ID: 1077311119

View in Genome Browser
Species Human (GRCh38)
Location 11:1889508-1889530
Sequence CTCTGGGCACGGAGGCTCTG GGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 399
Summary {0: 1, 1: 0, 2: 0, 3: 35, 4: 363}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1077311109_1077311119 2 Left 1077311109 11:1889483-1889505 CCTCTGGCTCCAGGCTCTGCCGC 0: 1
1: 1
2: 2
3: 48
4: 470
Right 1077311119 11:1889508-1889530 CTCTGGGCACGGAGGCTCTGGGG 0: 1
1: 0
2: 0
3: 35
4: 363
1077311112_1077311119 -7 Left 1077311112 11:1889492-1889514 CCAGGCTCTGCCGCGGCTCTGGG 0: 1
1: 0
2: 1
3: 45
4: 414
Right 1077311119 11:1889508-1889530 CTCTGGGCACGGAGGCTCTGGGG 0: 1
1: 0
2: 0
3: 35
4: 363
1077311106_1077311119 23 Left 1077311106 11:1889462-1889484 CCTGCTCTGTGGGGGTGGGCACC 0: 1
1: 0
2: 3
3: 31
4: 255
Right 1077311119 11:1889508-1889530 CTCTGGGCACGGAGGCTCTGGGG 0: 1
1: 0
2: 0
3: 35
4: 363
1077311105_1077311119 26 Left 1077311105 11:1889459-1889481 CCTCCTGCTCTGTGGGGGTGGGC 0: 1
1: 0
2: 4
3: 30
4: 291
Right 1077311119 11:1889508-1889530 CTCTGGGCACGGAGGCTCTGGGG 0: 1
1: 0
2: 0
3: 35
4: 363

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1077311119 Original CRISPR CTCTGGGCACGGAGGCTCTG GGG Exonic
900462163 1:2806867-2806889 CTCAGGGAGGGGAGGCTCTGGGG - Intergenic
900823809 1:4910492-4910514 CTCTGGACACTGAGGCTTCGTGG - Intergenic
900873891 1:5327441-5327463 CTCTGGACACTGATGCTCAGGGG - Intergenic
900902456 1:5526424-5526446 CTTTCGGCCCTGAGGCTCTGAGG - Intergenic
901069371 1:6509551-6509573 CTCGGGAGACGTAGGCTCTGGGG + Intronic
901320253 1:8335665-8335687 TTCTGGGAAGGGAGGCTCAGGGG - Intronic
902205876 1:14867737-14867759 CCCTGGGCATGGAGGCATTGGGG + Intronic
902219716 1:14957320-14957342 CTCTAGGCACGGGGGCACTGGGG - Intronic
902538107 1:17133376-17133398 CCCTGGCCCGGGAGGCTCTGCGG + Intergenic
902626627 1:17680278-17680300 CGCTGGGCACAGGGGCTCTCAGG - Intronic
902975257 1:20083721-20083743 CTCTGGGAAGGGAGGCTGCGTGG + Intronic
904354927 1:29932843-29932865 CTCTGGGAAGGGAGGCTTGGTGG - Intergenic
904982848 1:34521489-34521511 CTCTGGGCAAGGTAGCTGTGAGG - Intergenic
907256939 1:53186485-53186507 TTCTGGGCATGGAGGATCAGTGG - Intergenic
909522626 1:76587381-76587403 CTCTGGACACACAGGCGCTGAGG - Intronic
910851367 1:91652202-91652224 CTGGGGCCAAGGAGGCTCTGGGG + Intergenic
911054503 1:93698558-93698580 CTCTGGCCACGGAGGCCTCGTGG - Intronic
912384761 1:109265788-109265810 CTCTGGACAAGGAGCCTGTGGGG - Exonic
913439690 1:118884670-118884692 ATCTGACCACGGAGACTCTGGGG + Exonic
913498787 1:119451688-119451710 CTCTGAGCAGGGCGGCTGTGAGG + Intergenic
915464769 1:156090623-156090645 CTCTGGGGTCCCAGGCTCTGGGG - Intronic
915928220 1:160040723-160040745 CTCTGAGAACAGAGGCTATGAGG + Exonic
916005793 1:160658880-160658902 CTCTGGGCACACAGCCTATGGGG - Intergenic
916117031 1:161494353-161494375 CTTTGGGCATGCATGCTCTGTGG + Intergenic
916416008 1:164592567-164592589 CCCTGGCCACAGAGGCTTTGGGG + Intronic
921358565 1:214308889-214308911 CTCTAGGAAAGGAGGTTCTGTGG + Intronic
922073901 1:222223151-222223173 CCCTGGGCACTGAGTCTCTAAGG + Intergenic
922473040 1:225888308-225888330 CTCTGGGCACTGAGGAGCTAGGG + Intronic
922481043 1:225940278-225940300 CTCTGGGCACTGAGGAGCTAGGG + Intronic
922549751 1:226485274-226485296 CTCTGGGCAGGAAGCCTGTGAGG + Intergenic
922859633 1:228805050-228805072 GTGTCTGCACGGAGGCTCTGAGG + Intergenic
1064103811 10:12484807-12484829 CTGTGGGCACAGTGACTCTGGGG + Intronic
1064444244 10:15379462-15379484 CACTAGACTCGGAGGCTCTGGGG - Intergenic
1066649807 10:37643487-37643509 CTGTGGGCTCAAAGGCTCTGGGG - Intergenic
1067032698 10:42889032-42889054 CTGTGGGCTCAAAGGCTCTGGGG - Intergenic
