ID: 1077310154

View in Genome Browser
Species Human (GRCh38)
Location 11:1884886-1884908
Sequence CTGAATAATTGGAGGAGTAT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 218
Summary {0: 1, 1: 0, 2: 0, 3: 12, 4: 205}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1077310154_1077310159 8 Left 1077310154 11:1884886-1884908 CCAATACTCCTCCAATTATTCAG 0: 1
1: 0
2: 0
3: 12
4: 205
Right 1077310159 11:1884917-1884939 CATTCAATCAATGCCCCCCTCGG 0: 1
1: 0
2: 0
3: 8
4: 165

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1077310154 Original CRISPR CTGAATAATTGGAGGAGTAT TGG (reversed) Intronic
901285155 1:8072436-8072458 CTGAATGAATGGAGTAATATTGG - Intergenic
903081147 1:20814404-20814426 CTGTATAATTGAATGAGTAAAGG - Intronic
907061160 1:51426969-51426991 CTATATAATTGGAAGAGTAAAGG - Intronic
907613329 1:55895462-55895484 CTGAGTGATTGGAAGAGCATGGG + Intergenic
908734174 1:67258403-67258425 CTGGATAATTGAATGAGGATAGG - Intronic
908883955 1:68766258-68766280 CTGAATATTTAGAGGGCTATAGG + Intergenic
910590483 1:88924394-88924416 ATAAATAATGGGAGGAGGATGGG - Intergenic
913157555 1:116114901-116114923 TTTAATAAGTGGAGAAGTATAGG + Intronic
917484447 1:175442918-175442940 CTGAACACTTGGAAAAGTATGGG - Intronic
918523418 1:185439561-185439583 GGGAATGAATGGAGGAGTATGGG + Intergenic
919324645 1:196091175-196091197 CTGTAAACTTGAAGGAGTATTGG + Intergenic
920745247 1:208621162-208621184 CAGAATAGTTTGAGTAGTATTGG - Intergenic
922002693 1:221495859-221495881 CTAAATAATTGGAATATTATGGG - Intergenic
923689008 1:236175287-236175309 CTGAGTAAGTGGAGGAGGAGAGG + Intronic
1062853320 10:763129-763151 TGGAATCATTTGAGGAGTATTGG - Intergenic
1065102798 10:22347304-22347326 CTGGGTACTTGGAGGAGTACGGG - Intronic
1065357607 10:24857542-24857564 CTGCACAATTAGAGGAGAATGGG + Intronic
1065467426 10:26039440-26039462 CAGAATAGTTTGAGGAGGATTGG + Intronic
1070964313 10:80520334-80520356 CTGAATAGTTGGATGAGGAATGG + Exonic
1071782188 10:88858661-88858683 CTGAGTCACTGGAGGAGTAATGG - Intergenic
1077031229 11:468868-468890 CTGAATAATTGGAGAAGGAGGGG + Intronic
1077310154 11:1884886-1884908 CTGAATAATTGGAGGAGTATTGG - Intronic
1077310393 11:1886354-1886376 TTGATTAGATGGAGGAGTATTGG - Intronic
1077859576 11:6164174-6164196 CAGAATAATTTGAGTAGGATTGG - Intergenic
1082668322 11:56003441-56003463 TTGAATAATTTCAGGAGGATTGG - Intergenic
1085651286 11:78271016-78271038 CTGAATAAATGGAGGAGGGATGG + Intronic
1086798308 11:91136902-91136924 CTGAATATTTGGAGGATCACTGG + Intergenic
1087392168 11:97550157-97550179 CTGACTATTTAGAAGAGTATAGG - Intergenic
1090402839 11:126460083-126460105 ATGAATAAATGGAGGAGGAGCGG + Intronic
