ID: 1077309689

View in Genome Browser
Species Human (GRCh38)
Location 11:1882838-1882860
Sequence TTGAGCAGGACTGAACCTGG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 236
Summary {0: 1, 1: 0, 2: 4, 3: 28, 4: 203}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1077309689_1077309694 10 Left 1077309689 11:1882838-1882860 CCTCCAGGTTCAGTCCTGCTCAA 0: 1
1: 0
2: 4
3: 28
4: 203
Right 1077309694 11:1882871-1882893 GCTCAAAGCTGCCAGCTGGCTGG 0: 1
1: 0
2: 2
3: 18
4: 201
1077309689_1077309692 6 Left 1077309689 11:1882838-1882860 CCTCCAGGTTCAGTCCTGCTCAA 0: 1
1: 0
2: 4
3: 28
4: 203
Right 1077309692 11:1882867-1882889 AGCCGCTCAAAGCTGCCAGCTGG 0: 1
1: 0
2: 1
3: 13
4: 153

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1077309689 Original CRISPR TTGAGCAGGACTGAACCTGG AGG (reversed) Intronic
900366582 1:2314244-2314266 CTGTGCAGGAGTGACCCTGGAGG - Intergenic
901355274 1:8641644-8641666 TTGTTCAGCACAGAACCTGGAGG - Intronic
901731735 1:11284999-11285021 ATGAGCAGGACAGAAACAGGAGG + Intronic
901855481 1:12041822-12041844 TTGAGCAGGTCTTACCCTGCAGG - Intergenic
902616727 1:17627669-17627691 ATGAACAGGAATGAACGTGGGGG - Intronic
902625322 1:17673103-17673125 TGGAGCAGGAGGGAACCTGGAGG + Intronic
904081685 1:27876416-27876438 CTGAGGACGACTGAACCTGTGGG + Intronic
905203204 1:36327780-36327802 TTGAGAAGCACTGCTCCTGGAGG + Exonic
905692976 1:39956157-39956179 GGGATCAGGCCTGAACCTGGAGG + Intronic
906863245 1:49385003-49385025 TTCAGCCTGAATGAACCTGGAGG + Intronic
907312937 1:53550062-53550084 ATGAGCTGGGCTGAACCTGGTGG - Intronic
908228169 1:62077198-62077220 TTGACCAGGACTTAGCCTGTTGG + Intronic
909712844 1:78672549-78672571 TTGTGCAAGCCTGAACCTGGAGG + Intergenic
910189144 1:84576891-84576913 TAGTGCATCACTGAACCTGGAGG - Intergenic
910693769 1:89991170-89991192 TTGAGAAGTACTGACCCAGGGGG + Intergenic
910859778 1:91732142-91732164 GAGAGCAGGAATGAACCTGGGGG + Intronic
912003431 1:104862761-104862783 GAGAATAGGACTGAACCTGGGGG + Intergenic
912251620 1:108017904-108017926 TTGAGCAGGATGGAAACTAGGGG + Intergenic
912349027 1:108993682-108993704 TGAAGCAGGAGTGATCCTGGAGG + Intronic
912511907 1:110195439-110195461 TCGTGCAGGACTGAGCCTGCTGG + Intronic
912777897 1:112517546-112517568 TTGGGCAGCACTGGGCCTGGTGG - Intronic
916963744 1:169914109-169914131 TTGGCCTGGACTGAACATGGTGG - Intergenic
917703827 1:177611595-177611617 ATGAACAGGACTGAGCCTGTAGG + Intergenic
919146119 1:193637624-193637646 TTCAACATGAATGAACCTGGAGG - Intergenic
921517338 1:216111858-216111880 TTGAGTAGGAATGAAGCTGAAGG - Intronic
922742694 1:228023067-228023089 TGAAGCAGGACTGAGCCTGTGGG + Intronic
922862647 1:228832466-228832488 TTCACCAGGCCTGAAGCTGGGGG + Intergenic
924163238 1:241255502-241255524 ATGAGCAGGCCTGAACTTGAGGG + Intronic
1065186826 10:23176401-23176423 TTGTGAAGGACTGAACTGGGTGG - Intergenic
1068117773 10:52752850-52752872 TGCAGCAGGACTGCACCAGGAGG - Intergenic