1067752729 10:48982667-48982689 CTGTGGGGAAGGAGGCCCTGGGG - Exonic
1069656502 10:70093348-70093370 CTCGGGGCACAGAGGCAGTGTGG - Intronic
1070184880 10:74051945-74051967 CTCTGGGCACGCTGCCTCTAGGG - Intronic
1070718508 10:78739998-78740020 CTCAGGGCAAGGAGGCTGAGAGG + Intergenic
1071231114 10:83586943-83586965 CACTGGGCACAGATGGTCTGTGG + Intergenic
1072573500 10:96678713-96678735 CAGTGGGCACAGAGGCTCAGAGG - Intronic
1072807063 10:98430268-98430290 ATAAGGGCACTGAGGCTCTGGGG + Intronic
1073061419 10:100735861-100735883 GGCTGGGGACTGAGGCTCTGCGG + Intronic
1073110840 10:101062214-101062236 CTTTGGGCAAGGATGCTCAGGGG + Intronic
1074401462 10:113144286-113144308 CTCTGTCCACAGAGCCTCTGGGG - Intronic
1074437078 10:113443416-113443438 CTCTGGGCAGTGTGGCTCAGAGG - Intergenic
1075624267 10:123950622-123950644 CTCTGGGGACACAGGCTGTGTGG - Intergenic
1076115273 10:127891234-127891256 CTCTATGCACGGAGACTCAGAGG - Intronic
1076349926 10:129808699-129808721 CTCTGGGCGAGTAGGGTCTGTGG - Intergenic
1076575204 10:131461319-131461341 CTAAGGGCAAGGGGGCTCTGAGG - Intergenic
1076881842 10:133243476-133243498 GTCAGGGCAGGGAGGCTGTGGGG + Intergenic
1077311119 11:1889508-1889530 CTCTGGGCACGGAGGCTCTGGGG + Exonic
1077558841 11:3243065-3243087 CTCTGGGCACACAGCCTATGGGG + Intergenic
1077997775 11:7468751-7468773 CTCTGGGCAGGAAGCTTCTGAGG - Exonic
1078160081 11:8832625-8832647 CTCTGGGCTCTGGGGCTGTGTGG - Intronic
1078359571 11:10657924-10657946 CTCGGGGCATGGGTGCTCTGGGG - Intronic
1078360422 11:10663515-10663537 TGCTGGGCACTGGGGCTCTGGGG + Intronic
1079159235 11:17976970-17976992 CTCAGGGAGCTGAGGCTCTGTGG + Intronic
1081434803 11:43015464-43015486 CGTTGGGCACAGAGTCTCTGTGG - Intergenic
1081793507 11:45804863-45804885 GTCGGGGGACGGAGGCTCCGGGG + Exonic
1083272677 11:61580258-61580280 AGCTGGGCAGGGAGGTTCTGGGG - Intronic
1083791093 11:64986533-64986555 CTCTGGGCACGAGGACTCAGTGG - Intergenic
1084256442 11:67946274-67946296 CTCTGGGGAGGAAGACTCTGTGG - Intergenic
1084317509 11:68353980-68354002 CTCTGGCCCCTGAGGATCTGGGG + Intronic
1084439612 11:69165115-69165137 CTCTGGACACCAAGGCTCCGGGG + Intergenic
1085109311 11:73873624-73873646 CTCTGGCCAGGGAGGGACTGAGG - Intronic
1085200568 11:74699373-74699395 CTGAGGGCAGGTAGGCTCTGTGG + Intronic
1085401688 11:76239574-76239596 CCCTGGGCACAGTGGGTCTGGGG - Intergenic
1085412062 11:76297259-76297281 CTCTGGGCCAGGCGGCTTTGTGG - Intergenic
1088608672 11:111556326-111556348 CTCTGGACACGAAAGCTCTGTGG - Intronic
1088738977 11:112751439-112751461 CTCAGGGAACGGAGGCCCTGTGG - Intergenic
1089046451 11:115504903-115504925 CTTTGGGAACGGGGGCTGTGCGG + Intronic
1089956758 11:122578427-122578449 CTCTGGACACTGAGGCTTAGTGG - Intergenic
1090359137 11:126160567-126160589 TGCTGGGCCCTGAGGCTCTGCGG - Intergenic
1090737490 11:129622889-129622911 CTCTGGGCAGGGAAGCTGGGAGG + Intergenic
1092861068 12:12719121-12719143 CTCTGGGCATAGAAACTCTGAGG - Intronic
1097234224 12:57528581-57528603 GTCTGGGCTCAGGGGCTCTGAGG + Intronic
1097384368 12:58931976-58931998 CTCTGGGCATGGAGTTTCAGTGG - Intergenic
1097793631 12:63840909-63840931 CTCTGGGCACCCTGTCTCTGGGG + Intergenic
1097895844 12:64824507-64824529 TTCTGGGCACGGGGGAGCTGGGG + Intronic
1098224618 12:68308784-68308806 CTCTGGACAAGGAGCCTCTTTGG - Intronic
1102969568 12:117155553-117155575 CTGTGGGAGCGGAGGCCCTGGGG + Intronic
1103403698 12:120660132-120660154 CTTTGCCCACAGAGGCTCTGCGG + Intronic
1104269154 12:127266767-127266789 CCCTGGGCAGGGAGGCTGTGGGG + Intergenic
1104760247 12:131293818-131293840 CGCTGGGCGCTGAGTCTCTGTGG + Intergenic
1104766501 12:131333557-131333579 CACTGGGCACATGGGCTCTGTGG - Intergenic
