ID: 1077310444

View in Genome Browser
Species Human (GRCh38)
Location 11:1886596-1886618
Sequence TTCCCAATGCAGCCCCAGAG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 234
Summary {0: 1, 1: 5, 2: 1, 3: 19, 4: 208}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1077310444_1077310449 14 Left 1077310444 11:1886596-1886618 CCACTCTGGGGCTGCATTGGGAA 0: 1
1: 5
2: 1
3: 19
4: 208
Right 1077310449 11:1886633-1886655 AAACACAAACACAAAGCAGACGG 0: 6
1: 2
2: 11
3: 127
4: 1420
1077310444_1077310446 -10 Left 1077310444 11:1886596-1886618 CCACTCTGGGGCTGCATTGGGAA 0: 1
1: 5
2: 1
3: 19
4: 208
Right 1077310446 11:1886609-1886631 GCATTGGGAAAGCGCTCCCAGGG 0: 1
1: 5
2: 0
3: 7
4: 72

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1077310444 Original CRISPR TTCCCAATGCAGCCCCAGAG TGG (reversed) Intronic
902990689 1:20185556-20185578 TTCCCAGTGTGGCCCCGGAGTGG + Intergenic
903271566 1:22191803-22191825 TCCCCACTGCAGATCCAGAGAGG - Intergenic
904264858 1:29312534-29312556 TTCCCATTGTCTCCCCAGAGAGG + Exonic
906460700 1:46033609-46033631 CTCCCATTGGAGCCCCAGAGTGG - Intronic
907765226 1:57403230-57403252 TTCCCAATGGATCCACAGAATGG - Intronic
908480296 1:64533041-64533063 TTCCCAACAGAGCCCCAAAGAGG + Intronic
910459000 1:87428085-87428107 TTCACAGTGAAGCCTCAGAGGGG + Intergenic
910793704 1:91076427-91076449 TTCCAAATACAGCCACACAGGGG - Intergenic
913971311 1:143420321-143420343 TTCCCAATGCAGCCCTAGAGTGG + Intergenic
914065688 1:144245934-144245956 TTCCCAATGCAGCCCTAGAGTGG + Intergenic
914113463 1:144720420-144720442 TTCCCAATGCAGCCCTAGAGTGG - Intergenic
914316281 1:146515004-146515026 TTCACAGTGAAGCCCCAGAGGGG + Intergenic
914498074 1:148218357-148218379 TTCACAGTGAAGCCCCAGAGGGG - Intergenic
915145180 1:153792664-153792686 TTCCCGCTGCTTCCCCAGAGGGG - Intergenic
916210847 1:162358504-162358526 TTCCCAAAACAGCAACAGAGAGG + Intronic
916921430 1:169471879-169471901 ATCCCAAAGCAACCCCAGTGTGG + Intronic
920172056 1:204078306-204078328 ATCTCAAAGCACCCCCAGAGAGG - Intronic
920416858 1:205804662-205804684 CTCCCAAACCAGCTCCAGAGAGG + Intronic
921161160 1:212472889-212472911 GTCTCTAGGCAGCCCCAGAGTGG - Intergenic
921491105 1:215776984-215777006 TGCCCAATACAGCCCTAAAGAGG - Intronic
923031466 1:230252233-230252255 CTCCCAATGCACACCCACAGAGG - Intronic
923328448 1:232900794-232900816 TTTAGAATGCAGCCCCTGAGGGG + Intergenic
923680292 1:236113325-236113347 TTACCAAAGCAGTCCCACAGTGG + Intergenic
1062906170 10:1180727-1180749 TTTCCAATGCAGCCAGAGTGAGG - Exonic
1063830106 10:9942746-9942768 TCCCCAAAGCAGACCCTGAGAGG + Intergenic
1066388078 10:34957570-34957592 TTCCCAAGGCAGGCCCAGCCAGG + Intergenic
1070322645 10:75365948-75365970 TTCCCAGAGGAGCCCCAGTGAGG + Intergenic
1070627546 10:78061974-78061996 CTCCCACGGCAGCCACAGAGTGG + Intergenic
1071976974 10:90964931-90964953 CTCCCCAAGCAGCCCCAGGGTGG + Intergenic
