAGAGCTGGAAGCTGG + Intergenic
916368933 1:164067147-164067169 GTGGGGGTATAGCGGGGAGGTGG - Intergenic
917712362 1:177698506-177698528 GTTGTGGTGTGGGGGGAAGCGGG + Intergenic
917979119 1:180258528-180258550 GTAGGGGCATGGGCGGAAGCGGG + Intronic
920257586 1:204666001-204666023 GTGGTGGTACAGGAAGAAGCAGG + Intronic
921283250 1:213587286-213587308 GTGGGGATAGAGGGGAAGGCAGG + Intergenic
922221782 1:223613835-223613857 CTGGGGTTATAGGGAGTAGCTGG - Intronic
922362791 1:224838601-224838623 GTGGGGGCACAGGGGGAGTCAGG - Intergenic
922767258 1:228162650-228162672 GTGGGGGGGTTGGGGGAAGGTGG - Intergenic
922794948 1:228335309-228335331 GTGGGGGGATGGGGGGATGGGGG + Intronic
924332614 1:242955063-242955085 GTGGGGGGTTAGGGGAAAGGAGG - Intergenic
924491150 1:244539007-244539029 CTGGGGCTAGATGGGGAAGCTGG - Intronic
924581892 1:245330537-245330559 GTGGGGGGACTGGGGGAAGTGGG + Intronic
1063591179 10:7396901-7396923 GTGGGGGGATGGGGGGAGGGGGG + Intronic
1063985041 10:11493426-11493448 GTAGGGGAAGAGGGAGAAGCAGG - Intronic
1067348514 10:45455543-45455565 GGGGGGGGAAGGGGGGAAGCTGG + Exonic
1068830250 10:61485817-61485839 GTGAGGGCATAGAGGGATGCTGG - Intergenic
1069474528 10:68721199-68721221 GTGGAGGAAGAGGGGGAAGTTGG + Exonic
1069887976 10:71635896-71635918 GTGGGGACACAGTGGGAAGCAGG - Intronic
1069888341 10:71637826-71637848 GTCGGGGGGTAGGGGGATGCTGG - Intronic
1070151619 10:73808560-73808582 GGGGAGGTAGAAGGGGAAGCAGG + Exonic
1070327682 10:75399181-75399203 GTAGGGGTAGAGGGGGTGGCCGG + Exonic
1070409363 10:76125250-76125272 GTGGAGGGCTAGGGGGAAGCTGG + Intronic
1070478508 10:76854638-76854660 GTGGATGGATAGGGGGAAGTAGG + Intergenic
1070601710 10:77870776-77870798 ATGGGGGTAAATGGGGGAGCGGG + Intronic
1071136182 10:82457273-82457295 GTAGGGGAATAGGGGGAATACGG + Intronic
1071520408 10:86328762-86328784 GTGGGGGTGGAGGGGGGAACGGG - Intronic
1072409200 10:95184398-95184420 GTGGGGGGATGGCGGGGAGCTGG + Intergenic
1072637361 10:97186427-97186449 GTCGGGGGATGGGGGGAAACGGG - Intronic
1072785036 10:98273562-98273584 CTGGGGGTGCAGGGGGAAGAGGG - Intergenic
1073471601 10:103725969-103725991 TTGGGGGTGTAGGGTGAGGCCGG + Intronic
1074111279 10:110424219-110424241 GTGGGGGTAGTTAGGGAAGCTGG + Intergenic
1074347833 10:112705495-112705517 GTAGGGGTAGAGGGAGAAGAGGG - Intronic
1074473216 10:113745888-113745910 GTGTGTGTATTGGGGGAAGCAGG + Intergenic
1075741268 10:124697911-124697933 GTTGGGGGATGGGAGGAAGCAGG - Intronic
1076829303 10:132986040-132986062 GTGGGGGTGCAGGGGGAGTCAGG + Intergenic
1077307006 11:1872977-1872999 GTGGGGGTATAGGGGGAAGCAGG + Intronic
1077368439 11:2170697-2170719 GTGGGGGTGTAGGATGCAGCTGG + Exonic
1077648112 11:3944460-3944482 GTGGGAGTGGAGGGGGAAGTGGG + Intronic
1077959078 11:7053932-7053954 GTGGGGGAATGAGGGGAAGAGGG - Intronic
1078490827 11:11766810-11766832 GTGGGGGTTTGGGGAGATGCTGG + Intergenic
1078513963 11:12007841-12007863 GTGGGGGCAGAGAGGGAAGATGG - Intronic
1080165652 11:29233065-29233087 TTCGTGGTAGAGGGGGAAGCAGG - Intergenic
1080554822 11:33406513-33406535 GTGGATGTAGATGGGGAAGCTGG + Intergenic
1082687642 11:56259963-56259985 TTGGGGGGATGGGGGGTAGCAGG + Intergenic
1083493432 11:63030077-63030099 GTGTGGATATGGGAGGAAGCAGG + Intergenic
1084908634 11:72369403-72369425 GTGGGGGAGGAGGGGGAAGAGGG - Intronic
1084978699 11:72816968-72816990 GTGGGGGTGGTGGGGGAGGCAGG + Intronic
1085477630 11:76797988-76798010 GTTGGGGTGTTGGGGGAAGCTGG + Exonic
1085658394 11:78338906-78338928 GTGGGGGTGTACAGGGAATCAGG - Intronic
1086129598 11:83387070-83387092 GTGGGGGTAATGAGGGAAACTGG - Intergenic
1086172802 11:83855652-83855674 GATGGGGTATAGGGGGAGGAAGG + Intronic
1087175013 11:95088721-95088743 GTGGGGCTAAAGGAGGAGGCAGG - Intergenic
1089038885 11:115426699-115426721 GAGGGGGTAAAGGGGGAAGCAGG - Intronic
1089209699 11:116791764-116791786 GTGGGGGTGTGGGTGGAGGCTGG - Intronic