1068532857 10:58209113-58209135 TTGTGCAGGCCTGAATCTGGGGG + Intronic
1070668181 10:78359984-78360006 GTGAGCAGGAGGGAGCCTGGGGG + Intergenic
1071880915 10:89897569-89897591 TTGTGCAAACCTGAACCTGGAGG + Intergenic
1073120580 10:101120215-101120237 TTGAGCAGGGCTGAACCAGAAGG + Intronic
1074006717 10:109433233-109433255 TAGAGCAGAACTGAATCTGCAGG - Intergenic
1075746889 10:124734339-124734361 TTGAACTGCACTGAGCCTGGGGG + Intronic
1075853404 10:125607297-125607319 TTGTCCAGGATTCAACCTGGGGG - Intronic
1075958525 10:126546368-126546390 GTGATCTGCACTGAACCTGGGGG - Intronic
1077309689 11:1882838-1882860 TTGAGCAGGACTGAACCTGGAGG - Intronic
1081622170 11:44625036-44625058 ATGAGCAGGACTGCAGCTGGGGG + Intergenic
1081862375 11:46340600-46340622 ATGAGCAGGAGGAAACCTGGAGG - Intronic
1081922698 11:46793834-46793856 TTGAGGAGGCTTGAACCTAGGGG + Intronic
1082857801 11:57824631-57824653 TAGGGCTGGACTGAAGCTGGAGG + Intergenic
1084871093 11:72098973-72098995 TGGAGCAGGGCTGGACATGGAGG + Intronic
1085284379 11:75350550-75350572 TGGAGCAGGACAGCCCCTGGGGG - Intronic
1085532383 11:77199598-77199620 CTGGGCAGGACTGACCCCGGCGG + Exonic
1086515264 11:87604377-87604399 TTCAGCAGGCCTGACTCTGGAGG - Intergenic
1086813315 11:91336924-91336946 TTGTGCAAGCCTGAACCTGGAGG - Intergenic
1087640771 11:100752150-100752172 TCGTGCAAGCCTGAACCTGGAGG + Intronic
1088707535 11:112477373-112477395 CTGAGCAGGACTCAGGCTGGTGG - Intergenic
1089350309 11:117818266-117818288 TTTATCAGGTCTGAACCTGAGGG - Intronic
1091590932 12:1842657-1842679 TTCACCAGGACTGAGCCTGCTGG - Intronic
1092492027 12:8954131-8954153 TTCAGCATGAATGGACCTGGAGG + Intronic
1093111199 12:15154295-15154317 TTGTCCAGAACTGAACCGGGTGG - Intronic
1095554446 12:43483535-43483557 TTGTGCAAGCCTGGACCTGGAGG - Intronic
1096263184 12:50105397-50105419 TCTAGAAGGACTGAACTTGGAGG - Intronic
1096897594 12:54839708-54839730 TTGTGGAAGCCTGAACCTGGAGG + Intronic
1097725135 12:63066700-63066722 TCAAGCAGGAATGAACATGGTGG + Intergenic
1102319403 12:111918652-111918674 TTTGGCAGGGCTGAACATGGTGG + Intergenic
1102442590 12:112975017-112975039 TTGTGCAGGAGTCAACCTTGAGG + Intergenic
1103518947 12:121525009-121525031 TTTAGCAGGAATAAACCTAGAGG + Intronic
1105835225 13:24204742-24204764 TACAGCAGGGATGAACCTGGAGG - Intronic
1106241080 13:27914157-27914179 TTAAGCAGGACTGTACCTGGGGG + Intergenic
1108273123 13:48782760-48782782 TTATGCAAGCCTGAACCTGGAGG + Intergenic
1109001637 13:56812264-56812286 TTGAGCAAGTCTGAACCTAGAGG - Intergenic
1112068850 13:95825541-95825563 TTGTGCAAGCCTGAACCTGGAGG + Intronic
1113530437 13:111020588-111020610 TGGAGAAGGACAGACCCTGGAGG + Intergenic
1115386688 14:32806084-32806106 TTGAAAGGAACTGAACCTGGGGG + Intronic
1116489762 14:45492238-45492260 GTGGGAAGGACTGCACCTGGTGG - Intergenic
1118323192 14:64765207-64765229 GTGAGCCCGCCTGAACCTGGGGG - Intronic
1118640589 14:67788669-67788691 TAGAGAATCACTGAACCTGGGGG + Intronic