1072730551 10:97843086-97843108 TTTCCAATGCAGCCGCAGATTGG + Intergenic
1074352177 10:112748255-112748277 TTCCAAATGCAACCCCAAATTGG - Intronic
1077310444 11:1886596-1886618 TTCCCAATGCAGCCCCAGAGTGG - Intronic
1078537596 11:12187440-12187462 TGCTCACTGCTGCCCCAGAGGGG - Intronic
1078795895 11:14591476-14591498 TTCCACCTGCAGCCCCAGTGTGG + Intronic
1079363401 11:19788576-19788598 TTCTCCATACAGCACCAGAGAGG + Intronic
1079941668 11:26688273-26688295 TTCCCAATGCAGCATCAGCTCGG + Intronic
1081580204 11:44346725-44346747 TTACCACTGTAGCCCCTGAGAGG - Intergenic
1081636654 11:44726666-44726688 TTCCGAATTCAGACGCAGAGAGG + Intronic
1084763211 11:71287402-71287424 TTCAGAATGCAGCCACAGAAGGG + Intergenic
1084961935 11:72721426-72721448 TCCCCAACGAATCCCCAGAGGGG + Intronic
1086905007 11:92408293-92408315 TTCCAAATGTAGCCACAAAGTGG + Intronic
1088310911 11:108459487-108459509 TTGCCATTGGAACCCCAGAGAGG - Intronic
1089153685 11:116384790-116384812 TCCCCATTGCATCCTCAGAGCGG + Intergenic
1089174097 11:116536082-116536104 TTCCCAATGCACAGACAGAGGGG + Intergenic
1089418849 11:118315941-118315963 TACCCAGTCCATCCCCAGAGAGG - Exonic
1089777120 11:120845925-120845947 TACCCAATGCAAACCCTGAGAGG + Intronic
1096031339 12:48418075-48418097 TTGCTAATGCAGCAGCAGAGGGG + Intergenic
1097950984 12:65428041-65428063 TTCCCAAAGCAGCTCAACAGTGG + Intronic
1101074111 12:101110281-101110303 TTCCCAATACAGACGCACAGGGG - Intronic
1101286783 12:103322233-103322255 TTCCCATTGCAGCCAGAGAAGGG - Intronic
1102733564 12:115136920-115136942 GTCCCTCTGCAGTCCCAGAGGGG + Intergenic
1104970348 12:132528103-132528125 TTCCCTCTGGAGCCCCAGACTGG + Intronic
1106014410 13:25854667-25854689 TGAACAATGCAGGCCCAGAGTGG - Intronic
1106575553 13:30971043-30971065 AGCCCAAGGCAGCCCCAAAGAGG - Intronic
1107694754 13:42989433-42989455 TTCCTCCTGCAGCCCCAGTGTGG - Intronic
1109364702 13:61339571-61339593 CTCCCCCTGCAGCCCCAGTGAGG + Intergenic
1111007906 13:82274051-82274073 TTCGCAGTGCAGTTCCAGAGTGG - Intergenic
1116452434 14:45080847-45080869 CTCCACCTGCAGCCCCAGAGCGG + Intergenic
1116856918 14:49960609-49960631 TTCTCAATCCAGCCCAAGAGTGG - Intergenic
1118883394 14:69847731-69847753 TGACCACTGCAGCCCCAGGGAGG - Intergenic
1119646336 14:76351116-76351138 TTCTCACTCCAGCCCCACAGTGG - Intronic
1119722242 14:76899075-76899097 TTCTAAATGCAGCCCCAGGATGG + Intergenic
1120299056 14:82682093-82682115 TTCCCAAAGAAACCACAGAGGGG + Intergenic
1121114841 14:91336427-91336449 GACCTCATGCAGCCCCAGAGTGG - Intronic
1122076315 14:99237414-99237436 TCCCCAAGGCAGGACCAGAGAGG + Intronic
1122236695 14:100334593-100334615 TCCCCAAAGCAGCCCCACAGTGG - Exonic
1122297621 14:100714141-100714163 TTCCCTCTGCAACCACAGAGTGG + Intergenic
1124375394 15:29126142-29126164 TTCCCAGTGTGGCCCCAGACAGG + Intronic
1124835625 15:33194135-33194157 TTCCCAATGCAATCCCATTGTGG + Intronic
1125611823 15:40976549-40976571 TTGCCAAGTCAGACCCAGAGGGG + Intergenic