1089325526 11:117654194-117654216 GTGGGGAAATAGGGGGATGTTGG + Intronic
1089565270 11:119367966-119367988 GTGGGGGTGGAGGAGGAGGCGGG + Intronic
1089792175 11:120953227-120953249 GTGGGGGTCTGGGGAGAAGTGGG - Intronic
1090264610 11:125346187-125346209 GTGGGGGTGGAGGGGTAACCTGG + Intronic
1090691463 11:129187376-129187398 GTGGGGGCATAGTGGGAGGCTGG + Intronic
1092423336 12:8352607-8352629 TTGGGGGTTCAGGGGGAAGGGGG - Intergenic
1093683994 12:22035490-22035512 GTGGGGGGATAGGAAGAAACAGG + Intergenic
1093692255 12:22121767-22121789 GTGGGGGTGGAGTGGGAAGATGG + Intronic
1094763701 12:33565501-33565523 GTGGGGGAATAGGGAGAGGTTGG + Intergenic
1095572320 12:43697412-43697434 GTTGGGGTTGAGAGGGAAGCCGG - Intergenic
1095585295 12:43843163-43843185 GAGGGGGAAGAGGGGGAAGAGGG - Intronic
1096271045 12:50166871-50166893 GTGAGGGTCTAGGGGAATGCTGG - Intronic
1096913093 12:55003544-55003566 GTGGGAGAATGGGGGGAACCCGG + Intergenic
1097099308 12:56575544-56575566 GGGGGGGTGTAGGGGTAAGGGGG - Intronic
1097211291 12:57372407-57372429 GCGGGGGTGTGGGGGGAATCAGG + Intronic
1097967344 12:65595348-65595370 GTGGGGGGATGGGGAGAAGTAGG - Intergenic
1098429936 12:70408108-70408130 GTGGGGGTGTAGATAGAAGCGGG + Intronic
1098500633 12:71187674-71187696 GTGGTAGTATAGGGGGGATCAGG - Intronic
1100348868 12:93759614-93759636 GTGGGGGTAAAGGGAGCAGTAGG - Intronic
1100892575 12:99142117-99142139 CTGAGGGTACAGGCGGAAGCAGG + Intronic
1100926499 12:99554440-99554462 TTGGGGGTAAAGGTGGAAGGTGG + Intronic
1101545971 12:105713118-105713140 TTGGGGATATTCGGGGAAGCAGG + Intergenic
1101760116 12:107651470-107651492 GTGGGGGAAGACGGGGGAGCGGG - Intronic
1103239011 12:119397997-119398019 GTGGGGGGATGGGAGGAAGGGGG + Intronic
1103358859 12:120342099-120342121 GCGGGGGTCGAGGGGGAAGGGGG + Exonic
1104826678 12:131715324-131715346 GTGGAGGGATATGGGGAAGCAGG - Intronic
1105304930 13:19161603-19161625 GTGGGGGAGTAGGGGGGAACAGG + Intergenic
1105655219 13:22429424-22429446 GTGGGGGTATTGGGGGTGGGGGG - Intergenic
1107839069 13:44436964-44436986 GTGGGGGGAGGCGGGGAAGCAGG - Intronic
1108000872 13:45904639-45904661 GTGGGGGCAGCGGGGGCAGCTGG + Intergenic
1108626721 13:52236227-52236249 GTGGGGGTGTGGGAGGAAGATGG - Intergenic
1108659347 13:52570258-52570280 GTGGGGGTGTGGGAGGAAGATGG + Intergenic
1109048301 13:57441479-57441501 GTGGAGGTGGAGGGGGAAGCAGG + Intergenic
1109193210 13:59350126-59350148 GTGGGGGTAGCGGGGAGAGCAGG + Intergenic
1110923818 13:81125058-81125080 GTGGGGGAATAGGGAGAGGTTGG - Intergenic
1114583163 14:23784186-23784208 CTGGGGGAAAAGGGGGAATCTGG + Intergenic
1114811164 14:25901305-25901327 GTGTGTGTATAGGGGGGAGATGG - Intergenic
1116151099 14:41144114-41144136 TTGGGGGTAGATGGGGGAGCTGG + Intergenic
1116426554 14:44798832-44798854 GTGGGGGGAGCGGGGGGAGCAGG - Intergenic
1117368318 14:55052236-55052258 GTGGGGGTAGAGGGGAAATCGGG - Intronic
1117671355 14:58109887-58109909 GTGGTGGTGGAAGGGGAAGCAGG + Intronic
1119474220 14:74917917-74917939 GTGGGGGTGCTGTGGGAAGCGGG + Intronic
1119774401 14:77239526-77239548 GTGGGGGTAAAAGGGGAGGATGG + Intronic
1120541928 14:85761478-85761500 GTCGGGGTATGTGGGGAAGCAGG + Intergenic
1120668981 14:87342115-87342137 GTGGAGGTGTAGGGGGAGGTGGG + Intergenic
1121172254 14:91864322-91864344 GTAGGGGAGTAGGGGGAAGGAGG + Intronic
1121600383 14:95198993-95199015 CTGGGGGAAGAGGGGGAAGATGG + Intronic
1126669357 15:51102088-51102110 GTAGGGGTATTGTGGGAGGCTGG + Intronic
1126860489 15:52878118-52878140 GTGGGGGTAAAAGGACAAGCTGG + Intergenic
1127975841 15:63996873-63996895 GTGGGGGCAGAGGGGGATGGGGG - Intronic
1128124950 15:65185369-65185391 GTGGGGGTAGAAGGAGAAGGAGG - Intergenic
1128406932 15:67351235-67351257 GTTGGGGGGTGGGGGGAAGCAGG - Intronic
1128683530 15:69667842-69667864 GTGCTGGGAAAGGGGGAAGCTGG + Intergenic
1129208910 15:74054144-74054166 GTGGGGGTAGAGGGGGGTGGGGG + Intergenic