1104768511 12:131345865-131345887 CTCTGGGCACTGAGGTACAGAGG + Intergenic
1104811535 12:131622723-131622745 CTCTGGGCACTGAGGTACAGAGG - Intergenic
1104846964 12:131851648-131851670 ACCTGGGGACGGAGGCCCTGTGG - Exonic
1104863846 12:131941188-131941210 CTCTGGGTAAGGAGACGCTGGGG + Intronic
1104920461 12:132287881-132287903 CTCTGAGCTGGGAGTCTCTGGGG + Intronic
1105255841 13:18743660-18743682 ATCTGGGGCCGGAGGATCTGGGG + Intergenic
1105945040 13:25181835-25181857 CTCTGGGCAGGGAGGCAGAGTGG + Intergenic
1106386162 13:29288225-29288247 CTCTGGGAATGGAGGCAATGGGG + Intronic
1107128794 13:36872826-36872848 CACTGTGCAGGGAGGCGCTGCGG + Exonic
1107263024 13:38518481-38518503 CTGTGGGCTAGGAGGCTCTGAGG - Intergenic
1108285523 13:48904361-48904383 CTATGTGCTAGGAGGCTCTGAGG - Intergenic
1112402306 13:99087053-99087075 CTCTGCGCCCGGGGCCTCTGCGG + Intergenic
1113571229 13:111359646-111359668 CTCTGGACACAGAGACTCAGGGG + Intergenic
1113680112 13:112237972-112237994 CTCTGGTCCAGGAGGCTGTGGGG - Intergenic
1113741701 13:112716006-112716028 CTCTGGGCAGGCTGGCTCTGTGG + Intronic
1113766470 13:112883734-112883756 CTCAGGGCAGGGTGGCCCTGGGG - Exonic
1113981468 13:114280722-114280744 CTCTGGGCAGGGTGGCTCTCGGG + Intergenic
1114402616 14:22423646-22423668 CTCTAAGCACTGTGGCTCTGTGG - Intergenic
1118442694 14:65826626-65826648 CCCTGGGGACGGTGGCACTGGGG - Intergenic
1118571572 14:67200028-67200050 TTCTGGACACCCAGGCTCTGGGG + Intronic
1118614631 14:67566978-67567000 CTGGGGGCAGGGAGGTTCTGTGG - Intronic
1119597024 14:75944451-75944473 GTCAGGGCAGGGAGGCTCCGTGG - Intronic
1119599373 14:75964766-75964788 CTCTGGGCTCTAAGGTTCTGTGG + Intronic
1119756981 14:77126189-77126211 CTGTGGGGAAGGAGGCCCTGCGG - Intronic
1119858725 14:77921544-77921566 CTCTGGGCATGGGAGATCTGGGG - Intronic
1120868884 14:89319455-89319477 TCTTGGGCACTGAGGCTCTGAGG - Intronic
1121446769 14:93983733-93983755 CTGTGTGGACGGAGGCTGTGTGG - Intergenic
1121714430 14:96062980-96063002 CTCTGGGCAGAGAGGGTCTGTGG - Intronic
1122101116 14:99410251-99410273 CTGTGTGCACGGAGGGTGTGGGG + Intronic
1122162208 14:99793084-99793106 CTCCGCGCACGGGGGCTCAGGGG - Intronic
1122902534 14:104787739-104787761 CTCTGGGCAGGGATGCCCTGTGG - Intronic
1122967349 14:105137616-105137638 CTCTGGGCAGAGTGGCGCTGTGG - Intergenic
1123045293 14:105509794-105509816 GGCTGGGCACGGTGGCTCTTTGG - Intergenic
1124248962 15:28095176-28095198 CTCCGGGCATGGTGGGTCTGCGG + Intronic
1126316438 15:47374825-47374847 ATCTGGGCACTGAGGCTGAGTGG + Intronic
1126553928 15:49965466-49965488 CTGAGAGCACAGAGGCTCTGCGG - Intronic
1128283215 15:66414584-66414606 CTCTGGACACTGAAGCTCAGGGG - Intronic
1129341569 15:74889942-74889964 CTCTGGGCACGGGTGCCCCGGGG + Intergenic
1129370356 15:75089622-75089644 CTCTGGGGCCGCTGGCTCTGAGG + Intronic
1130444053 15:83982314-83982336 CTCTGGACACTGAGGATCTGCGG - Exonic
1131406084 15:92166175-92166197 CTCAGGGAACGCTGGCTCTGAGG + Intronic
1132865361 16:2090439-2090461 CTCTGGGCACTGCGGCTGTGGGG - Exonic
1132899076 16:2243629-2243651 CGCTCGGCAAGGAGGGTCTGAGG + Intronic
1133103906 16:3494772-3494794 CCCTGGGCACTGGGGCACTGCGG + Exonic
1133285374 16:4688285-4688307 GTCTGGGCATTGGGGCTCTGTGG + Intronic
1133371596 16:5249385-5249407 CTCTGGGGAGGAAGACTCTGTGG + Intergenic
1133489657 16:6255250-6255272 GCCTGGGAATGGAGGCTCTGTGG - Intronic
1134191025 16:12121353-12121375 CTCTCGGCTCCCAGGCTCTGGGG - Intronic
1134363493 16:13554750-13554772 AACTGGGCACGGTGGCTCTTTGG - Intergenic
1135286809 16:21200613-21200635 ATCTGAGCACTGATGCTCTGAGG - Intronic
1136683036 16:31978900-31978922 TCCTGGGGACAGAGGCTCTGAGG + Intergenic
1136783674 16:32922456-32922478 TCCTGGGGACAGAGGCTCTGAGG + Intergenic