1125743007 15:41980503-41980525 CTCCCAACCCAGCCACAGAGGGG - Intergenic
1127354719 15:58187385-58187407 CCCCCAATGCAGCCCCTAAGGGG + Intronic
1127734989 15:61831610-61831632 TTCTCAATCAAGGCCCAGAGAGG + Intergenic
1127790784 15:62397050-62397072 TTCCTAATTGAGGCCCAGAGAGG + Intronic
1128133965 15:65249303-65249325 TTCCCCAGGCAGCCCCTGGGCGG + Intronic
1128553605 15:68615035-68615057 TTCTCAATGCTGCCTCTGAGAGG + Intronic
1129792450 15:78350347-78350369 TGAGCAGTGCAGCCCCAGAGAGG - Intergenic
1129877458 15:78984958-78984980 GCCCCAATCCAGCCCCAGGGAGG + Intronic
1130510218 15:84583021-84583043 CTCCAAATGCAGCCACAGAGAGG + Intergenic
1132831971 16:1932873-1932895 TGGCCAGGGCAGCCCCAGAGCGG + Intergenic
1134122938 16:11597495-11597517 TTAGCAATACAGGCCCAGAGAGG + Intronic
1135653752 16:24229586-24229608 TCCCCAACTCAGCCCCTGAGAGG - Intergenic
1135771154 16:25219596-25219618 TTCCCAGGGGAGCCCCAAAGGGG - Intronic
1137062988 16:35809200-35809222 CTAGCACTGCAGCCCCAGAGAGG - Intergenic
1139012370 16:62648517-62648539 CTCCCAATTCAGGCCTAGAGAGG - Intergenic
1141149070 16:81551848-81551870 TTCCCCATGCATCCTCAGATGGG + Intronic
1141750650 16:85955710-85955732 TCTCCTATCCAGCCCCAGAGGGG - Intergenic
1142401635 16:89861806-89861828 ATCCCCAAGCAGCCCGAGAGAGG - Intronic
1142677118 17:1520733-1520755 TTCCCAAAGCAGCCTCGGGGAGG - Intronic
1143736821 17:8916798-8916820 TTCCCAAGGCAGCCCACGATGGG + Intronic
1144389272 17:14778657-14778679 ATCCCACTTCAGCCCCTGAGAGG + Intergenic
1145001889 17:19311189-19311211 TTCCCACTGCAGGGACAGAGAGG - Intronic
1146650173 17:34601711-34601733 TTCCCTCTGAAGCCCCAGAGGGG - Intronic
1146689801 17:34865485-34865507 TTCCCAGTTCAGCCCCAGGGTGG - Intergenic
1147847868 17:43417882-43417904 TGCCCCAGGCAGCCCCAAAGAGG - Intergenic
1147882262 17:43661464-43661486 TTTCGAAGGCAGCCCCAGACAGG + Exonic
1147952787 17:44116306-44116328 TTCGCCATCCAGCCTCAGAGGGG + Intronic
1149561559 17:57611318-57611340 TTCCCACTGTAGCCCCACACAGG - Intronic
1149685261 17:58531402-58531424 TTCCCAAAGGGACCCCAGAGAGG - Intronic
1150712562 17:67544376-67544398 TTCCCACTGAAGCCCAGGAGGGG + Intronic
1151001450 17:70381542-70381564 TTAGCAGTGCAGCCCCAAAGAGG + Intergenic
1151277302 17:73045116-73045138 TACCCAAGGCTACCCCAGAGAGG - Intronic
1152574701 17:81134860-81134882 TTCCCTTCCCAGCCCCAGAGGGG - Intronic
1154110702 18:11566193-11566215 CTCCAAATGCAGCCACAGAGGGG - Intergenic
1157596662 18:48868226-48868248 TTCACTTTCCAGCCCCAGAGAGG + Intergenic
1159199287 18:65162961-65162983 TTCACAAAGCAGCCCCTGTGTGG - Intergenic
1161302450 19:3549246-3549268 ATTCTAAGGCAGCCCCAGAGAGG + Intronic
1162935846 19:13981096-13981118 TTCCCAATGGAGGGGCAGAGGGG + Intronic
1163167692 19:15508966-15508988 ATCCCCATTCAGCCCCAAAGAGG - Intronic
1163184014 19:15623775-15623797 TCCCCACTGTAGCCCCAGACTGG - Intronic
1164413012 19:28021211-28021233 TTCCAAATGCCTCCACAGAGAGG + Intergenic