1129238031 15:74235343-74235365 GTGGGGGTAGAGAGGGAGGCTGG + Intergenic
1129452763 15:75659949-75659971 GTGGGGGTATTGGGGGAACTTGG + Exonic
1130884833 15:88084205-88084227 GTTGGGGTCTCTGGGGAAGCAGG - Intronic
1131424092 15:92331133-92331155 GTGGGGGTTGTGGGGGAAGAAGG + Intergenic
1132144976 15:99424345-99424367 GTGGAGGTGGAGGGGGAGGCAGG + Intergenic
1132540208 16:504894-504916 ATGGGGGTATAGGAGGAGGTGGG - Intronic
1132639619 16:971596-971618 GTGGGGGAAGAGGGGGACTCAGG + Intronic
1132659942 16:1056812-1056834 GAGGGGGTGGAGGGGGAAGGTGG + Intergenic
1133022710 16:2973958-2973980 ATGGGGGGCTAGGGGGAAGGTGG - Intronic
1134218599 16:12335677-12335699 GTTGGGGGTTTGGGGGAAGCTGG + Intronic
1134320192 16:13155790-13155812 GTAGGGGGAGAGGGGGAAGTGGG - Intronic
1134405298 16:13953018-13953040 GTGGGGTTATGGGGGGTAGTGGG + Intergenic
1134672823 16:16068297-16068319 GTGCAGGTACAGGGGGAAGCTGG + Exonic
1135334532 16:21589762-21589784 GTGGTGTGAGAGGGGGAAGCTGG + Intergenic
1136233607 16:28902096-28902118 GTGGGCGTCCAGGAGGAAGCCGG + Intronic
1137693135 16:50442865-50442887 GTGGGGGGGTGGGGGGAAGTGGG + Intergenic
1139466878 16:67158961-67158983 GTGGGGGTCGAGGGGGAGGTGGG + Intronic
1139486929 16:67263111-67263133 GTGGAGGAATAGGAGGCAGCAGG + Intronic
1139658122 16:68401450-68401472 ATAGGGGTATAGGAGGCAGCAGG + Intronic
1139662436 16:68430205-68430227 GAGGGGGCATAGAGGGAAGAGGG - Intronic
1139828967 16:69781230-69781252 GTGGGGGGATACTGGGGAGCAGG + Intronic
1140320313 16:73944592-73944614 GTTGGGGGATAGGGGGAAAGGGG + Intergenic
1140550886 16:75864314-75864336 GTGGGGGGATAGGGGGTGGTAGG - Intergenic
1140982898 16:80127616-80127638 GTGAGGGAAGAGGTGGAAGCAGG + Intergenic
1141127282 16:81409548-81409570 GAGGGGGTATTGGGAGAAGCAGG + Intergenic
1141667622 16:85474109-85474131 GTGAGGGTTGAGGCGGAAGCAGG + Intergenic
1141683585 16:85557424-85557446 GTGGGGGTGTAGGGAGGAGAGGG + Intergenic
1142247334 16:88976124-88976146 GTGGGGGTTTACGGGGAACCTGG - Intronic
1142478565 17:204419-204441 GTGGGGGCATAGGGGGTAGTTGG - Intergenic
1142496055 17:306898-306920 GTGGGGGCATCGGGCGCAGCTGG - Intronic
1142807819 17:2380660-2380682 GTTGGGGTAGAGGAGGAAGTGGG - Exonic
1143642008 17:8204537-8204559 GTGAGGGTAGAGGTGGAAGTGGG + Intergenic
1143665902 17:8359928-8359950 GTGGGGGTAGAGTGGGGAGGAGG + Intergenic
1144484959 17:15656670-15656692 GCTGGGGTAGAGGGGGAGGCTGG - Intronic
1146905968 17:36618070-36618092 CTGGGGCTTTAGGGGGAAGTGGG + Intergenic
1146935293 17:36809165-36809187 GGGGGGTTATAGGGGGAAGTGGG - Intergenic
1147573363 17:41585152-41585174 GTGGGGGAAAAGGGGGATTCAGG - Intronic
1147840294 17:43366867-43366889 GAGGGGGCATAGGTGGTAGCAGG - Intergenic
1148111581 17:45147521-45147543 GGGGGAGTGGAGGGGGAAGCGGG - Intergenic
1149269853 17:54966557-54966579 GTGGGGGTATAGGGTGCTACTGG - Intronic
1149675415 17:58456420-58456442 GTGGGGATATTGGGAGAAGTTGG + Intronic
1150765003 17:67995695-67995717 GTGGAGGGCTGGGGGGAAGCGGG - Intergenic
1151886021 17:76923819-76923841 GAGGGGGTGTTTGGGGAAGCGGG + Intronic
1151945885 17:77319642-77319664 GTTGGGGTACAGGGTGAAGAAGG + Intronic
1152058840 17:78053289-78053311 TTGGGGGGATAAGGAGAAGCAGG + Intronic
1152231778 17:79117522-79117544 GTGTGGGTGTGGAGGGAAGCGGG - Intronic
1152251414 17:79214563-79214585 GGGGGGGTCTCGGAGGAAGCAGG + Intronic
1152382336 17:79948567-79948589 GAGGGGGTGCATGGGGAAGCTGG + Intronic
1152699238 17:81810987-81811009 CTGGGGGTGTGGGGGGAGGCTGG - Intronic
1152840019 17:82561409-82561431 GTGAGGGTAGAGGGAGAAACTGG + Intronic
1152912085 17:83010705-83010727 GTGGGGGCAGAAGTGGAAGCAGG + Intronic
1153939896 18:9968618-9968640 ATGGGGCTAGAGGGGGAAGCGGG - Intergenic
1155921318 18:31605867-31605889 GTGGGGGGCTTGGGGGAGGCAGG + Intergenic
1158067775 18:53433767-53433789 GTGTGTGTACAGGGGGAAGGTGG - Intronic