1136886114 16:33931350-33931372 TCCTGGGGACAGAGGCTCTGAGG - Intergenic
1138583238 16:57955134-57955156 TTCTGGTCTGGGAGGCTCTGGGG + Intronic
1139592647 16:67942069-67942091 GGCTGGGCAGGCAGGCTCTGGGG + Intronic
1139852867 16:69961439-69961461 CTCTTGGAAGGGAGGCTGTGCGG + Intronic
1139881838 16:70184347-70184369 CTCTTGGAAGGGAGGCTGTGCGG + Intronic
1140127756 16:72132284-72132306 CTCTGAGAAAGCAGGCTCTGTGG + Intronic
1140370672 16:74411159-74411181 CTCTTGGAAGGGAGGCTGTGCGG - Intronic
1140477939 16:75248398-75248420 CGTTGGCCACGGAGGCTCTTTGG - Intronic
1141575286 16:84959465-84959487 CACTGAGCAAGGAGGCTTTGTGG + Intergenic
1141662245 16:85447651-85447673 ATGAGGCCACGGAGGCTCTGTGG + Intergenic
1142160040 16:88552584-88552606 TTCTCGGCACGGAGGGGCTGGGG + Intergenic
1142257924 16:89024196-89024218 CTCAGGGTACCTAGGCTCTGTGG + Intergenic
1203086325 16_KI270728v1_random:1186457-1186479 TCCTGGGGACAGAGGCTCTGAGG + Intergenic
1142954740 17:3513834-3513856 CTCTGTGCAGAGAGGCTTTGAGG - Exonic
1144724833 17:17496549-17496571 CTCTGGGCGCGGGGGCTGGGGGG + Intergenic
1144750469 17:17644808-17644830 CTGAGGGCACGGGGGCCCTGGGG - Intergenic
1144848600 17:18232830-18232852 CACCGGGCAGGGAGGATCTGGGG + Intronic
1146646173 17:34578977-34578999 CTCGGGCCGCGGGGGCTCTGGGG - Exonic
1146652063 17:34613079-34613101 CTTTGGGAGGGGAGGCTCTGGGG - Intronic
1147143943 17:38474609-38474631 TCCTGGGGACAGAGGCTCTGAGG + Intronic
1147653130 17:42073083-42073105 CTCTGGGCAGAGTGGTTCTGAGG - Intergenic
1147667921 17:42160301-42160323 CTGTGGACAAGGAGGGTCTGGGG + Exonic
1148045712 17:44742948-44742970 CTGGGGCCAAGGAGGCTCTGTGG + Intronic
1148569884 17:48659821-48659843 CTCAGGGCATGGAAACTCTGGGG - Intergenic
1151785502 17:76273040-76273062 CTCTGAGGAGGGAGCCTCTGAGG + Intergenic
1151828906 17:76538299-76538321 CTCTGGACGCCCAGGCTCTGGGG + Intronic
1151995091 17:77603354-77603376 CTCGGAGCAGGGAGGCTGTGGGG - Intergenic
1152155901 17:78632531-78632553 CGCTGGGCGCGGTGGCTCAGGGG - Intergenic
1152433947 17:80263897-80263919 CTGTGGCTACTGAGGCTCTGTGG + Intronic
1152593871 17:81228958-81228980 CTCTGAGCCAGGAGGCTCTTTGG + Exonic
1153956633 18:10102000-10102022 CTGTGGGCACAGAGGCTTTCCGG - Intergenic
1154293606 18:13131325-13131347 CTCTGGGCACCAAGGCTTTGGGG - Intergenic
1155630126 18:27883358-27883380 CTCTGGGCACGCTGCCTATGGGG - Intergenic
1156456799 18:37299394-37299416 CTCTGGGCAGGGATGCTCCTGGG + Intronic
1156979251 18:43265489-43265511 CTCTGGGCAAGGCATCTCTGAGG - Intergenic
1156991851 18:43418713-43418735 CTCTGGGCACAGCGCCTATGGGG + Intergenic
1160413146 18:78688399-78688421 CCCTGGGCACGGAGAGTCCGTGG - Intergenic
1160719716 19:591783-591805 AACTGGGCAGGGAGGCTGTGGGG + Intronic
1160773911 19:846164-846186 CTGTGGCGACGGAGGCACTGAGG - Exonic
1161104682 19:2437332-2437354 CTTTGGACAAGGAGGCCCTGTGG + Intronic
1161269570 19:3382402-3382424 CACGGGGCACGGAGCATCTGAGG + Intronic
1161269634 19:3382706-3382728 CACGGGGCAAGGAGGGTCTGAGG + Intronic
1161562177 19:4979510-4979532 AGCTGGGCACCCAGGCTCTGGGG + Intronic
1161573254 19:5041647-5041669 CTCAGGGCCCGGAGACACTGGGG + Intronic
1161582097 19:5086658-5086680 CTCTGCCCACAGAGGCCCTGGGG - Intronic
1161844012 19:6701345-6701367 CTTTGGGCGAGCAGGCTCTGTGG - Intronic
1162803093 19:13121767-13121789 CGAGGGGCACGGAGGATCTGAGG - Intronic
1162931259 19:13959108-13959130 CTCTGGGCTCTGGGGCTCAGGGG - Exonic
1163109849 19:15152986-15153008 CTCTGTGCATGCAGGGTCTGTGG - Intergenic
1163783192 19:19261228-19261250 CTCTGGGGAAGGTGTCTCTGGGG + Intronic
1165146293 19:33732935-33732957 CTCTAGACACTGAGGCTCAGAGG - Intronic
1165683184 19:37795217-37795239 CTCTGGGCAGGGGGGATTTGGGG - Intronic