1091901271 12:4145892-4145914 CTGAAGAAATGGGGGAGTCTTGG + Intergenic
1092651068 12:10635649-10635671 CTGGATAAATGGAGAAGAATGGG - Intronic
1094440863 12:30474945-30474967 CACAATACTTTGAGGAGTATTGG - Intergenic
1095622408 12:44273404-44273426 CAGAATAATTTGAGTACTATTGG - Intronic
1098387043 12:69930494-69930516 CTGACTATTTGGAGGAGGAGAGG + Intronic
1098456252 12:70677955-70677977 TTGAATAGTTTGAGGAGAATTGG + Intronic
1099411486 12:82334439-82334461 CTTAAATATTTGAGGAGTATTGG - Intronic
1099745963 12:86705475-86705497 CTGAAAAACTGGTGGAGTTTAGG + Intronic
1099871922 12:88360265-88360287 CAGAATAAATGGAGGAGGACAGG - Intergenic
1100028593 12:90159497-90159519 AAGAATAATGGGAGGAGTGTAGG + Intergenic
1100165073 12:91907671-91907693 ATGAATATTTGGGGGTGTATTGG - Intergenic
1101250988 12:102935447-102935469 CAGAATAGTTTGAGTAGTATTGG + Intronic
1105739361 13:23306243-23306265 TGGAATAATTTGTGGAGTATTGG + Intronic
1107533254 13:41304662-41304684 CTACATAAATGGAGGAGCATGGG - Intergenic
1108160522 13:47633402-47633424 GTGATTATTTGGAGGAGAATAGG - Intergenic
1108207820 13:48108432-48108454 TTGAATATTTTGAAGAGTATGGG - Intergenic
1108961872 13:56243693-56243715 CTGAATAGTTTGAGTAGTACTGG + Intergenic
1110122271 13:71896977-71896999 CAGAATAGTTTGAGGAGAATTGG - Intergenic
1110539744 13:76694859-76694881 CTGAATATATGGTGGAGAATGGG - Intergenic
1110870842 13:80451020-80451042 CTGGAAAATTGGAGGAGTCCTGG - Intergenic
1111055292 13:82940822-82940844 CTGAACAGTTTGAGGAGTACTGG - Intergenic
1113059125 13:106301974-106301996 CTGAATAATTGAATGAGCATTGG - Intergenic
1113222504 13:108120944-108120966 CAGAATATTTTGAGGATTATTGG + Intergenic
1116217288 14:42033877-42033899 CTGAATAATTCGAAGAGAAAGGG - Intergenic
1117963291 14:61183128-61183150 CTGAAAACTTGGTGGAGGATAGG - Intergenic
1121171050 14:91854780-91854802 CTGAATATTCTGAGGAGTAGGGG + Intronic
1124508238 15:30297647-30297669 CTGATAAATTTGAGGAGTAATGG + Intergenic
1124735317 15:32241009-32241031 CTGATAAATTTGAGGAGTAACGG - Intergenic
1125315482 15:38426807-38426829 CAGAATATTTAGAGGAGAATTGG + Intergenic
1126709033 15:51436699-51436721 CAGAATAGTTTGAGGAGGATTGG + Intergenic
1127001141 15:54507500-54507522 CTTAAAAATTAGATGAGTATTGG + Intronic
1127735188 15:61832802-61832824 CTGAATAATAGGAAGAGCCTGGG + Intergenic
1129501491 15:76042745-76042767 CAGAATAGTTTGAGTAGTATTGG - Intronic
1130610592 15:85357436-85357458 CTGAATAATTGTATGATCATAGG - Intergenic
1136009580 16:27354679-27354701 CTGTATAATGGGAGGAGTAAGGG + Intronic
1138836498 16:60442418-60442440 GTGATTAATTGGATGAGTGTGGG + Intergenic
1138845798 16:60564207-60564229 ATGAATAATTAGAGGAGGCTAGG + Intergenic
1139805732 16:69564252-69564274 CTGACTAATGGGTGGCGTATGGG + Intergenic