1159071238 18:63625944-63625966 GTGGAAGTCTATGGGGAAGCTGG + Intergenic
1160064873 18:75565250-75565272 GTGGGGGCATGGGGGGAATCAGG + Intergenic
1160598537 18:79994777-79994799 GTGGGGGTGTAGGTGGAGGTAGG - Intronic
1160844207 19:1159492-1159514 GTGGGGGGACAGGGGGCAGCAGG + Intronic
1161610191 19:5238056-5238078 GGGAGGGAAGAGGGGGAAGCAGG + Intronic
1161853555 19:6751327-6751349 TTGGGGGTGGAGGGGGCAGCAGG - Exonic
1162430606 19:10625923-10625945 GAGGTGGGATAGGGGGAAGGAGG - Intronic
1162927225 19:13936685-13936707 GTGGGGGTGTTGGGGGAATTGGG - Intronic
1164659523 19:29950260-29950282 CTGGGGGGAAAGGGGGAAGAAGG + Intronic
1164866973 19:31612588-31612610 GTCAGGGAAGAGGGGGAAGCTGG + Intergenic
1165808767 19:38597604-38597626 GTGTGTATGTAGGGGGAAGCAGG + Intronic
1165900789 19:39168352-39168374 GTGGGGCCTTAGGGGGGAGCAGG + Intronic
1166364008 19:42269464-42269486 GAGGGGGTACAGGGGGAAAGGGG + Intronic
1166581464 19:43903693-43903715 GTGGAGGTCTAGTGGGAAACCGG + Intergenic
1166874823 19:45890886-45890908 GTGGGGGCAGAGGTGGAGGCAGG + Exonic
1166930535 19:46298835-46298857 GTGGGGGTTTAGGTTGTAGCTGG - Intronic
1167648671 19:50718669-50718691 GTGGGGGGACAGGGGGCGGCTGG + Intronic
1167851289 19:52204364-52204386 GTAGGGGCAAAGGTGGAAGCAGG + Intronic
1168020784 19:53607201-53607223 TTGTGGGAATAGGGGGAATCTGG - Intergenic
1168173438 19:54606606-54606628 GTGGGGGCATGAGGGGATGCTGG - Intronic
1168173871 19:54608829-54608851 GTGGGGGTATGGGCAGAGGCAGG - Intronic
926221233 2:10936922-10936944 GTGGGGGGACAGGGGTAAGGAGG + Intergenic
926718762 2:15943199-15943221 GTGGGGGTTTAGGGGGTTGCTGG + Intronic
927189353 2:20506517-20506539 GTGGCTGTCTAGGGAGAAGCAGG + Intergenic
927393504 2:22622909-22622931 GTGTGGCTATAGGGGTGAGCTGG + Intergenic
930014414 2:46960485-46960507 GTAGGGGGATGGGGGGAAGCAGG + Intronic
930097061 2:47572825-47572847 GTGGGGGTACTGGGGGAACAGGG - Intergenic
930675006 2:54191134-54191156 TTGGGGGCACAGGGGAAAGCAGG - Intronic
931419884 2:62117083-62117105 GTGGGGGCAAAGAGGGAGGCAGG - Intronic
931749262 2:65316606-65316628 GTGGGGGTAAAGGCAGGAGCAGG + Intronic
931867981 2:66432490-66432512 GTGGGGGGATGGGGGGAGGCCGG + Intergenic
932429231 2:71664084-71664106 GTGTGTGTGTAGGGGGAAGGGGG - Intronic
932495046 2:72142081-72142103 GTGGGGGGAAGGGGGGATGCTGG - Intronic
933657933 2:84905056-84905078 GGGGGGGTGTAGGGGGAGGGGGG - Intronic
934113993 2:88766362-88766384 GTGGGGGTATATGGGGTGGCGGG + Intergenic
934301456 2:91778992-91779014 GTGGGGCTCAGGGGGGAAGCAGG + Intergenic
934636036 2:95991324-95991346 GTGGCGGTATATGGGGTGGCGGG - Intronic
934648003 2:96070480-96070502 CTGGGGGCATAGGGAGGAGCTGG + Intergenic
934733223 2:96672598-96672620 TTGGGGGCATAGTGGGCAGCTGG + Intergenic
934797611 2:97114102-97114124 GTGGCGGTATATGGGGTGGCGGG + Intronic
934835803 2:97589337-97589359 GTGGCGGTATATGGGGTGGCGGG - Intronic
935716742 2:105945925-105945947 GTGTGGGTGTAGGGGGATGGTGG + Intergenic
937724778 2:125149726-125149748 GTGGGGGGATAGGGGGCTGGGGG - Intergenic
938103474 2:128513835-128513857 GTGAGGGAATAAGAGGAAGCAGG - Intergenic
940721924 2:157291767-157291789 GAGGGGATATAGGGAGAGGCGGG - Intronic
941029477 2:160494030-160494052 GTGGGGGTGGAGGGGGAATGCGG + Intergenic
943255040 2:185583782-185583804 GTGGGGGAAGAGTGGGAAGAGGG + Intergenic
944837567 2:203595046-203595068 GTGTGGGGATAGGGGGAATATGG + Intergenic
944919021 2:204391077-204391099 GTAGGGGGATAGGGAGAAGTTGG - Intergenic
945254491 2:207792274-207792296 GTGGGGGGAGGGGGGGAAGGGGG - Intergenic
945865278 2:215167641-215167663 GTGGGGGAATAGTGGGAGGGGGG + Intergenic
946179961 2:217943076-217943098 GTGGGGGGAGAGGGAGGAGCAGG + Intronic
946201995 2:218075920-218075942 GTGGGGCAATAGGGAGAGGCGGG - Intronic
946307892 2:218866245-218866267 GTGGGGAAATAGAGGGAGGCTGG + Intronic
946895356 2:224318570-224318592 GTGCGGGGATAGGAGGAGGCAGG - Intergenic
