ID: 1077311363

View in Genome Browser
Species Human (GRCh38)
Location 11:1890338-1890360
Sequence CGTGCGGGGCTGTGACCTCC TGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 159
Summary {0: 1, 1: 0, 2: 0, 3: 15, 4: 143}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1077311363 Original CRISPR CGTGCGGGGCTGTGACCTCC TGG Exonic
900633419 1:3650794-3650816 CGTGCGGGTCTGGGACCTGGGGG + Intronic
902065611 1:13683340-13683362 CGTGCGAGGCCTTGACTTCCAGG + Intergenic
903438452 1:23369492-23369514 CCTGCGGGTCTGAGACCTCCGGG - Exonic
903439792 1:23379099-23379121 CCTGCCAGGCTGTGACTTCCTGG + Intergenic
904253015 1:29237894-29237916 CGGGCTGGGCTGCGACGTCCGGG + Intronic
908742602 1:67343989-67344011 CTTGCTGGACTGTGAGCTCCAGG - Intronic
915061918 1:153193219-153193241 CCTGGGGAGCTGTCACCTCCAGG - Intergenic
915485329 1:156216494-156216516 CGTGCGGGGCTCTGGCCTACCGG + Intronic
915596113 1:156897445-156897467 CGTCGGGGGCTGTGAACCCCTGG + Intronic
916446488 1:164876931-164876953 TCTGCGGGGCTGTGAGGTCCAGG - Intronic
920275917 1:204804166-204804188 GGTGCGGGGTTCTGAACTCCTGG + Intergenic
922702058 1:227767008-227767030 GGTGCAGTGCTGTGCCCTCCTGG - Exonic
924746646 1:246841326-246841348 CCTGCGGGGCTGTCATCCCCTGG - Intronic
1062904506 10:1170713-1170735 CATGCGGGGCTGGGAGTTCCAGG + Intergenic
1064030770 10:11881219-11881241 GGCATGGGGCTGTGACCTCCTGG + Intergenic
1064096880 10:12430307-12430329 CTTGTGGGGCTGTGCTCTCCGGG - Intronic
1064994662 10:21285983-21286005 CATGCGGGGCTCAGACCTTCTGG + Intergenic
1067328814 10:45294942-45294964 GGTGAGGGGCTGTGACATCCAGG + Intergenic
1067536513 10:47114485-47114507 CCTGCCGGGGTGTTACCTCCTGG - Intergenic
1067578257 10:47421141-47421163 GGAGAGGGGCTGTGACCCCCAGG + Intergenic
1071546977 10:86536554-86536576 CGCGCGGTGCTGGGGCCTCCCGG + Intergenic
1075948841 10:126460258-126460280 CGTGCTAGGCTGTGAGCTCCAGG + Intronic
1076451596 10:130560531-130560553 CTTGCCGGGCTGCAACCTCCTGG + Intergenic
1077311363 11:1890338-1890360 CGTGCGGGGCTGTGACCTCCTGG + Exonic
1077432423 11:2522392-2522414 AGTGGGGGGCTGTGACTGCCTGG + Intronic
1077462485 11:2717576-2717598 TGGGTGGGGCCGTGACCTCCCGG - Intronic
1078431189 11:11290024-11290046 CTGGCTGGGCTGTGGCCTCCAGG + Intronic
1078639912 11:13084913-13084935 GGTGCTGGGCTGTCAGCTCCAGG - Intergenic
1079195327 11:18322035-18322057 GGAGCTGGGCTGGGACCTCCGGG - Exonic
1080566073 11:33510715-33510737 GGTGTGAGGCTGTGACCTCCTGG + Intergenic
1084478288 11:69401187-69401209 GGTGAGGTGCTGTGTCCTCCAGG + Intergenic
1090284349 11:125486336-125486358 CCTAAGAGGCTGTGACCTCCAGG + Intronic
1091765557 12:3117904-3117926 CCTGCGGAGCTGTCACCTCAGGG + Intronic
1097054892 12:56243377-56243399 AGTGCTGGGGTGTGACCTGCAGG + Exonic
1097787871 12:63780350-63780372 CGTGCGCGCCTGTCACCCCCTGG - Intronic
