ID: 1077307674

View in Genome Browser
Species Human (GRCh38)
Location 11:1875260-1875282
Sequence CAGCGCCTGGACTTGGACAT CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 170
Summary {0: 1, 1: 0, 2: 2, 3: 16, 4: 151}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1077307674_1077307686 29 Left 1077307674 11:1875260-1875282 CCGATGTCCAAGTCCAGGCGCTG 0: 1
1: 0
2: 2
3: 16
4: 151
Right 1077307686 11:1875312-1875334 CTGTGCAGCAGAGGCCCAGAAGG 0: 1
1: 0
2: 9
3: 31
4: 325
1077307674_1077307684 20 Left 1077307674 11:1875260-1875282 CCGATGTCCAAGTCCAGGCGCTG 0: 1
1: 0
2: 2
3: 16
4: 151
Right 1077307684 11:1875303-1875325 AGACCTGATCTGTGCAGCAGAGG 0: 1
1: 0
2: 5
3: 22
4: 192

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1077307674 Original CRISPR CAGCGCCTGGACTTGGACAT CGG (reversed) Intronic
900121275 1:1049633-1049655 CAGCGCCTGGAGCTTGGCATTGG + Exonic
900623087 1:3596363-3596385 CAGCGTCTGGACTTGGGGAGGGG - Intronic
903572997 1:24320074-24320096 CAGAGCCTGGATTTGAACTTAGG - Intronic
903859117 1:26354531-26354553 CAGGGCCTGCTCCTGGACATGGG - Intergenic
904059819 1:27699975-27699997 CAGTGCCTTGACTTTGACATAGG + Intergenic
904133509 1:28292938-28292960 CAGTGCCTGGACTAGTACCTGGG - Intergenic
904286942 1:29459025-29459047 CAGGGCCAGGACATGGACCTGGG - Intergenic
904410708 1:30323119-30323141 CAGAGCCTGACCCTGGACATGGG - Intergenic
904819443 1:33231948-33231970 CAGAGCCTGGACTTGGTTCTTGG + Intergenic
905786007 1:40758191-40758213 CTGGCCCTGGACTTGGACAGCGG - Exonic
906205111 1:43982408-43982430 GACCTCCTAGACTTGGACATGGG + Intronic
907274094 1:53307501-53307523 CAGCGCATGTACTTGCAGATGGG + Intronic
907299691 1:53478852-53478874 CAGTGCCTGTATTTGGAGATGGG + Intergenic
907526583 1:55057350-55057372 CACCGGCTGGTCTTGGGCATTGG - Exonic
908075001 1:60507088-60507110 CATCCCCTGAACTTGGAAATTGG + Intergenic
909775426 1:79478840-79478862 CAGCGACTACAGTTGGACATTGG - Intergenic
911903446 1:103533822-103533844 CAGAGCCTGAAGTGGGACATGGG - Exonic
912994048 1:114515970-114515992 CAGCGCCTGGTCATGGAAATAGG - Intergenic
913972190 1:143423773-143423795 CGGTGCCTAGACTTGGACATAGG + Intergenic
914066571 1:144249386-144249408 CGGTGCCTAGACTTGGACATAGG + Intergenic
914112582 1:144716968-144716990 CGGTGCCTAGACTTGGACATAGG - Intergenic
914827571 1:151146590-151146612 CCGCGGCTGGACTTGGACCCAGG - Intronic
916741503 1:167650628-167650650 CAGCTCCTGGACTTTGGCTTTGG - Intronic
919680638 1:200431298-200431320 CCGCTCCTGGCCTTGTACATGGG + Intergenic
920372695 1:205489554-205489576 CAGAGCCAGGACTGGAACATGGG - Intergenic
921845847 1:219880922-219880944 CAGAGCCAGGACTTGAACCTAGG - Intronic
922569317 1:226624537-226624559 CAGCACCTGGGCTTGGGCAGGGG - Intergenic
923082507 1:230672106-230672128 CAAGGCCTGGACTGGGACAATGG - Intronic
1063591519 10:7400089-7400111 CAGAGCCTGCACTGGGAAATGGG + Intronic
1064544812 10:16439471-16439493 CAGTGCCAGGACTTGGCCATAGG + Intronic
1067205762 10:44211446-44211468 CAGAGCATGGACTTGAACTTAGG + Intergenic
1069795511 10:71049439-71049461 CAGAGCCAGGGCTTGGACACTGG + Intergenic
1072418808 10:95272017-95272039 CAGATCCTGGTCTTGGAAATGGG - Intronic
1073562204 10:104506568-104506590 CAACCCCTGGGCTTGGGCATTGG + Intergenic