1164517507 19:28948625-28948647 TTCCAAATGCCTCCACAGAGAGG + Intergenic
1164545991 19:29163357-29163379 TTCCCTCTGCAGCCCCACAAAGG + Intergenic
1165891000 19:39112182-39112204 TCCCCAATCCAGCCCAAGAAGGG - Intergenic
1166717062 19:44975253-44975275 GTCCCAATGAGGCCCCAGAATGG - Intronic
1166795733 19:45424361-45424383 TTCCCAGTGCTGACCCAGAATGG + Intronic
1167342334 19:48923080-48923102 TTCCCCACACAGCCCCAGAAGGG + Exonic
1168312738 19:55469223-55469245 TTCCCAACCCAGACGCAGAGGGG + Intergenic
1168379423 19:55907460-55907482 CTCCCACTGCAGCCCCCGAGTGG - Intronic
925074100 2:997708-997730 CTCCCCACTCAGCCCCAGAGGGG - Intronic
925720369 2:6821224-6821246 TTCCCCATGCCCCTCCAGAGAGG + Intergenic
930106246 2:47642198-47642220 TTCCAAGTGGAGCCCCTGAGAGG - Intergenic
931668112 2:64624649-64624671 TTCTCAAGGCTGGCCCAGAGGGG - Intergenic
931708761 2:64969416-64969438 CTCCACCTGCAGCCCCAGAGTGG + Intergenic
932404670 2:71505177-71505199 GTCACAGTGCAGCCCCAGACAGG + Intronic
934158503 2:89225758-89225780 TTCCCAATACAGCAGCACAGTGG + Intergenic
934176006 2:89581254-89581276 TTCCCAATGCAGCCCTAGAGTGG + Intergenic
934286316 2:91655616-91655638 TTCCCAATGCAGCCCTAGAGTGG + Intergenic
939168964 2:138671612-138671634 TTCCCAATCCAGCCCCTCCGTGG + Exonic
945255404 2:207799003-207799025 GCCCCAATGCAGACCCCGAGAGG - Intergenic
948530047 2:238598474-238598496 TTCCTTATGCAGCCACCGAGAGG + Intergenic
948759692 2:240182992-240183014 TTCCCAGGGCAGCCCCAGATTGG - Intergenic
948769848 2:240246033-240246055 GGCGCAATGCAGCCCTAGAGGGG + Intergenic
948907406 2:240986423-240986445 TTGCTCATGCAGCCTCAGAGTGG + Intronic
1169406041 20:5322065-5322087 TCCACAATGCAGCCCCTGAGAGG + Intergenic
1170851662 20:20010082-20010104 TTCCCTATGCAGCGTCTGAGCGG - Intergenic
1170961402 20:21028972-21028994 TTCACAACGTAGCCCCGGAGCGG - Intergenic
1173353411 20:42265209-42265231 TTCCCAATGCTGGCTCAGAATGG + Intronic
1174139122 20:48400514-48400536 TTGCCAGAGCAGCCACAGAGGGG - Intergenic
1175050551 20:56151665-56151687 TTCCCACAGCAGCACCTGAGAGG - Intergenic
1175812313 20:61864877-61864899 GGCCCCGTGCAGCCCCAGAGAGG - Intronic
1177594752 21:23224143-23224165 ATCCCAAGGCAGCCCCAAGGTGG + Intergenic
1180069845 21:45430801-45430823 TTCCCAGGGCAGCCCCACAAAGG - Intronic
1180693366 22:17736598-17736620 TTCACAATGCTGCCCAAGAAGGG - Intronic
1181719488 22:24762914-24762936 TTCCCAATGCTGCCACATTGGGG + Intronic
1182546762 22:31081210-31081232 TTCCCAATGGGGCACGAGAGTGG + Intronic
1182685827 22:32121242-32121264 TGACCAATGCAGCCACAGATAGG + Intergenic
1184320930 22:43741740-43741762 TACCGAATCCTGCCCCAGAGTGG - Intronic
1184453540 22:44596818-44596840 TGCCCACTGCAGGCCCACAGCGG + Intergenic
1184691149 22:46117896-46117918 TCACCAATGCAGCACCAGAGGGG - Intergenic
1184738428 22:46412514-46412536 TACCCAATCCTGGCCCAGAGAGG - Intronic
950006012 3:9691408-9691430 GTGCCACTGCAGCCTCAGAGTGG - Intronic