948394604 2:237635417-237635439 GTGGGGATGGAGGTGGAAGCAGG + Intronic
948502970 2:238408405-238408427 GTTGGGGGATAGGGGCAGGCAGG - Intergenic
949040817 2:241849372-241849394 GTGGGGGCAGCGGGGGAGGCGGG - Intergenic
1169401872 20:5288816-5288838 GTGGGGGGAAAGGTGGAAGGGGG + Intergenic
1170118269 20:12884799-12884821 GTGGGGGTATGGGGTAAAGGTGG + Intergenic
1170589053 20:17757357-17757379 GGGCTGGTATAGGGGGAAGGTGG + Intergenic
1171111842 20:22491245-22491267 GTGGGGGCACAGCGGGCAGCAGG - Intergenic
1171372073 20:24668610-24668632 GTGGGGGTACCCGGGGAGGCGGG - Intergenic
1171938439 20:31299695-31299717 GTGGGGATGTAGGGGTAAGTGGG + Intergenic
1172337349 20:34128293-34128315 GCGGGGCTATAGGGTGAAGGTGG - Intergenic
1172338479 20:34136341-34136363 GCGGGGCTATAGGGTGAAGGTGG - Intergenic
1172587355 20:36093840-36093862 GTGGGGGGCTGGGGGGAGGCCGG - Intronic
1172635471 20:36406965-36406987 GTAGGGGTGTAGGGGACAGCGGG + Intronic
1173904190 20:46613822-46613844 CTGGGGGCAGAGGGGGAAGGAGG + Intronic
1174135685 20:48377415-48377437 GTGGGGGTCTTGTGGGAAGGTGG - Intergenic
1175592754 20:60206598-60206620 GAGGGTGATTAGGGGGAAGCTGG + Intergenic
1175852533 20:62101521-62101543 GTGTGGGTGTAGGGGGATGAGGG + Intergenic
1175944391 20:62551930-62551952 CTGGGGGTCAAGGGGAAAGCTGG - Intronic
1178819459 21:35962113-35962135 GTGTGGGTAAAGGGAGAAGCAGG - Intronic
1178855981 21:36250811-36250833 GTGGGGGTCTTGCAGGAAGCCGG - Intronic
1179278960 21:39917463-39917485 CTGGTGGTAGAGGGAGAAGCTGG + Intronic
1179372234 21:40817196-40817218 GTGGGTGTGGAAGGGGAAGCCGG - Intronic
1180352867 22:11818606-11818628 GTGAGGTTAGAGGGAGAAGCTGG - Intergenic
1180385374 22:12173751-12173773 GTGAGGGGAGAGGGAGAAGCTGG + Intergenic
1181201168 22:21218067-21218089 GTGGGGCTCAGGGGGGAAGCAGG - Intronic
1181406727 22:22690224-22690246 GTGAGTGGACAGGGGGAAGCTGG + Intergenic
1181774651 22:25150527-25150549 GTTGGGGTGTCGGGGGAGGCAGG - Intronic
1181811005 22:25404109-25404131 CTGGAGGTGTAGGGGGCAGCGGG - Intronic
1181932186 22:26411082-26411104 GTGGGGGTTAAGGGAGAAGAAGG - Intergenic
1182548800 22:31090348-31090370 ATGGGGGTGGAGGGGGAGGCTGG - Intronic
1183338789 22:37266760-37266782 GTGTGGCTTTAGCGGGAAGCAGG - Intergenic
1183377802 22:37475150-37475172 CTGGGGGTACAGGGAGAATCAGG + Intronic
1183617458 22:38954329-38954351 GTGGGGGTATGGGGGACAGAGGG + Intronic
1183627657 22:39014495-39014517 GTGGGGGCAGCGGGGGAACCAGG - Intronic
1183724835 22:39582754-39582776 GTGGGTGTATGGGGGAAAGATGG - Intronic
1183858807 22:40654103-40654125 CACGGGGTATGGGGGGAAGCAGG + Intergenic
1184460681 22:44636242-44636264 GTGGGGGTTGCAGGGGAAGCAGG - Intergenic
1184976455 22:48065885-48065907 GAGGGAATATAGAGGGAAGCTGG + Intergenic
1185025528 22:48408196-48408218 GTGGGGGTGTAGAGAGAAGCAGG - Intergenic
1203225745 22_KI270731v1_random:77364-77386 GTGGGGCTCAGGGGGGAAGCAGG + Intergenic
1203265083 22_KI270734v1_random:9420-9442 GTGGGGCTCAGGGGGGAAGCAGG - Intergenic
951781522 3:26368596-26368618 GTGGGGGGACAGAGAGAAGCTGG + Intergenic
952025674 3:29078372-29078394 GTGGAGATATATGGGAAAGCAGG - Intergenic
952515842 3:34104148-34104170 GTTGGGGTATAGAATGAAGCGGG - Intergenic
952683243 3:36120213-36120235 GGGTAGGTATTGGGGGAAGCTGG + Intergenic
953048267 3:39315487-39315509 GTGGGGGAAAAGGGGTAAGCAGG - Intergenic
954150212 3:48653586-48653608 CTGAGGGTATAGGGGTGAGCAGG + Intronic
954434205 3:50487397-50487419 GTGGGGGCATTGGAGGGAGCTGG - Intronic
954456072 3:50600516-50600538 GTGGGGGTAGTGGGGGAAGGGGG + Intergenic
954910186 3:54099060-54099082 ATGGGGGGATGGGGAGAAGCCGG - Intergenic
955292780 3:57707817-57707839 GTGGAGGCATAGGGGGAAGTGGG + Intergenic
955642960 3:61106441-61106463 GTGGGGGAATAGGGAGATGCTGG - Intronic
956581214 3:70816123-70816145 GTGAAGGTATAGGGTGAAGTGGG + Intergenic
956725694 3:72154905-72154927 GTGGGGGCATGGAGAGAAGCAGG - Intergenic