1077307674 11:1875260-1875282 CAGCGCCTGGACTTGGACATCGG - Intronic
1077340698 11:2025095-2025117 CAGCTCCTGGAGTTGGACGAGGG - Intergenic
1077542686 11:3154761-3154783 AAGCGGCTGTACTTGGAGATGGG + Intronic
1080880196 11:36312600-36312622 CAGAGCCAGGACTTGAACATTGG - Intronic
1081416606 11:42822773-42822795 CAGAGCCAGGACTTGGCCCTGGG - Intergenic
1081633368 11:44704294-44704316 CAGGGCCAAGATTTGGACATGGG + Intergenic
1081911291 11:46701407-46701429 CCGCGCCTGGGCCTGGACTTAGG + Exonic
1083679475 11:64344543-64344565 CAGGGCCTGGACCTGGCCACGGG + Exonic
1084594641 11:70109673-70109695 CAGGGCCGGGTCTTGGACCTCGG + Intronic
1085184630 11:74565121-74565143 AATCCCCTGGACATGGACATAGG - Intronic
1085753195 11:79180322-79180344 CAAAGCCTGGAATTAGACATGGG + Intronic
1085972228 11:81606987-81607009 GAGAGCTTGAACTTGGACATGGG - Intergenic
1087156814 11:94912988-94913010 CAGCGCCTGGGCCTGGAACTGGG + Intergenic
1087385890 11:97467968-97467990 CAGCCCCTGGACTTTGATATGGG + Intergenic
1088035013 11:105300718-105300740 CAGAGCCTGCACTAGGACTTGGG - Intergenic
1089064725 11:115653851-115653873 CAGTGCCAGGACTTGGAATTGGG - Intergenic
1089633570 11:119798023-119798045 CATCGCCTGGACATGCAGATTGG + Intergenic
1202823683 11_KI270721v1_random:80284-80306 CAGCTCCTGGAGTTGGACGAGGG - Intergenic
1093504098 12:19844652-19844674 CTTCTCCTGGCCTTGGACATTGG + Intergenic
1093894478 12:24561870-24561892 TAGGGTCTGGCCTTGGACATTGG + Intergenic
1101481880 12:105106191-105106213 CAGAGCCAGGATTTGGACCTAGG + Intergenic
1101599501 12:106196809-106196831 CAGAGCCTGGACTAGAACCTGGG + Intergenic
1102262867 12:111455486-111455508 GAGGGCTTGGCCTTGGACATTGG - Intronic
1102389100 12:112535250-112535272 CAGCTCCTGGCCCAGGACATAGG + Intergenic
1102462517 12:113108781-113108803 CAGAGCCAGGAGTTGGACTTAGG + Intronic
1106436889 13:29731144-29731166 AAGCATCTGGACATGGACATAGG + Intergenic
1114262046 14:21044037-21044059 CAGAACCTGGACTTGAACCTAGG + Exonic
1118016834 14:61669334-61669356 CAGGGCTTGAACTTGGACAGAGG + Intergenic
1119190000 14:72674776-72674798 CAGTGCCTGGACCTTGCCATTGG + Intronic
1119380143 14:74223274-74223296 CTGCGCCTGGTCTTGGAGAGCGG - Intergenic
1122720675 14:103720523-103720545 CACAGGCTGGACATGGACATAGG - Intronic
1125682726 15:41542619-41542641 CAGAGCCTGGATTTGAACACAGG - Intronic
1131599092 15:93828884-93828906 CAGAGCCAGGAAGTGGACATGGG + Intergenic
1136027726 16:27480730-27480752 CAGGGCCAGGATTTGAACATAGG - Intronic
1137717660 16:50608580-50608602 CAGGGCCAGGACATGGACCTAGG - Intronic
1140982109 16:80120513-80120535 CACAGCCTGGACTTGAACCTTGG - Intergenic
1144029154 17:11304224-11304246 CAGTGCCTGGAGTTGGACGAAGG + Intronic
1144477123 17:15597949-15597971 CAGAGCCGGGATTTGGACCTAGG + Intronic
1144921116 17:18765418-18765440 CAGAGCCGGGATTTGGACCTAGG - Intronic
1145781543 17:27567000-27567022 CAGGGCCTGGATTTGGACCTTGG - Intronic
1146445316 17:32928175-32928197 CCGCGCCCGGACTTTGCCATCGG + Exonic
1146972186 17:37082308-37082330 CAGAGCCTGGACTTGTACAGTGG + Intergenic
1147600219 17:41740523-41740545 CAGAGCCTGGACATGGACGCAGG - Intergenic
1150651521 17:67013267-67013289 CAGCAGATGCACTTGGACATGGG - Intronic
1151233870 17:72704330-72704352 CAGCACCTCGATTTGGACCTAGG + Intronic