1122419519 14:101566664-101566686 CTGAGCAGGTCTGCACCTGTAGG + Intergenic
1124650470 15:31470025-31470047 TTGAGCACCACTGAATCTGTTGG - Intergenic
1125374159 15:39011264-39011286 CTTACCAGGACTGAAACTGGTGG - Intergenic
1125433962 15:39626301-39626323 TTGAGCTGGCCTGAAGATGGAGG + Intronic
1125810677 15:42538499-42538521 TTGAGGAGGCCTGAGGCTGGAGG - Exonic
1127879972 15:63148507-63148529 CTGAGCAGGGCTGAAGCTGAGGG + Exonic
1129261064 15:74367545-74367567 TTGACCAGGACTGAGCGTGGGGG + Exonic
1129366365 15:75057916-75057938 CTGAGCAGGACTGAACTGTGTGG + Intronic
1130256547 15:82328513-82328535 CTGGGCAGGACTGGGCCTGGTGG - Intergenic
1130512488 15:84601043-84601065 TTGAGCCGGGGTGAATCTGGAGG + Exonic
1130598405 15:85261475-85261497 CTGGGCAGGACTGGGCCTGGTGG + Intergenic
1130605033 15:85307899-85307921 TTGTGCAAGCCTGCACCTGGAGG - Intergenic
1133225184 16:4337483-4337505 TTGAGCAGCACCGAGCCCGGCGG - Exonic
1134040751 16:11066423-11066445 ATCAGCAGGGCTGATCCTGGAGG + Intronic
1135135322 16:19882907-19882929 TGGAGGAAGACTGAACCAGGAGG - Intronic
1135636431 16:24079356-24079378 ATCAGCTGGACTGAACCTTGGGG + Intronic
1135993633 16:27232334-27232356 TTCAGCAGGACTAGACGTGGGGG + Intronic
1136636274 16:31525566-31525588 GTGAGAAAGACTGGACCTGGTGG + Intergenic
1136638148 16:31538945-31538967 GTGAGAAAGACTGGACCTGGTGG - Intergenic
1136666588 16:31818219-31818241 GTGAGAAAGACTGGACCTGGTGG + Intergenic
1137590015 16:49687726-49687748 CGCAGCAGGACGGAACCTGGTGG - Intronic
1138355210 16:56372352-56372374 TGCAGCATGAATGAACCTGGAGG - Intronic
1139041541 16:63004780-63004802 TTGTGCAAGCCTGAACCTGGAGG + Intergenic
1140933823 16:79652589-79652611 GAGTGCAGGACTGAAGCTGGTGG + Intergenic
1141426755 16:83949305-83949327 TTGAGAAGGCCTGAGGCTGGGGG - Exonic
1142219615 16:88847498-88847520 TTGAGGAGGGCTGTGCCTGGAGG + Intronic
1142328779 16:89436576-89436598 AAGAGCAGGACTGAAGCAGGCGG + Intronic
1143023168 17:3927068-3927090 AAGAACAGGATTGAACCTGGTGG - Intronic
1143315928 17:6033470-6033492 CAGAGCAGAACTGAACCTGCAGG + Intronic
1143434819 17:6915533-6915555 TTGTGCAAGCCTGATCCTGGAGG - Intronic
1146498436 17:33343739-33343761 TTAGGCAGGGCTGAGCCTGGGGG - Intronic
1147327411 17:39676114-39676136 CACAACAGGACTGAACCTGGTGG + Intronic
1147807814 17:43144596-43144618 AAAAGCAGGACTGAAGCTGGCGG - Intergenic
1148274479 17:46291369-46291391 GTGAGCAGGACTAAAACTGCAGG + Intronic
1150408576 17:64923186-64923208 GTGAGCAGGACTAAAACTGCAGG - Intergenic
1150760211 17:67954589-67954611 GTGAGCAGGACTAAAACTGCAGG - Intronic
1151277341 17:73045414-73045436 TGGAGCAGGACTGGGCATGGAGG - Intronic
1153259492 18:3209536-3209558 TTGGGCAGGACTGATCATGGAGG - Intronic
1153605721 18:6829292-6829314 TGGAGCTGGACTGAAATTGGAGG - Intronic
1157327433 18:46679285-46679307 TAACGCAGGATTGAACCTGGGGG + Exonic
1157763025 18:50278169-50278191 TTGAGCAGGACTGAGCGGGATGG + Intronic