957124526 3:76141730-76141752 GTGTGGGCATAGGGGGAATGTGG + Intronic
957359479 3:79135177-79135199 GTGGGGGTTTGGGGAGATGCTGG - Intronic
957368587 3:79259565-79259587 GTGGGGGCATAGGGGGAGGTGGG - Intronic
957980246 3:87500180-87500202 GTGTGGGTGGAGGTGGAAGCTGG - Intergenic
959095684 3:101952942-101952964 GTTGGGGTCTAGGGGGAAGAAGG - Intergenic
960013756 3:112862049-112862071 GTGGGGGAATGGTGGGAAGGTGG - Intergenic
961486596 3:127221514-127221536 GTGGGGGTGTTGGGGGTAGTTGG + Intergenic
964853263 3:161117975-161117997 GTGGGGGTCTGGGGGGTAGGTGG + Intronic
966604589 3:181809694-181809716 TTGGGGGTTGAGGGGGAAGCAGG - Intergenic
966679577 3:182627246-182627268 GTGGGGGAATGGGAGGAAGCAGG + Intergenic
968900435 4:3429004-3429026 GTGGGGCCATAGGGAGGAGCTGG - Intronic
968929548 4:3571447-3571469 GTGGGGGTGAGGGAGGAAGCTGG + Intergenic
969578212 4:8048694-8048716 GTGGGAGTCCAGGAGGAAGCTGG - Intronic
971456187 4:26847020-26847042 ATGGGTGTATGGGTGGAAGCTGG - Intergenic
971470785 4:27023850-27023872 GTGGGGGGATATGGGGATTCAGG + Exonic
973105378 4:46329445-46329467 GTGAGGGTATATGCTGAAGCTGG - Intronic
973726982 4:53786719-53786741 GTGGGGGTGGAGGGAGACGCAGG + Intronic
974960058 4:68687334-68687356 CTGGGGGCATGGGGGTAAGCAGG + Intergenic
976379176 4:84379707-84379729 GTGGGGGGAGAGGGAGGAGCAGG + Intergenic
976953744 4:90867675-90867697 GTGGAGGTATTGGGGGAAGAGGG - Intronic
977826122 4:101533727-101533749 GTGGTAGTATAGGGAGAATCAGG - Intronic
978886262 4:113769774-113769796 GTGGGGGAAGTGGGGGAAGAAGG - Intergenic
979017717 4:115455223-115455245 GTGTGGGGATAGGGTGAAGGTGG + Intergenic
981012936 4:139944324-139944346 GTGGTGGGATGGGGGGAAGGGGG - Intronic
981900636 4:149857898-149857920 ATGGTGGTATAGAGGCAAGCTGG + Intergenic
982275046 4:153629794-153629816 GTGGGGAGATGGGGAGAAGCTGG - Intronic
983055930 4:163098843-163098865 GTAGGTGGATAGGGGGCAGCTGG - Intergenic
984885111 4:184442894-184442916 GTGGGGGTGGTGGGGGCAGCGGG + Intronic
985617223 5:930497-930519 GTGGAAGTCTAAGGGGAAGCAGG - Intergenic
986192415 5:5509631-5509653 GTGGGAGTTGAGGGGGAAGAGGG + Intergenic
986980943 5:13447589-13447611 GAGTGGGTGTAGGGGGAAGGAGG - Intergenic
988209473 5:28184673-28184695 GTGGTGGGATGGGGGGAAGGGGG - Intergenic
989823146 5:45819777-45819799 GTTGGGGTATAGGGGGCAAGAGG + Intergenic
992387625 5:76300988-76301010 ATGGGAGTACAGGGGGAAACAGG - Intronic
994347255 5:98701130-98701152 GTGGTAGTATAGGGAGAATCAGG - Intergenic
994703721 5:103172482-103172504 GTGGGGGTAGAGTGGGAAAGAGG - Intronic
995341363 5:111064574-111064596 TTGGGGGTTTGGGGGAAAGCAGG + Intergenic
997631164 5:135369847-135369869 TTGGGAGTGTTGGGGGAAGCAGG - Intronic
997828051 5:137125150-137125172 CTGGGGGTACAGGGCCAAGCTGG - Intronic
998116716 5:139543433-139543455 ACGTGGGTATAGAGGGAAGCTGG - Intronic
998807483 5:145933096-145933118 ATGGGGGTATAAGTTGAAGCAGG + Intergenic
999154680 5:149450047-149450069 ATGAGGGGATAGGGGGAAGTGGG - Intergenic
1000956839 5:167553766-167553788 GTTGGGGTAGAGGGGAAAGAGGG + Intronic
1001232015 5:169996811-169996833 GTGGGGGCTTAGGGGGTAGTAGG + Intronic
1001237468 5:170042353-170042375 TTGGGGGTAGTGGAGGAAGCAGG - Intronic
1001556386 5:172640474-172640496 TTGGGGGCATAGGGAGAATCTGG - Intergenic
1001948226 5:175797488-175797510 GTGGGGGTCTGGAGGGAAGACGG - Intronic
1002363255 5:178690424-178690446 GTGGGGGGATGGGGGGATGCTGG - Intergenic
1003505856 6:6739987-6740009 GTGGGGGGATGGGAGGATGCAGG - Intergenic
1003893430 6:10584162-10584184 GTGGGGCTATAGGGTGAAGGTGG + Intronic
1004415221 6:15417146-15417168 GTGGGTGAGTAGGGGGAAGAGGG + Intronic
1004512227 6:16292293-16292315 GTGGGGGGATTGGGGGGAGTGGG + Intronic
1005442668 6:25887427-25887449 GTGGGGATACAGGGAGAAGACGG - Intergenic
1006460103 6:34153179-34153201 GTGGGGATATAGGGATGAGCTGG - Intronic
1006498248 6:34439829-34439851 GGGGGGGTGCAGGCGGAAGCAGG - Intergenic