1152163091 17:78681700-78681722 CAGTGCTAGGACTTGGCCATGGG - Intronic
1155262074 18:24052836-24052858 CAGGGCATGGAATTGGACCTGGG + Intronic
1156154619 18:34287302-34287324 GAGAGACTGGACTTGGACTTGGG - Intergenic
1157897093 18:51479458-51479480 CAGAGGCAGGACTTGGACACTGG - Intergenic
1159015525 18:63099127-63099149 CAGAGCCTGGACTGGCACCTGGG + Intergenic
1160575695 18:79852657-79852679 CAGCGCCTGCACCTGGGCGTGGG + Intergenic
1160723726 19:608564-608586 CAGAGCCTGGAGATGGACGTGGG + Intronic
1161210763 19:3064166-3064188 CTGCGCCTGGCCCTGGACTTGGG + Intergenic
1163275362 19:16280549-16280571 CAGTGCCTGGCCTTGAAGATGGG - Intergenic
1164610435 19:29628010-29628032 CTGTGCCTGGCCTTGGACACAGG - Intergenic
1165285039 19:34834584-34834606 CAGAGCCGGGGCTTGGACACTGG + Intergenic
925339561 2:3126711-3126733 CACAGCCTGGACTGGGAGATGGG + Intergenic
925700237 2:6629435-6629457 TAGGGCCTGGACTTGGGCAGTGG - Intergenic
927207154 2:20617990-20618012 CAGGGTCTGGACTTGGTCAGTGG - Exonic
927917552 2:26946694-26946716 CAGAGCCTGGACTTGGACCCAGG - Intronic
928032897 2:27796771-27796793 CAGCGCCTGGAGCTGGGTATGGG + Intronic
932848489 2:75158844-75158866 CAGAGCCAGGCCTGGGACATGGG - Intronic
933175969 2:79173468-79173490 TAGCACCTGAACTTGGACACTGG - Intergenic
933366945 2:81364872-81364894 CAGGGCCTGGATTTAGTCATTGG + Intergenic
933649476 2:84838754-84838776 CAGCCCCAGGCCTTGGACTTGGG + Intronic
934176887 2:89584710-89584732 CGGCGCCTAGACTTGGACATAGG + Intergenic
934287194 2:91659070-91659092 CGGCGCCTAGACTTGGACATAGG + Intergenic
934522887 2:95030968-95030990 CAGAGCCGGGACTGGGCCATGGG + Intronic
937999888 2:127724545-127724567 CAAAGCCTGGACTTGGACTCTGG + Intronic
944499230 2:200341252-200341274 CAGGGCCTGGATTTGAACCTAGG + Intronic
946911921 2:224470915-224470937 CAGAGCCAGGAGTTGGACCTAGG - Exonic
947759598 2:232594069-232594091 CAGAGCCGGGACTAGGAAATCGG - Intergenic
948372559 2:237498893-237498915 CAGCTCCTGGGATAGGACATGGG - Intronic
948729901 2:239956200-239956222 CAGCGCCTACACTTGGAGGTGGG + Intronic
1169925970 20:10784201-10784223 CAGCGGCAGGGCTTGGACACTGG - Intergenic
1173931468 20:46823700-46823722 CTGCGTTTGAACTTGGACATTGG - Intergenic
1174547238 20:51334629-51334651 CGGAGCCTGGACTTGGTCCTGGG + Intergenic
1181109323 22:20592039-20592061 CAGATCCTGGACTTGGACCTGGG - Intergenic
1183236750 22:36624466-36624488 CAGAGCCTGGACTTGAACCCAGG + Intronic
1183464233 22:37971588-37971610 CTTGGTCTGGACTTGGACATGGG + Intronic
1183489699 22:38109763-38109785 TTGGGCCTGGACTTGGACTTGGG + Intronic
1183779718 22:39991265-39991287 CAGAGCCTGCACTTGGAAACGGG + Intergenic
1183827616 22:40400821-40400843 CAGGGGCTGGACTTGGAAACGGG + Intronic
1184103097 22:42351886-42351908 CAGGGCCCGGCCTTGGACAGAGG + Intergenic
1184929610 22:47671449-47671471 CTGCACCAGGAGTTGGACATTGG + Intergenic
950206362 3:11084273-11084295 CAGCCCCTGGACTTGGCCCCTGG + Intergenic
953832373 3:46311502-46311524 CAGCACCAGGATTTGGTCATTGG - Intergenic
953919866 3:46944416-46944438 CAGGGCCTAGGCTTGGACTTGGG - Intronic
954079999 3:48207978-48208000 CAAGGCCTGCCCTTGGACATGGG - Intergenic
955736171 3:62040791-62040813 CAGAGCCTGGTCAGGGACATCGG + Intronic
956523007 3:70126271-70126293 CAGAGACTGGAGTGGGACATGGG + Intergenic