1140182585 16:72735611-72735633 GTGATTATTTGGAGGAGAATAGG + Intergenic
1143147132 17:4783878-4783900 CTGGATATTTGGGGGATTATAGG + Intergenic
1145966183 17:28919401-28919423 CTGAATCACTGGAGGAAGATAGG - Intronic
1148517653 17:48236165-48236187 TTGAATAAGTGAAGGAATATCGG - Intronic
1148727653 17:49806481-49806503 CAGAATAATGGGAGGACAATGGG - Intronic
1149951207 17:60988442-60988464 CTCAATAGTTGGAGTAGGATTGG + Intronic
1150075949 17:62192210-62192232 ATGAATATTTGGAGGAGACTGGG - Intergenic
1155430633 18:25752455-25752477 TGGAATAATTTGAGAAGTATTGG - Intergenic
1156084710 18:33383797-33383819 GTGATTATTTGGAGGAGAATAGG - Intronic
1156435927 18:37129550-37129572 CTGAGAAATTGAAGGAGTATAGG + Intronic
1156448280 18:37252837-37252859 CTGAATAAATGGAGGAACATGGG + Intronic
1156744766 18:40376148-40376170 CTGAATAATTGATGGCTTATGGG - Intergenic
1158009710 18:52715009-52715031 CTGGATAATGGAAGGATTATTGG + Intronic
1159312534 18:66727906-66727928 CAGAAAAATTGGAGGATTCTTGG - Intergenic
1160519938 18:79500935-79500957 CTGAAGAGTTTGTGGAGTATTGG - Intronic
1162614645 19:11788248-11788270 CAGAATAATTTGAGTAGGATTGG - Intergenic
1162944320 19:14032870-14032892 TTGAAGGAGTGGAGGAGTATTGG - Intronic
1164858955 19:31547329-31547351 CTGAGTCATTTGAGGAGTGTGGG + Intergenic
925239187 2:2307661-2307683 CTGAAGCATAGGTGGAGTATAGG - Intronic
925239210 2:2307956-2307978 CTGAAGCATAGGTGGAGTATAGG - Intronic
926848561 2:17169402-17169424 TTGAACATTTGGAGGATTATTGG + Intergenic
928384579 2:30855229-30855251 CAGAATAATTTGAGTAGAATTGG - Intergenic
928672083 2:33612133-33612155 CTAAATAATAGGAAGGGTATTGG + Intergenic
931322602 2:61185768-61185790 CTGAATAATTGGAGGGGAGATGG + Intronic
931980624 2:67690102-67690124 CTGAATTATTAGAGGAGCTTAGG - Intergenic
932667058 2:73706547-73706569 CTGAATAAAGGGATGAGTCTTGG + Intergenic
932669060 2:73720888-73720910 CTGAATAAAGGGATGAGTCTTGG + Intergenic
933032471 2:77347400-77347422 CAGAATATTTGGAGTACTATTGG + Intronic
933118760 2:78508485-78508507 CTGTATAATGGGAGAAATATAGG - Intergenic
933242735 2:79941359-79941381 CTGCATAACTGGAGCAGTACAGG - Intronic
935229451 2:101083168-101083190 GTGAATAAGTGGGGAAGTATGGG - Intronic
937531496 2:122834006-122834028 TAGAATATTTGGAGTAGTATGGG - Intergenic
941780198 2:169435721-169435743 CAGAATAATTTGAGTAGAATTGG - Intergenic
942414423 2:175743976-175743998 ATGAAAAATTGGAGAAGTATTGG + Intergenic
943714522 2:191135809-191135831 TGGAATAATTTGAGGAGAATTGG - Intronic
945970858 2:216229929-216229951 TGGAATAATTTGAGGAGAATTGG + Intergenic
946466502 2:219916725-219916747 CTGAATTACTGGAGGAATTTAGG + Intergenic
947230213 2:227877028-227877050 CTGAAAAATTTGAGGAATAGAGG + Intronic