1006850774 6:37096642-37096664 GTGGGGGTAGAGGGGTATGGGGG + Intergenic
1006997071 6:38270941-38270963 GTAGGGGGATAGGGGAAAGGAGG + Intronic
1007002583 6:38328420-38328442 GTGAGGGTATAGCGAGAAGGTGG + Intronic
1007436916 6:41820361-41820383 GTGGTGGTAGGGAGGGAAGCTGG - Intronic
1008493238 6:52107320-52107342 GTGGAGGAAGAGGGAGAAGCTGG - Intergenic
1008855870 6:56086654-56086676 GAAGGGGTAAAAGGGGAAGCAGG + Intronic
1010176502 6:73033717-73033739 GGGTGGGTATGGGGGGAAGGGGG - Intronic
1010839365 6:80630007-80630029 GTGGGGGTATAGAGGGGAAGTGG + Intergenic
1011914750 6:92489273-92489295 GTGGGGGCATGGGGGGCAGGTGG + Intergenic
1012945748 6:105463845-105463867 GTGGGGGGATGGGGGGGAGAGGG - Intergenic
1013253044 6:108354043-108354065 GTGGTGGGAGATGGGGAAGCAGG + Intronic
1013350571 6:109302087-109302109 GGTGGGGTATAGGGGGAGGAAGG + Intergenic
1013820229 6:114145744-114145766 GTGGGGGTGCTGTGGGAAGCAGG + Intronic
1014140587 6:117937940-117937962 GTGGTGGCATAAGGGGAAGGAGG - Intronic
1015762733 6:136682306-136682328 GTGGGGAGAGAGGGGGAAGGAGG + Intronic
1017165887 6:151408092-151408114 GTGGGGTTATTGGGGGATGAAGG + Intronic
1017479533 6:154837773-154837795 GTGGGGGTATGGGGAGTAGAGGG + Intronic
1018897172 6:168027697-168027719 GTGGGGATGTGGAGGGAAGCCGG - Intronic
1020035343 7:4960111-4960133 GTGGGGGTGTTGGAGGGAGCGGG + Intergenic
1020916383 7:14198837-14198859 GAGGAGGGATAGGGGGAACCTGG + Intronic
1021697123 7:23286339-23286361 GAGGGGGGAGAGGGGGAAGGAGG - Intergenic
1021894444 7:25220955-25220977 GTGGGGCTTCAGGGGGACGCGGG - Intergenic
1022283202 7:28931120-28931142 GTCGGGGGATAGGGGGATGAAGG - Intergenic
1022381031 7:29860231-29860253 GTAGGTGTATAGGTGGAAGTGGG - Intronic
1023583385 7:41705049-41705071 GTGGGGGTGGTGGAGGAAGCAGG + Intergenic
1023862998 7:44226797-44226819 GGGGGGGTGTGGGGGGAAGATGG + Intronic
1023863010 7:44226836-44226858 GAGGGGATATAGGGGAAAGAAGG + Intronic
1024942268 7:54775296-54775318 GTGGGGAGATAAGCGGAAGCTGG + Intergenic
1024951578 7:54866655-54866677 GTGGGGCTATTGAGAGAAGCTGG - Intergenic
1025121599 7:56308699-56308721 GTTGTGGTGTAGGGGGAAGGGGG - Intergenic
1025807517 7:64849457-64849479 GTGGTAGTATAGGGAGAATCAGG + Intergenic
1026385173 7:69839688-69839710 GTGGGGGTATTCAGGAAAGCAGG + Intronic
1026503889 7:70965942-70965964 GTGAGGATATAGGGAGAAGGTGG + Intergenic
1028616406 7:92772702-92772724 GTGAGGGTGGAGGGGCAAGCAGG - Intronic
1029481575 7:100816669-100816691 CTGGGGGTACAGAGTGAAGCAGG + Intronic
1029630199 7:101745455-101745477 GTGGGGGTCCAGGGGGGACCAGG + Intergenic
1029745163 7:102512445-102512467 GTGGGGGTTAAGAGGGAAGGGGG + Intronic
1029747082 7:102521982-102522004 TTGGTGGGGTAGGGGGAAGCTGG - Intergenic
1029763155 7:102611606-102611628 GTGGGGGTTAAGAGGGAAGGGGG + Intronic
1029765035 7:102621071-102621093 TTGGTGGGGTAGGGGGAAGCTGG - Intronic
1030198030 7:106872191-106872213 GGAGGGGTAGAGGGGGAAGATGG - Intronic
1030434719 7:109502148-109502170 GTGGAGGTTTAGTGAGAAGCTGG - Intergenic
1031743757 7:125468317-125468339 GTCGGGGAACTGGGGGAAGCTGG - Intergenic
1031886665 7:127251983-127252005 ATGGGGGTCGCGGGGGAAGCCGG - Intronic
1032290530 7:130586310-130586332 TTGGGGGGAGAGTGGGAAGCAGG + Intronic
1032504464 7:132425001-132425023 GTGGGGCTAGAGAGGGCAGCTGG - Intronic
1033233499 7:139620114-139620136 ATGTGGGAATAGGGGGAAGGGGG - Intronic
1033314139 7:140283737-140283759 ATGGGGGTATCTGGGGAAGAGGG - Intergenic
1033849692 7:145480216-145480238 GGAGGGGTTTAGGAGGAAGCTGG + Intergenic
1034402944 7:150877842-150877864 GTGGGGATCTAGGAGGAAGCAGG - Intergenic
1034659838 7:152759671-152759693 GTGGGGGTGTTGGGGGAGGCGGG + Intergenic
1034914368 7:155024643-155024665 GTGAGGGTAGAGTGAGAAGCTGG + Intergenic
1035299413 7:157887522-157887544 GAGCGGGTACTGGGGGAAGCGGG - Intronic
1035399132 7:158553393-158553415 GTGTGTGTATAAGGGGAGGCTGG - Intronic