1166109194 19:40612292-40612314 CTCTGGGGACTGAGGGACTGAGG - Intronic
1166749954 19:45159872-45159894 CTTTGGGCCCGCAGGCCCTGTGG + Intronic
1167439257 19:49499083-49499105 CTCTGGGCGGGGAGGATCTTGGG + Intronic
1167557834 19:50206576-50206598 CTCTTGGCCCTGAGGCTCTCAGG - Intronic
1167751240 19:51381481-51381503 CTCTGGACACTGAAGCTCAGTGG + Intronic
1167757606 19:51422131-51422153 CTCTGGGGCCCGAGGCTCCGCGG - Intergenic
925780150 2:7374628-7374650 CTGTGGTCTCGGAGGCTATGTGG - Intergenic
925918556 2:8624197-8624219 CCCTGGGCACGGAGGAGCTGAGG + Intergenic
926163564 2:10504552-10504574 CTCTCTCCAAGGAGGCTCTGGGG - Intergenic
926440701 2:12885552-12885574 ATCAGGGCACAGAGGCACTGTGG - Intergenic
927003235 2:18821528-18821550 CTCAGTGCAGGGATGCTCTGGGG - Intergenic
927058659 2:19392066-19392088 CTCTGAGAAAGGAGACTCTGTGG + Intergenic
927718469 2:25367852-25367874 CTCTGGGAAGGGGCGCTCTGAGG - Intergenic
927937971 2:27086130-27086152 CTCTGGGCGCGGTGCCGCTGCGG - Exonic
928450869 2:31377629-31377651 CTCTGGGGACTGAGGCTGTTTGG + Intronic
929452856 2:42048279-42048301 CTCCGGGCTCGGAGCCTCCGAGG + Exonic
931177429 2:59868115-59868137 CTCTGGGTATGCAGGCCCTGAGG - Intergenic
931215103 2:60234718-60234740 CTTGGGGCAGGGAGGCTCTTGGG - Intergenic
931970486 2:67580231-67580253 CTTTCGGAACTGAGGCTCTGTGG - Intergenic
932344087 2:70984538-70984560 TTCTGGGCAAGGAGGTCCTGTGG - Intronic
932704075 2:74009926-74009948 CTCTGGGCAGGTGGGCTGTGTGG + Intronic
934039469 2:88115987-88116009 CTCTGCACCAGGAGGCTCTGAGG + Intergenic
934735231 2:96686575-96686597 CGCTGGGCACGGTGGCTCACAGG + Intergenic
934943691 2:98520911-98520933 CTGTGGGCACGGAGGCTCCAAGG - Intronic
935084567 2:99832360-99832382 TTCTGAGCCCGGAGGCTTTGGGG - Intronic
935749251 2:106215873-106215895 CTCTAGACACTGAGGCTCAGGGG + Intergenic
936484538 2:112914895-112914917 CTCAGGGCGCTGAGGCTCTAGGG + Intronic
937347607 2:121136241-121136263 CTCTGGGCACACTGCCTCTGGGG - Intergenic
937456033 2:122042532-122042554 CTCTGGGCACACTGCCTCTGGGG + Intergenic
937840032 2:126515543-126515565 TTCTGGACACAGAGGCTCAGTGG - Intergenic
937888787 2:126919220-126919242 CTCTGGATACCGAGGCTCAGTGG - Intergenic
938324504 2:130389512-130389534 CTCTGTGGAAGGAGGTTCTGTGG - Intergenic
944481434 2:200161428-200161450 CTCTGGACACTGAAGCTCAGCGG - Intergenic
944529535 2:200653599-200653621 CTCTGCTCAGGGAGGCCCTGTGG - Intronic
945369517 2:208999703-208999725 CTCTGGGCACGCTGCCTATGAGG + Intergenic
946193416 2:218019645-218019667 CTCAGAGCAGGGAGGCCCTGGGG + Intergenic
947476071 2:230448766-230448788 CCCTGGGCAGGGTAGCTCTGGGG + Intronic
947742946 2:232493136-232493158 CTCTGGGCACCCCTGCTCTGGGG - Intergenic
947752398 2:232539856-232539878 CTCAGGGGATGGAGGGTCTGAGG + Intronic
947842694 2:233218572-233218594 CTATGGGCAGGGAGCCACTGTGG + Intronic
947910901 2:233800105-233800127 ATCTGGGCATGGAGCCCCTGGGG + Intronic
948251926 2:236536240-236536262 CACTGGGCACTGAGGAGCTGGGG + Intergenic
948371344 2:237491384-237491406 CTCTGGGCACTGACGCTTTGGGG - Intronic
948737568 2:240019170-240019192 CTCTGAGGAAGGAGGCTGTGGGG - Intronic
948939838 2:241190238-241190260 CCCTGGGCCCAGAGCCTCTGGGG + Intronic
949035080 2:241812486-241812508 CCGAGGACACGGAGGCTCTGTGG + Intronic
949035089 2:241812529-241812551 CTGAGGACACGGAGGCTCTGTGG + Intronic
1169883854 20:10376164-10376186 CTCTGGACACCGAGGTTCCGTGG - Intergenic
1169980396 20:11378273-11378295 CTCTGGGCACAGTGTCTGTGGGG - Intergenic
1170461563 20:16581578-16581600 CTCTGGGCACAGTGCCTCTGGGG - Intergenic
1170753700 20:19176842-19176864 CTCTGGGCACACTGCCTCTGGGG + Intergenic
1171981556 20:31632717-31632739 CTGTGGGAGCGGAGGCTCTGCGG - Intergenic