957665763 3:83224021-83224043 CACCTCCTGGACCTGGATATAGG - Intergenic
958874405 3:99599400-99599422 CAGAGCCAGGACTTGAACCTGGG - Intergenic
962205034 3:133427428-133427450 CAGAGCCAGGACTTGAACCTTGG + Intronic
967522149 3:190445096-190445118 CAGAGCTTGGACTTGGACCTGGG - Intronic
967642628 3:191884473-191884495 CAGCAACTGGACTGGGCCATAGG - Intergenic
971212205 4:24629657-24629679 CGGCGCCTGGCCTAGGACGTTGG - Intergenic
977555184 4:98481076-98481098 CTGAGCTTGGACTTGGACAGCGG - Intronic
978325109 4:107544817-107544839 CAGAGCCTGGATTTGGACCCAGG - Intergenic
978533968 4:109741583-109741605 CAGGGCCTGGACTTGAACCCAGG + Intronic
985617536 5:932655-932677 CAGCTCCTGCTCTTGGACAGAGG - Intergenic
985649041 5:1098830-1098852 CCTGGCCTGGACTTGGACATCGG + Intronic
998348523 5:141485579-141485601 CAGCAGCTGGACTTGGAAATTGG + Exonic
999565499 5:152855875-152855897 CAGAGCCGGGACTTTGGCATTGG - Intergenic
1000085460 5:157884112-157884134 CAGTGCCTGGACTTGAGAATTGG - Intergenic
1002286506 5:178166000-178166022 GAGCTCCTGGACATGGACGTGGG - Intergenic
1002329939 5:178434414-178434436 CTGGACCAGGACTTGGACATTGG + Intronic
1002430837 5:179203009-179203031 CAGAGCCTGGGCTGGGATATGGG - Intronic
1006373122 6:33657513-33657535 CAGCGTTTGGACTGGGACAAGGG + Intronic
1007090555 6:39181904-39181926 CAGCTCCTGGACTAGGCCCTCGG + Intergenic
1007595056 6:43046135-43046157 CACCCCCTGGACTTGGCCATGGG - Intronic
1011716998 6:90116920-90116942 CTGCACATGTACTTGGACATAGG - Intronic
1013361096 6:109394533-109394555 CAGTGCTTGGGCTTGGACAGTGG + Intronic
1016551993 6:145291949-145291971 CTTCTCCTGTACTTGGACATCGG - Intergenic
1020935088 7:14453233-14453255 AGGAGCCTGGATTTGGACATGGG + Intronic
1024698950 7:51886045-51886067 CAGCACCAGAACTTGGATATAGG + Intergenic
1024935982 7:54712736-54712758 CAGACCCTGGACTTGAACCTGGG + Intergenic
1031979364 7:128114800-128114822 CAGCACCAGGACTTGAACCTGGG - Intergenic
1032913685 7:136462784-136462806 CAGAGGCTGGACTTGCAAATGGG + Intergenic
1033533664 7:142291620-142291642 CTTCACCTGGACTTGGAAATAGG + Intergenic
1036732267 8:11276365-11276387 CAGGGGCTGGGCTTGGACACTGG + Intergenic
1040945848 8:52883395-52883417 GAGCATCTGGACTTGGACTTTGG - Intergenic
1042186133 8:66138012-66138034 CAGGGCCTGGACTTGAACCCAGG - Intronic
1048941044 8:139401120-139401142 CAGAGCCGGGACGTGGACACAGG - Intergenic
1049402354 8:142434099-142434121 CAGGGCCTGGGCTTGGACTCTGG - Intergenic
1049802239 8:144523216-144523238 CAGCGGCTGCACGTGGACAGAGG + Exonic
1050614470 9:7387805-7387827 CAGCCACTGGACATGGAAATAGG + Intergenic
1051346975 9:16160871-16160893 CAGGGCCTGGATTTGAACACAGG + Intergenic
1051738633 9:20229236-20229258 CAGAGCCTGGATTTGAACCTTGG - Intergenic
1061240785 9:129370870-129370892 CAGGGCCAGGACTTGGACCCAGG - Intergenic
1062066314 9:134528436-134528458 CAGCTCCTGGAATTAGAGATGGG + Intergenic
1062338343 9:136082312-136082334 CAGAGCCCGGACTTGGCCTTGGG - Intronic
1187411403 X:19053518-19053540 CAGAGCCAGGATTTGGACCTAGG - Intronic
1194650136 X:96504392-96504414 CAGCACCTGGACTTGAATCTAGG - Intergenic
1195941588 X:110172134-110172156 CAGAGCCAGGACTTGAACTTGGG - Intronic
1197330541 X:125148840-125148862 GAGTGCCTGGATTAGGACATGGG - Intergenic