1036447840 8:8838473-8838495 TGTGGGGTATAGGGGGAAGAAGG - Intronic
1037319806 8:17631781-17631803 GTGGGGGAGGTGGGGGAAGCTGG - Intronic
1037509094 8:19563599-19563621 CTGTGGGAATAGGAGGAAGCAGG - Intronic
1039648398 8:39312808-39312830 ATAGGAGTATAGGGGAAAGCTGG - Intergenic
1040354057 8:46598623-46598645 CTGGGGGTTTAGGAGGAAGAGGG + Intergenic
1041212159 8:55563486-55563508 ATGGGGGAGTAGGGGTAAGCGGG - Intergenic
1043305395 8:78787262-78787284 ATGGGGGTGGAGGGGGAAGGAGG + Intronic
1044434936 8:92150830-92150852 GTGGGGGTGGAGGGGGCAGGGGG + Intergenic
1044545148 8:93450953-93450975 ATGATGGTAGAGGGGGAAGCAGG - Intergenic
1045913063 8:107433142-107433164 GTGTGGGTATAGGGGAAATTGGG + Intronic
1047046900 8:121063958-121063980 GTGAGAGTATAGTGAGAAGCTGG - Intergenic
1047289965 8:123521200-123521222 CTGGGGGTAGAGTGGGAAACAGG - Intronic
1047343628 8:124006233-124006255 GTGGGGGTTTCAGGGGAAGATGG + Intronic
1048890207 8:138940464-138940486 GTGGGGGGATTGGGGGAGGTGGG - Intergenic
1048890218 8:138940483-138940505 GTGGGGGGGTGGGGGGAAGGTGG - Intergenic
1048981053 8:139703575-139703597 GGAGGGGTAAAAGGGGAAGCAGG - Intergenic
1049222234 8:141433412-141433434 GTGGGGGTGGAGGGAGACGCTGG + Intergenic
1049760728 8:144330953-144330975 GGCGGGGTGTAGGGGGAAGCAGG + Exonic
1053089346 9:35259777-35259799 GTGTGTGTGTAGGGGGATGCGGG + Intronic
1054460730 9:65461019-65461041 GTGGGGGTGAGGGAGGAAGCTGG - Intergenic
1056055952 9:82824294-82824316 CTGGGATTATAGGGGGAAGAAGG + Intergenic
1057614797 9:96579650-96579672 GTGGAGGTACAGGGAGAAGGCGG + Intronic
1058557875 9:106189564-106189586 GTGGGGTGGTAGGGGGAAGTGGG - Intergenic
1058772005 9:108244098-108244120 GTGGAGGTAGAGGAGGAAGTAGG - Intergenic
1058847487 9:108975335-108975357 GTGGGGGTAGGGGGGGCAACAGG + Intronic
1059456254 9:114402178-114402200 CTGGGGGTGCAGAGGGAAGCTGG + Exonic
1061620352 9:131807646-131807668 GGGGGAGTATAGGGGGAGCCAGG - Intergenic
1061925316 9:133803371-133803393 GTGGGGGCATACGGGGACGTGGG - Intronic
1062255838 9:135620145-135620167 GGGGGAGTAGAGGGGGAAGGGGG - Intergenic
1062261188 9:135663984-135664006 TTGGGGGTAAAGGGGGGATCTGG + Intronic
1062430671 9:136525634-136525656 GTGGGGGTCCTGTGGGAAGCCGG - Intronic
1062517971 9:136945561-136945583 TGGGGGGTGTAGAGGGAAGCAGG + Intronic
1186202560 X:7169131-7169153 GTGGGGGTATGGGAGGAATGTGG - Intergenic
1186286709 X:8052102-8052124 GTGCGGGGTCAGGGGGAAGCGGG - Intergenic
1186652818 X:11579034-11579056 GTGGGGGGATGGGGGGATGGGGG + Intronic
1187884710 X:23878758-23878780 GTGGGGGTCTGGGGGAAAGGTGG - Intronic
1188275137 X:28191511-28191533 GTAGGGGTATTGGGGGAATAGGG - Intergenic
1188697722 X:33216445-33216467 GAGGGGGAATGGAGGGAAGCGGG + Intronic
1192035363 X:67557136-67557158 GTGGGAGCAAGGGGGGAAGCAGG + Intronic
1193990385 X:88299747-88299769 GTGAGGGTACAGGGAGAAGATGG + Intergenic
1194766950 X:97852459-97852481 GTGGGGGTAGGGTGGGAAGTTGG + Intergenic
1196210474 X:112990365-112990387 GTGGGATTATAGGAGCAAGCTGG + Intergenic
1196531216 X:116788839-116788861 ATGGGGGGAAAGGGGGAAGGGGG + Intergenic
1196574011 X:117297489-117297511 GTGGGGGTGTTGTGGGAAGTTGG - Intergenic
1197408928 X:126091970-126091992 GTGAGGGGTTAGGGGGAAGGTGG + Intergenic
1198025450 X:132701602-132701624 GTGGGAGAAGATGGGGAAGCAGG - Intronic
1198342769 X:135731418-135731440 GTGGGGGTGTCGGGGGAAGCGGG - Intergenic
1198345220 X:135751877-135751899 GTGGGGGTGTCGGGGGAAGCGGG + Intergenic
1198733869 X:139764802-139764824 GGGGAGGGATTGGGGGAAGCTGG - Intronic
1199496431 X:148457587-148457609 GTGGTGGTATAGGTGGGAGGAGG - Intergenic
1199668296 X:150119672-150119694 GGGGGGCTAAAGGGGAAAGCTGG + Intergenic
1199841932 X:151658043-151658065 GTAGGGGGAGAGGGGGAAGAGGG - Intronic
1200838514 Y:7756168-7756190 TTCTGGCTATAGGGGGAAGCCGG + Intergenic
1202584717 Y:26410111-26410133 GTGGGGGTATAGGGGTTGGCGGG + Intergenic