1172803854 20:37597488-37597510 CTCTGGGCACGCTGCCTATGGGG + Intergenic
1173872114 20:46348654-46348676 TCCTGAGCACGGAGGCTCTGAGG + Intronic
1174146413 20:48455522-48455544 CTCTGGGGACAGTGGGTCTGGGG + Intergenic
1176040654 20:63064221-63064243 CTCTGGGGCCGTGGGCTCTGAGG + Intergenic
1176074722 20:63243251-63243273 CGCTGGGGACCGAGGCTCTGAGG + Intronic
1176167406 20:63681329-63681351 CTCTGGGCACGTTGCCTCTCCGG + Intronic
1176674284 21:9763395-9763417 CCCTGGGAAGGGAGGCCCTGAGG - Intergenic
1179150845 21:38806587-38806609 CGCCGGGCCCGGAGGATCTGGGG + Intronic
1179984021 21:44911403-44911425 CTCTGCTCACGGAGGACCTGGGG - Intronic
1180801950 22:18636094-18636116 CTGCGGGGACCGAGGCTCTGGGG + Intergenic
1180958715 22:19752678-19752700 CTCTGAGAAGGAAGGCTCTGGGG - Intergenic
1180964937 22:19783185-19783207 TTCTGGGCACGTGGGCTCCGTGG - Intronic
1181219770 22:21359167-21359189 CTGCGGGGACCGAGGCTCTGGGG - Intergenic
1182097989 22:27638794-27638816 CACTGGGAACTCAGGCTCTGGGG + Intergenic
1182944843 22:34312279-34312301 CTCCTGGCCCTGAGGCTCTGTGG + Intergenic
1183097007 22:35558365-35558387 CCCTGGGCAGAGTGGCTCTGTGG - Intergenic
1184411514 22:44328938-44328960 TTCTGGGCAGGGACCCTCTGTGG - Intergenic
1184649183 22:45911836-45911858 CTCTGGAGCGGGAGGCTCTGCGG + Intergenic
1184735302 22:46394449-46394471 CTTTGGGCATGGTGGATCTGTGG - Intronic
1184813628 22:46854125-46854147 CACTGGGCAATGAGGCTCAGAGG - Intronic
1184937666 22:47736812-47736834 CTGTGGTCAGGGAGGCCCTGGGG + Intergenic
1185131821 22:49043670-49043692 CTGTGGGCACCCAGGCGCTGGGG + Intergenic
1185280670 22:49968605-49968627 CTCAGGGCCTGGAGGCTCTGTGG - Intergenic
949577760 3:5355490-5355512 ACCTGGGCAAGGAGGCTGTGTGG + Intergenic
950474643 3:13207651-13207673 CCCTGGGTGCAGAGGCTCTGGGG - Intergenic
952080190 3:29748623-29748645 CCCTGGGCATGGATGCTGTGAGG + Intronic
952730149 3:36629932-36629954 CACTGGGCAGGTAGGATCTGAGG + Intergenic
953607429 3:44420880-44420902 CTCAGGGCAGGGAGGGGCTGGGG - Intergenic
954646325 3:52133800-52133822 ACCTGGGCATGGGGGCTCTGCGG - Intronic
955819942 3:62886060-62886082 CCCTGGGAACAGAGGCTCAGGGG + Intergenic
956286285 3:67613838-67613860 TTCTGGTCCCAGAGGCTCTGTGG + Intronic
957071350 3:75570302-75570324 CTCTGGGGAGGAAGACTCTGTGG - Intergenic
958958679 3:100488577-100488599 CTCTGGGGAGGAAGGCTCTAAGG + Intergenic
961380627 3:126494476-126494498 CTGTTGGCACGGGGACTCTGAGG + Intronic
961649012 3:128408275-128408297 GGCTGGGCAAGGAGGCCCTGGGG - Exonic
961651887 3:128420954-128420976 CTCGGGACAAGGAGGCTCTCAGG + Intergenic
962055398 3:131866028-131866050 CTTTGGGTAAGGAGGCTCTCTGG + Intronic
962255414 3:133866978-133867000 CTCTGTGCTTGGAGGCCCTGGGG - Intronic
962350007 3:134649819-134649841 CAATGAGCACAGAGGCTCTGGGG + Intronic
963070971 3:141304987-141305009 CTCTGAGCTCTGAGGCTCAGAGG + Intergenic
963145046 3:141984966-141984988 CTCTGGGCACGTTGCCTATGGGG - Intronic
964915177 3:161832206-161832228 CTCTGGACACTGAAGCTCAGTGG - Intergenic
965408825 3:168304167-168304189 CTCTGGACACTGAGGCTCAGCGG - Intergenic
965494599 3:169382397-169382419 CACTGAGCACGGAGGACCTGAGG + Intronic
965500186 3:169446556-169446578 CTCAGGGCAAGGTGGCTCTGTGG - Intronic
966868774 3:184276768-184276790 CTCTGGGCCCGGGGGCAATGAGG - Intronic
967262118 3:187652592-187652614 CTCTGGGCCCTCAGGATCTGTGG + Intergenic
968804615 4:2764098-2764120 CGCTGGGCACGGTGGCGGTGTGG - Intergenic
969056710 4:4407052-4407074 CTGTGGGCACTGCGGCCCTGGGG + Intronic
969167155 4:5325951-5325973 CTCTGGGAATGTAGGGTCTGTGG + Intronic
969606928 4:8206461-8206483 CCCTGGGCCCCGCGGCTCTGTGG - Intronic
969611035 4:8227966-8227988 GTTTGGGCAGGGAGGCTGTGGGG - Exonic
969702253 4:8774037-8774059 CAGTGGGGAAGGAGGCTCTGCGG - Intergenic