1168434655 19:56307308-56307330 TTAAGCAGGACTGCAGCAGGGGG - Intronic
1168531142 19:57130326-57130348 TTGAGCAGTAGTGCACCTGTTGG + Exonic
925044965 2:766175-766197 ATGAGCAGGTCTGAAGCAGGAGG + Intergenic
925325618 2:3019781-3019803 TTCAGCAGCACTGAATGTGGAGG + Intergenic
927298656 2:21484772-21484794 TGCAGCAGGAATGAGCCTGGAGG + Intergenic
929127493 2:38535061-38535083 TTGAGCAGGACTGAATCTCTAGG - Intergenic
932255513 2:70282704-70282726 TTGAATAGGACAGAACCTAGAGG + Intronic
933349714 2:81137650-81137672 TTGTGTAAGCCTGAACCTGGAGG - Intergenic
934101824 2:88660526-88660548 TGGAGGAGAACTGGACCTGGAGG + Intergenic
936236040 2:110743624-110743646 TTGACCAGGACTGAGGCTGGCGG + Intronic
936980200 2:118256725-118256747 TGGTGCAAGACTGACCCTGGGGG + Intergenic
937765538 2:125656453-125656475 TTGAGCAGAACTTAACCTAATGG + Intergenic
942888043 2:180952593-180952615 GTAAGCAGGACTGAATCTGAAGG - Intergenic
944692484 2:202170432-202170454 TTAAGACGGCCTGAACCTGGAGG - Intronic
1170663409 20:18364143-18364165 TCTAGCAGGCCTGAACCTGGAGG + Intergenic
1171216415 20:23355872-23355894 TGAAGTAGGACTGAACTTGGGGG + Intergenic
1173150725 20:40564724-40564746 TTGAGCTGGAAGGAACCTAGGGG - Intergenic
1173528517 20:43750864-43750886 GTGAGAAGGAGTGAACCAGGTGG + Intergenic
1174643530 20:52066064-52066086 AAGAGCTGGACTTAACCTGGTGG - Intronic
1174712963 20:52726755-52726777 CTGAGCAGGACTGAAAATAGAGG + Intergenic
1174847100 20:53953262-53953284 TGGAGAAGGATTGAACCTGCTGG + Intronic
1175252151 20:57616279-57616301 TTGGGCGGGACTGATCCTGAAGG - Exonic
1175281601 20:57807498-57807520 TTGAGCAGGACAGAGGCTTGGGG + Intergenic
1175548126 20:59793224-59793246 TTGAGCAAGAACGAAGCTGGAGG - Intronic
1178803526 21:35818983-35819005 CTGAGCAGGACTGAACCTGCAGG + Intronic
1184309103 22:43629692-43629714 TTGAGAAGGACAGAAGCTTGGGG + Intronic
1184351378 22:43946198-43946220 CTGAGCAGGACTGGCCCTGCTGG + Exonic
949811069 3:8006719-8006741 TAGAGCAGGTATGAACCTTGAGG + Intergenic
949961316 3:9314713-9314735 GAGAGCAGGACTGGACTTGGAGG - Intronic
950166389 3:10803592-10803614 TTGACTAGGGCTGAACTTGGGGG - Intergenic
951639348 3:24817852-24817874 TTGAACAGTGCTGAACCTGTGGG - Intergenic
951901911 3:27665318-27665340 TAGATGAGGACTCAACCTGGCGG + Intergenic
952925730 3:38318023-38318045 TGGAGCAGGCCTGATTCTGGAGG + Intronic
953022333 3:39122776-39122798 TAGGGAAGGACTCAACCTGGTGG - Intronic
954381557 3:50221623-50221645 TTGGGCAGGCCTGAACCAGCTGG + Intergenic
954622923 3:52005960-52005982 GGGAGCAGGCCTGAGCCTGGAGG - Intergenic
958729612 3:97947780-97947802 TTGTAGAGGACAGAACCTGGAGG - Intronic
959568243 3:107854679-107854701 ATCAGCAGGATTGAACCTGAAGG + Intergenic
960578099 3:119246679-119246701 TTGTGCAGGCTTGAATCTGGGGG - Intergenic
962933456 3:140058710-140058732 TTGTGCTGGACTGACTCTGGGGG + Intronic
964782690 3:160358298-160358320 TTGAGGGGGGCTGAACATGGTGG - Intronic
965398922 3:168194765-168194787 ATGAGCAGGACTGAAACTGGTGG - Intergenic