1170126345 20:12968374-12968396 CTGCATAAATGCAGGAATATTGG - Intergenic
1170153745 20:13251099-13251121 CTGAATAATTAAAGTATTATAGG - Intronic
1177359701 21:20051846-20051868 TTCAATAATTTGAGGTGTATGGG + Intergenic
1178017750 21:28370122-28370144 CTAAATAGTTTGAGTAGTATTGG + Intergenic
1178749696 21:35289512-35289534 CTAAATAATTGGAGCTGTCTTGG + Intronic
1179089626 21:38252682-38252704 CTGACAAAGTGGAGGAGGATGGG + Intronic
1180978462 22:19865762-19865784 CTAAATAATTGGTGTAATATTGG + Intergenic
1183894084 22:40953634-40953656 GTAAGTAATTGGAGGAGGATGGG + Intronic
952726126 3:36587006-36587028 CTGAATAGTTTGAGTAGGATTGG - Intergenic
953088495 3:39698565-39698587 CTGAATAGTTTGAGTAGGATTGG - Intergenic
954021005 3:47741567-47741589 TTGAGTAGTTGGAGGAGTAAGGG - Intronic
954545258 3:51428871-51428893 CTGAGTAGTTGGGGGACTATAGG - Intronic
955460500 3:59177465-59177487 ATCAATAATAGGAGGAGTTTTGG - Intergenic
955932261 3:64068835-64068857 CCGAATAGTTTGAGGAGAATTGG + Intergenic
956360816 3:68444562-68444584 AAGAATATTTGGAGGAATATGGG + Intronic
957418581 3:79938185-79938207 CTGAGTAAATGGATGAGTACAGG - Intergenic
957656466 3:83084184-83084206 CTGCAGAATAGGAGGAATATTGG - Intergenic
957665657 3:83222206-83222228 ATGAATAATTGGATGTCTATTGG - Intergenic
958617850 3:96518675-96518697 CAGAATAGTTTGAGGAGAATTGG - Intergenic
958630894 3:96681991-96682013 CAGAATAGTTTGAGGAGGATTGG + Intergenic
959328438 3:104969800-104969822 CAGAATAATTTGAGTAGGATTGG + Intergenic
962908118 3:139823681-139823703 CTGAAAAATGGGAGGAGTCATGG + Intergenic
963430861 3:145200875-145200897 CAGAATACTTCGAGGAGGATTGG - Intergenic
963455255 3:145538424-145538446 CTGGATAATTAGAGAAGTAAAGG + Intergenic
964063081 3:152548864-152548886 CTGAATAAATGAATGAGTAAAGG + Intergenic
965102568 3:164319694-164319716 TTGAAAAAATGGTGGAGTATAGG + Intergenic
967726472 3:192867130-192867152 CTGATGAATGGGAGGAGTATTGG + Intronic
967840374 3:194000504-194000526 GTGAATAAATGGAGGAGAGTGGG - Intergenic
970560924 4:17281684-17281706 CTGAGGAAATGGAGAAGTATGGG + Intergenic
973608250 4:52608874-52608896 CTGAGCATTTGGAGGAGTAAGGG + Intronic
973855968 4:55010034-55010056 CTGGATTATGGGAGGATTATGGG - Intergenic
976044171 4:80925561-80925583 CTCTATAATTGCAGGTGTATGGG - Intronic
976499422 4:85770389-85770411 GTGAACAATAGGAGGACTATTGG - Intronic
978020666 4:103807808-103807830 CTGAATAAATTTAAGAGTATTGG - Intergenic
978684783 4:111427075-111427097 CTGAATAATGTGAGTAGGATTGG - Intergenic
980678154 4:136117661-136117683 GTGTTTAATTGGAGGAGTAAAGG - Intergenic
980764263 4:137279070-137279092 ATGAATAAATGGAGGAGAAGAGG + Intergenic