1099890104 12:88580145-88580167 CGTGCAGGGCTGTGCCTGCCGGG - Intronic
1103944391 12:124518032-124518054 GGTGGGGGGCTGTGGCCTGCAGG - Intronic
1104969602 12:132525275-132525297 TGTACAGGGCTATGACCTCCAGG - Intronic
1104973333 12:132541222-132541244 GGTGTGGGGCTGTGCCCCCCAGG - Intronic
1106375324 13:29181171-29181193 AGTGCAGCACTGTGACCTCCGGG - Intronic
1106404822 13:29464307-29464329 GGTCCGAGGCTGTGCCCTCCTGG - Intronic
1113898948 13:113785280-113785302 CGTGCAGGGCAGTGAACTTCAGG - Intronic
1121367945 14:93332387-93332409 GGTGCGGGGTTGCGACCGCCAGG - Intronic
1122628655 14:103097495-103097517 CCTGCGGGGCTGAGACCTGAAGG - Intergenic
1122645067 14:103188958-103188980 CGGGCGAGGCCGTGGCCTCCAGG - Intergenic
1122650024 14:103220982-103221004 CGGGCGAGGCCGTGGCCTCCAGG + Intergenic
1126187807 15:45847626-45847648 GGTTTGGGGCTGTGAGCTCCGGG + Intergenic
1131163636 15:90126750-90126772 CCTCTGGGGCTGTGTCCTCCAGG - Intergenic
1132692453 16:1187672-1187694 CAAGCAGGGCTGTGGCCTCCAGG - Intronic
1133383295 16:5348606-5348628 CCTGTTGGGCTGTGAACTCCAGG - Intergenic
1135400261 16:22162247-22162269 CGTGCCGGGCTCTGTCCTGCAGG - Intergenic
1135712436 16:24729489-24729511 CCTCGGAGGCTGTGACCTCCAGG + Intergenic
1138396044 16:56705539-56705561 CCTGCTGGCCTCTGACCTCCTGG - Intronic
1138656317 16:58493706-58493728 TCTGCGAGGCTGTGAACTCCCGG - Intronic
1139386526 16:66576026-66576048 AGTGCGTGGCAGTGCCCTCCTGG - Intronic
1139745895 16:69074054-69074076 CCTGCTGGGCAGTTACCTCCTGG - Intronic
1142120272 16:88383462-88383484 CGTGCGGGGCAGCGAGCGCCGGG + Intergenic
1147833718 17:43315312-43315334 CGGACGGGGCTGTGACTCCCAGG + Intergenic
1147842090 17:43379007-43379029 GGGGCGGGGCTGTGACTCCCAGG - Intergenic
1148013264 17:44503031-44503053 TGTGAGGGGCTGTGCCCTCCAGG - Intronic
1149587608 17:57803162-57803184 ACTGTGGGACTGTGACCTCCAGG + Intergenic
1150002957 17:61452615-61452637 CGTGCGGGGCTGGGGCCACAGGG + Intronic
1151235736 17:72718571-72718593 CGTGCCTGGCTGTGACCCCAAGG - Intronic
1151434912 17:74089193-74089215 CCTGCGGGTCTGGGCCCTCCAGG + Intergenic
1151875901 17:76868288-76868310 CGTGCGGGGCTGGGACGCCGAGG - Intergenic
1152628555 17:81399461-81399483 CGGGCGGGGCGGGGACCCCCGGG + Intronic
1154374338 18:13796692-13796714 CCTGCGGGGCTGAGACCCCCCGG + Intergenic
1157322805 18:46647203-46647225 CTGGCAGGGCTGGGACCTCCTGG - Intronic
1159957015 18:74525918-74525940 CTTGCTGGACTGTGACCCCCAGG + Intergenic
1160164938 18:76502458-76502480 CGGGCGGGACTGTGAACTCTGGG - Intergenic
1160755546 19:755178-755200 CGAGCAGGTGTGTGACCTCCGGG + Intronic
1161556400 19:4945079-4945101 CGTGCAGGGCTAGGAGCTCCTGG + Intronic
1162966606 19:14159192-14159214 TGTTCAGGACTGTGACCTCCAGG + Exonic
1163582535 19:18147017-18147039 GGTGCGCGGCAGTGACCACCAGG + Exonic
1163796092 19:19338871-19338893 GGTGTCGGCCTGTGACCTCCTGG + Exonic