967580131 3:191143256-191143278 ATGAGAAGGGGTGAACCTGGAGG + Intergenic
969081858 4:4625262-4625284 TAGAGCAGGACTGAAGCTCTAGG + Intergenic
970252601 4:14131746-14131768 TTGAGCCAGAAGGAACCTGGGGG - Intergenic
971264838 4:25088388-25088410 TTGAGCAGGCCTGTATCAGGGGG - Intergenic
972209982 4:36824539-36824561 TTGTGCAAGCTTGAACCTGGAGG - Intergenic
972325949 4:38015510-38015532 TAGAAAAGGACTGAACATGGGGG + Intronic
976474435 4:85467665-85467687 TGCAGCAGGATTGAACCTGAAGG + Intergenic
981923740 4:150116140-150116162 TCGTGCAAGCCTGAACCTGGAGG + Intronic
982845346 4:160246072-160246094 TTATGCAAGCCTGAACCTGGAGG + Intergenic
983219330 4:165029971-165029993 TTCAGCAGGACCTAAGCTGGGGG - Intergenic
984473006 4:180200957-180200979 GGGAGCAGGACTGAGCATGGTGG - Intergenic
985084415 4:186298283-186298305 TTCAGCTGCACAGAACCTGGGGG - Intergenic
985537303 5:472578-472600 GCGGGCAGGACGGAACCTGGGGG + Intronic
985553498 5:544805-544827 CTGAGCAGCACAGGACCTGGAGG - Intergenic
986971812 5:13345782-13345804 TCAAGCAGGACTGAAACTGAAGG + Intergenic
987299099 5:16581039-16581061 TTGAGAAGGCCTGAACATGAGGG - Intronic
990923745 5:60995873-60995895 TTGGGAAGGACTGAATCTTGTGG - Intronic
991953005 5:71965133-71965155 TTGAAGAGGACTGACCATGGAGG + Intergenic
991998373 5:72411185-72411207 TTGAACAGGGCTAAACCTTGAGG - Intergenic
992073918 5:73173764-73173786 TTGAGGAGGACTTGACATGGCGG - Exonic
995073494 5:107952933-107952955 TGGAGGAGGACTGAGCCTTGAGG - Intronic
997201020 5:132010288-132010310 TGGATCAGGCCTGAACCTGGAGG - Intronic
997832715 5:137164853-137164875 GTGAGAAGGACTGTACCTTGTGG + Intronic
1002644192 5:180645229-180645251 TTGAGAAGGGCTGGACCTGCGGG + Intronic
1003704366 6:8507843-8507865 TGGAGCAGTACTGAACCAGGTGG - Intergenic
1005896745 6:30185452-30185474 TTGTGCAAGAAGGAACCTGGGGG + Exonic
1006224289 6:32522852-32522874 TTAAGCAGGTGTGAACCAGGGGG + Intronic
1008755251 6:54787519-54787541 TACAACAGGAATGAACCTGGAGG + Intergenic
1009614862 6:65991034-65991056 TTCTGCAAGCCTGAACCTGGAGG - Intergenic
1011394624 6:86892755-86892777 TCGTGCAAGCCTGAACCTGGAGG - Intergenic
1015512257 6:134049450-134049472 TGGTGCAGAACTGACCCTGGTGG - Intronic
1016031721 6:139344729-139344751 TTATGCAAGCCTGAACCTGGAGG - Intergenic
1016677047 6:146782937-146782959 TTAAGCAGGACTGGAACTAGGGG + Intronic
1018074412 6:160198796-160198818 AGGAGCAGGACTGCAGCTGGTGG + Intronic
1018884116 6:167918108-167918130 TTGAACAGAAGTGAACCTGGTGG + Intronic
1020997492 7:15281408-15281430 TTGTGCAAGCCTGAACCTGGAGG - Intronic
1022348309 7:29539509-29539531 GTGAGCAGGACTGCATCTTGTGG + Intergenic
1023665744 7:42521497-42521519 TTGAGCATGAAGGAAGCTGGAGG - Intergenic
1024808157 7:53173617-53173639 TTGAGAAGGAATAAAGCTGGGGG - Intergenic
1024851310 7:53720441-53720463 TACAGCAGGACAGAACCTTGAGG - Intergenic
1025004178 7:55342579-55342601 TTGAGCAGGGCTGGCCATGGCGG - Intergenic