969798169 4:9541935-9541957 CTCTGGGGAGGAAGACTCTGTGG + Intergenic
970237901 4:13977119-13977141 CTCAAGGCACAGAGGCACTGTGG + Intergenic
971187574 4:24395336-24395358 CTGTGGGCACTGTGGCTCTTTGG - Intergenic
975849812 4:78560551-78560573 TTCTGGACACTGAGGCTCAGAGG - Intronic
979600129 4:122578421-122578443 CTTTGTGCTCGGATGCTCTGGGG + Intergenic
980724645 4:136742660-136742682 CTTTGGGCATGTATGCTCTGTGG + Intergenic
982048576 4:151475507-151475529 ATCTGGGGATGGAGGCTCCGGGG + Intronic
983520264 4:168701263-168701285 CACTGGGCACATGGGCTCTGGGG - Intronic
984171841 4:176368691-176368713 CTCAGGGGAGGCAGGCTCTGGGG + Intergenic
985512722 5:321500-321522 CTCGGGGCACGGAGACTCCGGGG + Intronic
985515830 5:344131-344153 CTCCGGGCACCGGGGCGCTGCGG - Intronic
985985332 5:3510910-3510932 CTGTGTGCAGGCAGGCTCTGGGG - Intergenic
986792900 5:11180959-11180981 ATGTGGGCCCGGAGGTTCTGGGG + Intronic
988428368 5:31090550-31090572 CTGTGGGAATGGAGGCCCTGAGG + Intergenic
991963058 5:72064952-72064974 CTCTTGGCTCTGGGGCTCTGAGG - Intergenic
993298479 5:86175545-86175567 CTCTGGGCACACTGGCTATGGGG + Intergenic
997689882 5:135821234-135821256 AGCTGGGGACGGTGGCTCTGTGG + Intergenic
997722230 5:136088496-136088518 CTCAGGGCCCTGAGGCTCTGGGG + Intergenic
998227993 5:140341734-140341756 CTGTGGGGAGGGAGGCTCTGGGG - Intronic
999689292 5:154132886-154132908 CTGTGAGCACAGAGGTTCTGAGG + Intronic
1000329603 5:160196401-160196423 CTCTGGGGAGAGAGGCTCTAGGG + Intronic
1001426506 5:171625997-171626019 CCCTGGGAAGGGAGGGTCTGTGG + Intergenic
1003134555 6:3424224-3424246 CCAAGGGCATGGAGGCTCTGGGG - Intronic
1007662564 6:43495755-43495777 CTCTGGCCATGGAAGCCCTGGGG + Intronic
1008206759 6:48669481-48669503 CTTTGGGCACGCATGCTCTGTGG - Intergenic
1008211967 6:48736581-48736603 CCCTGGGCATGGAGGCACTCTGG + Intergenic
1008842399 6:55919725-55919747 ATCTGGGCAGGGAGGGGCTGAGG - Intergenic
1009649999 6:66463397-66463419 CTCTGGGCACACAGCCTATGGGG + Intergenic
1011819071 6:91229614-91229636 CTCTGGGAAAGGAAGCTCCGTGG - Intergenic
1013708258 6:112865314-112865336 CTCTGGGCACGCTGCCTATGGGG - Intergenic
1016456338 6:144234774-144234796 CTCTGGGCACTAAGGCTTGGGGG + Intergenic
1017999889 6:159569746-159569768 CTCTGGACACTGAAGCTCAGTGG - Intergenic
1018503986 6:164443997-164444019 GCCTGGGCCCTGAGGCTCTGTGG - Intergenic
1019327298 7:444750-444772 AGCTGGGCTCGGAGGCTGTGAGG - Intergenic
1019412131 7:911332-911354 CTCTGGGCAGGAAGGCGCTGTGG - Intronic
1019774911 7:2906607-2906629 CCCTGGGCAGAGAGACTCTGTGG - Exonic
1020281081 7:6650297-6650319 CTCTGTGCACGGAGTGGCTGTGG + Intronic
1021512696 7:21451563-21451585 GTCAGGGCAGGGTGGCTCTGTGG + Intronic
1021827350 7:24568609-24568631 GTCAGGGCAAGGAGGCCCTGAGG + Intergenic
1022532951 7:31078528-31078550 CACTGGGCGCTGAGGATCTGTGG - Intronic
1022687797 7:32612869-32612891 CTCTGGGCACACAGCCTATGGGG - Intergenic
1023085275 7:36564136-36564158 CTCAGAGCTGGGAGGCTCTGAGG - Intronic
1023984101 7:45085349-45085371 CTCAGAGGACGGGGGCTCTGGGG + Exonic
1026098859 7:67368443-67368465 ATCTGGGCATGTGGGCTCTGGGG + Intergenic
1027265334 7:76492147-76492169 CGCTGGGGAGGGAGGCACTGGGG - Exonic
1027316703 7:76990263-76990285 CGCTGGGGAGGGAGGCACTGGGG - Intergenic
1029408261 7:100390844-100390866 CTCTGGGATCAGAGGCTCTTGGG - Intronic
1029457796 7:100679729-100679751 CCCTGGGCAGGGGGGCTCAGGGG + Exonic
1029577439 7:101412709-101412731 CTCTGGGCACACTGCCTCTGGGG + Intronic
1029706608 7:102279796-102279818 ATCTGTGCCCGGAGGCACTGTGG + Intronic
1033601416 7:142891644-142891666 CCTTGGGCGCGGAGGCTCCGTGG - Intergenic
1034239269 7:149597286-149597308 GTCTGGCTACGGAGGCTTTGTGG + Intergenic