981414713 4:144478653-144478675 TTGAATAGTTTGAGGAGGATTGG + Intergenic
981996390 4:150979910-150979932 CGGAATAATTTGAGTAGGATTGG - Intronic
982459350 4:155649373-155649395 CAGAATAAATAGAGTAGTATCGG + Intergenic
982837209 4:160134375-160134397 CGGAATAGTTTGAGGAGAATTGG - Intergenic
983368721 4:166831123-166831145 CTGAAAAATTGGGGGAGAAATGG + Intronic
984253856 4:177366716-177366738 CAGAAGAATAGGAAGAGTATGGG - Intergenic
988083167 5:26438628-26438650 CAGAATAGTTGGAGTAGAATTGG - Intergenic
988801960 5:34704358-34704380 CTGACTATCTGGAGGAGTTTAGG - Intronic
992917107 5:81467785-81467807 CAGAAGAGTTGGAGGAATATTGG - Intronic
993840502 5:92872298-92872320 TAGAATAGTTGGAGGAGAATTGG + Intergenic
994579510 5:101621825-101621847 CTTGATAATTTGAGGAGTATTGG + Intergenic
999656160 5:153812511-153812533 GGAAATAATTGAAGGAGTATAGG + Exonic
1003260893 6:4515234-4515256 CTGAATATTTAGAGGAATGTTGG + Intergenic
1004814831 6:19301626-19301648 CAGAATAATTGGAAGAAGATTGG - Intergenic
1005212925 6:23489798-23489820 CTGCATATTTGGAGGATTTTAGG - Intergenic
1009604274 6:65847165-65847187 ATGAATAATTGGAGAAGGAAAGG + Intergenic
1010012482 6:71064991-71065013 GTGAATACTTTGAGAAGTATTGG + Intergenic
1010042841 6:71407174-71407196 CTGAATCATTTGTGGAGTACTGG + Intergenic
1010924521 6:81727719-81727741 CGGAATAATAGGAGGAAAATTGG + Intronic
1013337797 6:109182554-109182576 CTGTTTATTTGGAGGGGTATGGG - Intergenic
1014539548 6:122657568-122657590 GTGAATGATTGCAGAAGTATTGG + Intronic
1014690373 6:124556037-124556059 CAAAATAATTGAAGGAGAATTGG - Intronic
1016381585 6:143488822-143488844 ATAAATAATTGTAGGAGTAAAGG - Intronic
1016641036 6:146349458-146349480 GTGAATAATTGAAGAAGAATAGG - Intronic
1020452966 7:8340822-8340844 GTGAATAAATGGAGAAGGATAGG - Intergenic
1024960475 7:54969690-54969712 ATGAATCATTTGAGGAATATTGG + Intergenic
1027505265 7:79009568-79009590 AAGAATAATGGGAGGAATATTGG - Intronic
1034783593 7:153904570-153904592 TTGAATGATTGAAGGAGTAATGG + Intronic
1035084209 7:156243103-156243125 CAGAATAGTTTGAGTAGTATTGG + Intergenic
1037526837 8:19733339-19733361 ATTAATAATTGGTGGAGTGTGGG - Intronic
1039740581 8:40379311-40379333 CTGAAGAAATGTAGCAGTATTGG - Intergenic
1040425780 8:47284682-47284704 CTGAATTCTTGGAAGAGTGTAGG + Intronic
1041938865 8:63365053-63365075 CTGTCTATTTGGAGGAGGATAGG + Intergenic
1042290252 8:67163418-67163440 AAGAATAATCGGAGGAGAATGGG + Intronic
1042725622 8:71872597-71872619 TAGAATAATTTGAGGAGAATTGG + Intronic
1043561328 8:81497398-81497420 CTGAGTAATTGAAGGAATCTAGG - Intergenic
1044645769 8:94441557-94441579 CTGAATAAGTGGAGGTTTCTGGG - Intronic
1045759647 8:105589134-105589156 CTGAATAATAGCAGGATTAGAGG - Intronic