1164240522 19:23384357-23384379 CGTGGTGGGCGGTGACCTGCAGG - Intronic
1165153996 19:33776742-33776764 CTTGAGTGGCTGAGACCTCCTGG + Intergenic
1166316843 19:41994106-41994128 CGGGCGGGGCGGGGACCTCGGGG + Exonic
1166717787 19:44979785-44979807 CTTGAGGGGGTGTGACCTACAGG + Intronic
1167436217 19:49480335-49480357 CTGTCGGGGCTGTGGCCTCCAGG - Exonic
1167609619 19:50500877-50500899 CAGGCGGGGCTGTGGCCCCCAGG - Intergenic
1168666721 19:58210001-58210023 CCTGCTGGGCAGTGACCTCGAGG - Exonic
1168691608 19:58380884-58380906 CCTGCGAGGCGGGGACCTCCCGG - Intronic
925695460 2:6572843-6572865 CTCGCTGGGCTGTGAGCTCCAGG + Intergenic
930261789 2:49155219-49155241 AGTGCTGGGCTGTCACCTCAGGG - Intergenic
931414205 2:62065396-62065418 AGTGCAGTGGTGTGACCTCCTGG + Intronic
938458895 2:131485082-131485104 CATGGGGGGCTGTGACCCCACGG - Intronic
1168828936 20:833831-833853 CACGCGGGGCTGGGGCCTCCTGG + Exonic
1169462398 20:5807057-5807079 CCTGCAGGGCTTTGCCCTCCTGG + Intronic
1170602151 20:17849284-17849306 CGTGCTGGGCTTTGACCTGCTGG + Intergenic
1171085249 20:22232638-22232660 CCGGCGGGGCTGTGGCATCCTGG - Intergenic
1171346789 20:24471182-24471204 CGTGCTAGGCTGCGACCTCAAGG + Intronic
1175101087 20:56579299-56579321 TGAGCGGGGCTGTGTGCTCCAGG + Intergenic
1175310139 20:58006158-58006180 TCGGCGGGGCTGTGAGCTCCTGG + Intergenic
1176055930 20:63149074-63149096 AGTGCCAGGCTGTGACTTCCCGG - Intergenic
1176546875 21:8206042-8206064 CGCGCGGGGCTCTGGCCTACCGG + Intergenic
1176554780 21:8250251-8250273 CGCGCGGGGCTCTGGCCTACCGG + Intergenic
1176565826 21:8389089-8389111 CGCGCGGGGCTCTGGCCTACCGG + Intergenic
1176573701 21:8433276-8433298 CGCGCGGGGCTCTGGCCTACCGG + Intergenic
1180048025 21:45318657-45318679 GGGTCGGGGCTGTGACCTCCAGG - Intergenic
1180089355 21:45525828-45525850 CGTGCGGGGCCTGGGCCTCCCGG - Exonic
1180782530 22:18529142-18529164 TGAGCGGGGCCGTGACCACCTGG + Intronic
1181036913 22:20174168-20174190 CCTGTGGGGCTGTGTCCACCCGG + Intergenic
1181126082 22:20703171-20703193 TGAGCGGGGCCGTGACCACCTGG + Intergenic
1181181653 22:21072884-21072906 CATGGGGGGCTGTGACCCCATGG - Intergenic
1181474637 22:23160718-23160740 TGGGTGGGGCTGTGCCCTCCTGG + Intronic
1181495727 22:23286470-23286492 CTTGTGGGACTGTGACCTCCAGG + Intronic
1181512849 22:23396478-23396500 TGTTCGGGGCTGAGACATCCTGG - Intergenic
1181629730 22:24144363-24144385 AGAGCAGGGCTGAGACCTCCTGG + Intronic
1184228235 22:43143039-43143061 CGTGCTGGGCTACGACCTGCTGG - Exonic
1184358282 22:43997022-43997044 CTTGCTGGGCTGCGTCCTCCTGG + Intronic
1184415801 22:44351090-44351112 CGTGCGAGGCTGAGACCTTTGGG - Intergenic
1185322547 22:50208710-50208732 CGTGCGGCCCACTGACCTCCCGG - Exonic
1203251750 22_KI270733v1_random:122327-122349 CGCGCGGGGCTCTGGCCTACCGG + Intergenic
1203259800 22_KI270733v1_random:167409-167431 CGCGCGGGGCTCTGGCCTACCGG + Intergenic