1034699855 7:153086453-153086475 CACTGGGCAGGGAGGAGCTGAGG + Intergenic
1035170413 7:157014315-157014337 CGCTGGGCAGGGAGGAGCTGTGG - Intergenic
1035260085 7:157655625-157655647 CACTGGAGACGGAGCCTCTGGGG - Intronic
1035823848 8:2623601-2623623 CTCTGGGCTCGTAGACTGTGAGG - Intergenic
1036256733 8:7212391-7212413 CTCTGGGGAGGAAGACTCTGTGG - Intergenic
1036308783 8:7670993-7671015 CTCTGGGGAGGAAGACTCTGTGG - Intergenic
1036360758 8:8075118-8075140 CTCTGGGGAGGAAGACTCTGTGG + Intergenic
1036556142 8:9862146-9862168 CCTTGGGCAAGGTGGCTCTGCGG - Intergenic
1036890210 8:12591854-12591876 CTCTGGGGAGGAAGACTCTGTGG - Intergenic
1038104312 8:24415705-24415727 CTCTGGAAACGGTGTCTCTGGGG + Intergenic
1039990213 8:42481451-42481473 CTCTGGGCGCTGAGGTTCTCTGG + Intronic
1040038739 8:42896378-42896400 CTCTGGCCGCCGAGGCTCTGCGG - Exonic
1040417249 8:47206338-47206360 CTCTGGGCTGGGAGGCCCTGAGG + Intergenic
1041466822 8:58165691-58165713 CTCTGGGAACTCAGGCTCTGAGG - Intronic
1044986507 8:97760820-97760842 CTCTGGGAACAGAAACTCTGCGG + Intergenic
1048981580 8:139705511-139705533 CTCTGGGCCCGGGGTCCCTGAGG - Intergenic
1049069448 8:140345439-140345461 CTCTGGGCCCTGAGGTCCTGGGG + Intronic
1049437948 8:142596296-142596318 CTCTGGGCACGGAGGGGCCTTGG - Intergenic
1049488299 8:142877662-142877684 CCCTGGGCACAGTGCCTCTGGGG + Intronic
1049493189 8:142915686-142915708 CCCTGGGCACAGTGCCTCTGGGG + Intronic
1050184563 9:2959447-2959469 ATATGGGAACTGAGGCTCTGTGG - Intergenic
1051489645 9:17647055-17647077 CTCTGGGCAGGGCATCTCTGAGG - Intronic
1054714872 9:68547185-68547207 CTCTGGGCCAGGGGACTCTGTGG + Intergenic
1054738823 9:68783929-68783951 TTCTGGGCTAGGAGGCCCTGAGG + Exonic
1055451019 9:76431563-76431585 CTCTGGTCATGGAGGCTCAGTGG - Intronic
1056578306 9:87872324-87872346 ATCTGGGAACGAAGGCCCTGTGG - Intergenic
1057189038 9:93075985-93076007 CTCTCAGCTCGGTGGCTCTGGGG + Intronic
1057505004 9:95626621-95626643 CTCTGGTCTCTGTGGCTCTGGGG + Intergenic
1057513751 9:95703430-95703452 CTCTGGGGACGGTGGGTCGGGGG + Intergenic
1058532420 9:105919710-105919732 CTCTGGGCCCCGAGGATCTCAGG + Intergenic
1058778747 9:108311919-108311941 TGCTGGGCTCTGAGGCTCTGAGG + Intergenic
1060462957 9:123875823-123875845 CACAGGGCAAGGAGTCTCTGGGG - Intronic
1060831754 9:126722073-126722095 CAGAGGGCACGGAGGGTCTGAGG - Intergenic
1062033064 9:134370784-134370806 CTCAGACCACGGAGGGTCTGGGG + Intronic
1062142453 9:134967125-134967147 GTCTGGGCTGGGAGGCACTGGGG - Intergenic
1062212612 9:135372939-135372961 CTCTGGGCAGGGTGGCTGTGGGG - Intergenic
1062399329 9:136365568-136365590 CTGTGGGCATGGCGGCCCTGGGG + Intronic
1062631505 9:137465102-137465124 CTCAGGGGACGGAGGCTGGGAGG + Intronic
1185546282 X:948130-948152 CTCTGGGGAAGGAGGGTCTGTGG - Intergenic
1185767083 X:2734045-2734067 ATTTGAGCACGGAGCCTCTGCGG + Intronic
1186454210 X:9698548-9698570 CTCTGGGCACTGAGACTCTATGG - Intronic
1186514546 X:10156825-10156847 CTCTGGACACGAATGCTCCGGGG + Intergenic
1187865891 X:23723026-23723048 ATTTGGGCACTGAGTCTCTGTGG - Intronic
1191249218 X:58252089-58252111 CTCTGGGCACTCAGGCACTCTGG + Intergenic
1197814273 X:130480517-130480539 CTTTGGGCAAGGGGGCTCAGAGG - Intergenic
1198237885 X:134753087-134753109 CTGTGGGAAAGGAGGCTTTGTGG - Intronic
1198417396 X:136434523-136434545 TTCAGTGCATGGAGGCTCTGGGG + Intergenic
1199590626 X:149465093-149465115 CTGTGGGCAGGGTGACTCTGAGG + Intergenic
1199673402 X:150165236-150165258 ATCTGTGCAAGGAGGCTCAGTGG - Intergenic
1199845181 X:151687751-151687773 CTCTGGGCTAAGATGCTCTGGGG + Intergenic
1200096611 X:153667534-153667556 CACTGGGCAAGGATGCTCTCTGG + Intergenic
1202045644 Y:20735108-20735130 CCCTAGGCACTGAGGCTCTATGG - Intergenic