1045991111 8:108309588-108309610 TTGAATAATTTGAGTAGGATTGG - Intronic
1046150301 8:110215226-110215248 CAGAATAGTTGGAGTAGGATTGG - Intergenic
1046620060 8:116519789-116519811 CAAAATAATTGGAGCAGAATTGG - Intergenic
1048053689 8:130843983-130844005 CTGAATAAATGGAGAAGAAAGGG + Intronic
1049946300 9:599385-599407 CAGAATATTTGGAGGAATAGTGG - Intronic
1052272520 9:26641357-26641379 CTGAGTTTTTGGGGGAGTATGGG - Intergenic
1052499179 9:29267420-29267442 CAGAATAAATGGAGAAGTATTGG + Intergenic
1055037430 9:71832733-71832755 CAGAATAGTTTGAGTAGTATTGG - Intergenic
1055727925 9:79251398-79251420 CTGAATAGTTGAAAGACTATAGG + Intergenic
1057309299 9:93931800-93931822 CTGAAAAATGGGAGGTGTTTTGG + Intergenic
1058030998 9:100197553-100197575 CTGAATATGTGGAGGCTTATAGG - Intronic
1058341715 9:103905209-103905231 CTGAGTCATTGGACCAGTATTGG - Intergenic
1058460867 9:105181383-105181405 TTGAATATCTCGAGGAGTATTGG - Intergenic
1058810463 9:108634088-108634110 CTGAATAAATTCAGGAGTTTGGG - Intergenic
1060274793 9:122174230-122174252 CCGAAGAAATGGAGGAGGATGGG + Intronic
1187676111 X:21718206-21718228 CTGAACAATTGGAGCATTAATGG - Intronic
1188161537 X:26810443-26810465 CAGAATAGTTGGAGGAGGATTGG + Intergenic
1188607966 X:32056711-32056733 CTGAAGAATTTGAGAAGGATTGG - Intronic
1188924153 X:36018902-36018924 CAGAATAGTTTGAGGAGGATTGG + Intergenic
1190245471 X:48687909-48687931 CTGAATGAGTGAATGAGTATAGG - Intronic
1191052126 X:56205708-56205730 CTGAATAATTTGAGTAGGATTGG + Intergenic
1191984680 X:66967330-66967352 CAGAATAATTTGAGTAGAATTGG + Intergenic
1192533277 X:71907978-71908000 ATGAATAAATGGAGGATTATAGG - Intergenic
1192842277 X:74868919-74868941 TGGAATAGTTGGAGTAGTATTGG - Intronic
1193100534 X:77606378-77606400 CAGAATAGTTTGAGGAGGATTGG - Intronic
1193190927 X:78570388-78570410 TGGAATAATTGGAGTAGAATTGG + Intergenic
1193561734 X:83026227-83026249 CAGAATAATTTGAGTAGAATTGG - Intergenic
1193821195 X:86167111-86167133 CGGAATAGTTTGAGTAGTATTGG + Intronic
1193957641 X:87881929-87881951 CAGAATAATTTGAGTAGGATTGG + Intergenic
1195175298 X:102309201-102309223 CTGAATAAAGGGAGGAGGACAGG + Intronic
1195183567 X:102377892-102377914 CTGAATAAAGGGAGGAGGACAGG - Intronic
1195992782 X:110699145-110699167 CTGAATAGTTGCAGAAGAATTGG - Intronic
1196832946 X:119790716-119790738 CTGTAGATTTGGGGGAGTATTGG - Intronic
1197144489 X:123156441-123156463 CAGGCTAATTGGAGGAGTTTGGG - Intergenic
1197482312 X:127002576-127002598 CTGAATCATTAGAGTTGTATTGG + Intergenic
1197508845 X:127345291-127345313 CTGAATAGTTTGAGTAGCATTGG + Intergenic
1198813651 X:140562703-140562725 TGGAATAATTTGAGGAGAATTGG + Intergenic
1200243098 X:154507974-154507996 CTGAACAAATGGATGAATATTGG - Intronic