1029998143 7:105029846-105029868 ATGGGGAGGACTGAGCCTGGGGG + Intronic
1030616498 7:111743347-111743369 TCAAACAGGACTGACCCTGGCGG + Intronic
1030812802 7:113996105-113996127 TTGAGAAAGAATGAAGCTGGAGG + Intronic
1032710243 7:134454919-134454941 TGGACCAGGACTGACCCTGTAGG + Intronic
1033306256 7:140227944-140227966 GTTAGCAGGACAGAACCAGGAGG - Intergenic
1033669060 7:143472388-143472410 CTTATCAGGACTGAAACTGGTGG - Intergenic
1035212725 7:157340279-157340301 TTGTGCAGGACCCCACCTGGTGG + Intronic
1040815597 8:51505035-51505057 TTGAGCACTAATGAACCTAGAGG + Intronic
1042084261 8:65090004-65090026 TTGTGCAGGCCTGAATCTGGTGG - Intergenic
1044880149 8:96715435-96715457 TTGTGCAAGCCTGAACCTGGAGG + Intronic
1045350036 8:101330042-101330064 TTCAAAAGGACTGAAACTGGTGG - Intergenic
1047969884 8:130075428-130075450 TTGAGCAGAAGTCAAACTGGGGG - Intronic
1048219054 8:132524808-132524830 CTGAGCAGGAATAAAGCTGGAGG - Intergenic
1048354176 8:133640136-133640158 CTGAGAAGGACTCAACATGGAGG + Intergenic
1049294270 8:141822457-141822479 TTTATCAGGACAAAACCTGGAGG - Intergenic
1050465664 9:5920461-5920483 TGGAGCAGAACTGTAACTGGGGG + Exonic
1050735100 9:8752815-8752837 TTGAGCTGGGCTCAACTTGGTGG - Intronic
1056797795 9:89670485-89670507 TTGAACAGCCCTAAACCTGGAGG - Intergenic
1058343044 9:103921242-103921264 TTGTGCAGGCCTGAATCTGGGGG - Intergenic
1058360696 9:104143058-104143080 TTGAGAAGCACTGAGCTTGGAGG + Intergenic
1058974828 9:110116002-110116024 TTGAGCAGGGAAGAACATGGTGG + Intronic
1060206997 9:121688021-121688043 TTGAGCAGGCCTGGCCCTAGGGG + Intronic
1060266857 9:122116667-122116689 TTGCCCAGGACTCACCCTGGAGG + Intergenic
1061662636 9:132140390-132140412 TTGAGTAGGAGTCAACCAGGGGG - Intergenic
1062117313 9:134816458-134816480 CTGGGCAGGACTGGGCCTGGAGG + Intronic
1185839666 X:3376855-3376877 TTGAGAAAGACTAGACCTGGTGG - Intergenic
1186273182 X:7912042-7912064 TTATGCAGGACTGAAGCTAGTGG - Exonic
1188870551 X:35365686-35365708 TTGTGGAAGCCTGAACCTGGAGG - Intergenic
1188886949 X:35562400-35562422 TTGTGCAAGCCTGAACCTGGAGG + Intergenic
1189574025 X:42330544-42330566 TTAGGCAGGGGTGAACCTGGGGG + Intergenic
1191972607 X:66833355-66833377 ATGGGAAGGACTGAACCTTGTGG + Intergenic
1193876529 X:86868920-86868942 GTGGGCAGGACTGTATCTGGTGG - Intergenic
1193877799 X:86883759-86883781 ATGAGAAGGACTGCACCTTGTGG - Intergenic
1194337611 X:92666669-92666691 TTGTGCAAGCCTGAACCTGGAGG - Intergenic
1194623271 X:96198629-96198651 TTGTGCAAGCCTGAACCTGGAGG - Intergenic
1195739786 X:108051834-108051856 TACAGCATGAATGAACCTGGGGG + Intronic
1196377385 X:115048447-115048469 TTAGTCAGGACTGAACCTGATGG - Intergenic
1197394273 X:125907231-125907253 TTGTGCAAGCCTGAACCTGGAGG + Intergenic
1197449487 X:126594260-126594282 TTGAGAAGGACTGCATCTTGTGG - Intergenic
1199065871 X:143417702-143417724 TTGTGCAAGACTGAACCTGGAGG + Intergenic
1200646026 Y:5783411-5783433 TTGTGCAAGCCTGAACCTGGAGG - Intergenic