950456311 3:13094808-13094830 TTCCCAGTGGAGGCCCAGAAGGG - Intergenic
952710528 3:36427377-36427399 TTTCCAAGGCTGGCCCAGAGGGG - Intronic
952838828 3:37627376-37627398 CTCCCGCAGCAGCCCCAGAGAGG - Intronic
954131059 3:48561142-48561164 TGCCCCCTGCAGCTCCAGAGTGG + Intronic
955053480 3:55434958-55434980 TTCCCAAAGCTGCCCCCTAGTGG - Intergenic
956168615 3:66415134-66415156 TTCCCAACTCAGACCCAGAGAGG - Intronic
956407373 3:68941990-68942012 TACTCATTGCAGCCACAGAGGGG + Intergenic
957625639 3:82649732-82649754 CTCCCATTGCAGGCCTAGAGAGG - Intergenic
958499972 3:94892934-94892956 TTCTCACTGCAGCCCAAGTGAGG + Intergenic
960054427 3:113266987-113267009 TTTCCAGTGGAGACCCAGAGAGG - Intronic
961023800 3:123533725-123533747 TTCCCTTTGCATCCCCAGTGTGG - Intronic
961059616 3:123817442-123817464 ATCCAGATGCAGGCCCAGAGGGG - Intronic
962405422 3:135095891-135095913 TTCCCAAGGCTCTCCCAGAGTGG + Intronic
962887668 3:139642512-139642534 TTCCCAGGGCAGCGCCACAGTGG - Intronic
964499061 3:157328045-157328067 TTCCCAATTGAGCCACAGAGAGG - Intronic
967895246 3:194390111-194390133 TACTCAATGGAACCCCAGAGAGG + Intergenic
968097736 3:195943763-195943785 TTCCAGCTGCAGACCCAGAGAGG - Intergenic
969114476 4:4862515-4862537 TTCCCATTGCAACCCCGCAGGGG - Intronic
969507683 4:7598328-7598350 TGCCCGATGATGCCCCAGAGAGG + Intronic
969519610 4:7668345-7668367 TCCCCATCCCAGCCCCAGAGGGG - Intronic
977357082 4:95960010-95960032 TGCCCATTGCAGCCCCAAAGAGG - Intergenic
979206086 4:118039991-118040013 TTCTCAATGCAGCATCAAAGTGG - Intronic
981942469 4:150297538-150297560 TTCCAAATGCAGGCCCAGAAGGG + Intronic
982883179 4:160745365-160745387 TTCCCAACCCAGGCCAAGAGAGG - Intergenic
983162627 4:164435393-164435415 TACACAATGGAGACCCAGAGGGG + Intergenic
984784984 4:183559334-183559356 TTCCCAATTCAGAGACAGAGTGG + Intergenic
985699725 5:1363311-1363333 CTCCCACAGCAGCCCCAGGGAGG - Intergenic
988798398 5:34673824-34673846 TTCCCAATTCTCACCCAGAGAGG + Intronic
993173643 5:84453393-84453415 TTGCCAATCCAGCCCCAAAAAGG + Intergenic
996951340 5:129129521-129129543 TTACCATGGCAGGCCCAGAGGGG - Intergenic
997525020 5:134547244-134547266 GTGCCAATGCAGCCCTGGAGGGG - Intronic
998232711 5:140371563-140371585 TATCCAAAGCAGCCCCAGACAGG - Exonic
998948853 5:147371248-147371270 TTCCCCATGCAGCCCCACAGTGG + Intronic
999122036 5:149217190-149217212 TTCCCAATCCACCCAGAGAGGGG - Intronic
1002069846 5:176672733-176672755 TCCCCAATGCGGGCACAGAGAGG + Intergenic
1002395390 5:178948657-178948679 TTCCCAAACCAGCCTCAGTGCGG - Intronic
1003240793 6:4344097-4344119 TTCCAGATGCAGACCCAGGGTGG + Intergenic
1004536026 6:16503210-16503232 TTCTGAAGGCAGCCCCACAGAGG + Intronic
1004599440 6:17133199-17133221 TCCCCTATGCAGCCCTGGAGGGG - Intergenic
1007252005 6:40502141-40502163 TGCCCACAGCAGCCCTAGAGGGG + Intronic
1008016157 6:46522230-46522252 TTCCCACTGAATCTCCAGAGGGG + Intergenic
1010037812 6:71346230-71346252 TTGCCACTGTAGCCTCAGAGAGG - Intergenic
1012113256 6:95262079-95262101 TTCACATTGCAGCCCTAGAAAGG - Intergenic
1012295230 6:97513667-97513689 TTCCCAAAGCAGCTCAACAGTGG - Intergenic
1012517388 6:100078507-100078529 TTCCCAAAGCAGCAGCACAGTGG + Intergenic
1015187744 6:130437459-130437481 GTCCCAATGTAGACCCTGAGAGG - Exonic
1016119268 6:140327478-140327500 CTCCCAATCCAGGCCTAGAGAGG + Intergenic
1018635805 6:165858343-165858365 TTCCCAGTGCCTCCCCTGAGGGG - Intronic
1019586413 7:1806583-1806605 TTCCCAATTCACTCCCGGAGTGG - Intergenic
1019802436 7:3098103-3098125 TAGCCAAGGCAGCCCTAGAGAGG + Intergenic
1022816067 7:33915593-33915615 TTCACAATGAAGGCTCAGAGAGG - Intronic
1023866096 7:44239149-44239171 GTCTCCATGCGGCCCCAGAGGGG + Intronic
1027793460 7:82661395-82661417 ACCTCAATGCAGCCCCAGACAGG + Intergenic
1029345018 7:99972051-99972073 AGCCCTATGCAGCCCCACAGTGG - Intronic
1030708932 7:112726344-112726366 TTCCCATTGCAACCCCCGAGTGG + Intergenic
1031901723 7:127418387-127418409 TTCCCACCCCAGCACCAGAGGGG + Intronic
1032524664 7:132570948-132570970 TTCCTACTGCTGCCTCAGAGGGG + Intronic
1032534252 7:132648567-132648589 TCCTCAATCCAGCTCCAGAGGGG + Intronic
1032799077 7:135303750-135303772 TTTCCTTTGCAACCCCAGAGCGG + Intergenic
1036755939 8:11471183-11471205 TTCCCTCTGCTGCCTCAGAGTGG - Intronic
1038604512 8:28985879-28985901 ATCACCATCCAGCCCCAGAGTGG + Intronic
1045359372 8:101418461-101418483 TTCCCATTTCAGCCCAACAGAGG - Intergenic
1045738433 8:105322231-105322253 TTTGCACTGCAGCCCCAGAATGG - Intronic
1049852016 8:144837670-144837692 CTCCCAAGGCAGCCCCACAACGG - Intronic
1055371680 9:75606493-75606515 TTCCCAGGGAAGCCCCAGGGTGG - Intergenic
1056489077 9:87087257-87087279 TTCCCAAGACAGCCACAGATAGG + Intergenic
1056942710 9:90969056-90969078 CTTCCAATGCTGCCCCAAAGAGG + Intergenic
1057949746 9:99360279-99360301 TTACCAATTCAGCCTCAGGGAGG + Intergenic
1058505414 9:105661370-105661392 CATCCAATGCAGCCCCAAAGAGG + Intergenic
1060340546 9:122771806-122771828 CTCCCCCTGCAGCCCCTGAGAGG - Intergenic
1062339477 9:136087575-136087597 AGCCCAAGGCAGACCCAGAGAGG - Intronic
1062457132 9:136645130-136645152 TTTCCTGTGCAGCCCCAGATGGG + Intergenic
1062610744 9:137372351-137372373 CTCCCACAGCACCCCCAGAGTGG - Intronic
1189692659 X:43633232-43633254 GTTCCAAAGCAGCCTCAGAGGGG - Intergenic
1193040142 X:76996607-76996629 TTCCACCTGCAGCCCCAGTGCGG - Intergenic
1193311683 X:80017214-80017236 GTGCCAATGGAGCACCAGAGAGG + Intronic
1194123578 X:89988630-89988652 TTCCCAATATAGGCCTAGAGAGG + Intergenic
1196582756 X:117395092-117395114 CTCCAACTGCAGCCCCAGTGCGG + Intergenic
1197313134 X:124930768-124930790 TGCCCAAGGGAGCCCCACAGAGG + Intronic
1197777599 X:130129513-130129535 AACCCACTGCAGCCCCTGAGAGG - Exonic
1200476463 Y:3646251-3646273 TTCCCAATATAGGCCTAGAGAGG + Intergenic
1200906130 Y:8484723-8484745 TTCTCAAGGCAAGCCCAGAGAGG - Intergenic