949889802 3:8725372-8725394 AGTCTGGGGCTGTGACCTCATGG - Intronic
961106635 3:124248354-124248376 TGTCCGGGGCTGTGACCACAGGG + Intronic
968462513 4:732430-732452 CCTGCGGGGCTGTGAGGTTCGGG - Intronic
968582371 4:1401065-1401087 CCTGTGGGGCTGTGAGCTCCTGG + Intergenic
968632890 4:1661309-1661331 GGCGCCGGGCTGTGACCTCCGGG - Intronic
968911468 4:3478784-3478806 CCTGCTGGGCTGTATCCTCCTGG + Intronic
980740731 4:136946848-136946870 GGTGTGGGGCTGTCACTTCCAGG + Intergenic
981752863 4:148109286-148109308 CATGCTGCCCTGTGACCTCCAGG + Intronic
982136724 4:152279636-152279658 CCTGGGGGGCTGTGTCCTCAGGG - Intergenic
985628905 5:1004889-1004911 GGCGCGGGGCTCTGTCCTCCCGG - Intergenic
985791411 5:1930550-1930572 AGGGCGGGGCTGGGAGCTCCTGG + Intergenic
986785618 5:11111534-11111556 AGTGAGGGGCTGTGATCACCTGG + Intronic
992997475 5:82347360-82347382 CCTGCCGTGCTGTGAACTCCAGG + Intronic
993945329 5:94111476-94111498 TTTGCGGGGATGTGAGCTCCGGG - Intronic
997186154 5:131884176-131884198 GGAGCGGGGATGTGACCTACTGG + Intronic
999195466 5:149778678-149778700 CGTGAAGGGCTGTGACTTGCAGG - Intronic
1000345769 5:160312378-160312400 CGTGGGGGGCTGCGAGCGCCGGG + Exonic
1002896743 6:1384048-1384070 CGGGCTGGGTTGGGACCTCCAGG + Intergenic
1003098097 6:3157608-3157630 CGGGCGGGGCTGTGGCCGCGGGG + Intergenic
1003343430 6:5243284-5243306 CGTGCGGGGTTCTAACCTGCTGG + Intronic
1005848582 6:29801622-29801644 CGTGAGGGGCCCTGACCCCCAGG - Intergenic
1006831825 6:36972738-36972760 CTTGTGGGGCTGTAACCTGCTGG - Exonic
1007629167 6:43263244-43263266 CGTGGGGGGCTGTGACGTCTCGG - Exonic
1007654731 6:43445314-43445336 GGTGAGGGGCTGGGACCTCGGGG + Exonic
1013538749 6:111087510-111087532 GGTGCGGGGCTGTGACCTAGAGG + Intronic
1018904175 6:168065452-168065474 CGTGCTGGGCGGTGAGCTCTGGG - Intronic
1021716830 7:23469235-23469257 GGCGCGGGGCTGCGGCCTCCGGG - Intronic
1025161455 7:56664838-56664860 CCTGCTGGGCTCTGCCCTCCTGG + Intergenic
1025606807 7:63045215-63045237 CGAGCTGGGCTATGAGCTCCTGG - Intergenic
1026434227 7:70380497-70380519 CGTCCGTGGCTGTGATCTCAGGG + Intronic
1033227149 7:139571282-139571304 CGGGCGAGGCTGAGAGCTCCAGG + Exonic
1034536150 7:151727293-151727315 TGTGGGGGACTGGGACCTCCAGG + Intronic
1035024987 7:155819353-155819375 CGTGCAGGGCTCTGGGCTCCAGG + Intergenic
1035310469 7:157964653-157964675 CGTGTGGAGCTGTGACCACCAGG + Intronic
1037613391 8:20495477-20495499 CTCCTGGGGCTGTGACCTCCTGG + Intergenic
1047247297 8:123156890-123156912 CGTCCTGGACTGTGACCACCCGG + Intergenic
1048005881 8:130419075-130419097 CGTGCGGGACCCTGGCCTCCAGG - Intronic
1048531546 8:135254480-135254502 CATGCGAGACTGTGAGCTCCAGG + Intergenic
1049612395 8:143561642-143561664 TGAGCGGGGCTGTGACGGCCTGG + Intronic
1060793735 9:126501635-126501657 GGTGCTGGGCTGTGACTTGCTGG + Intronic
1061801303 9:133114746-133114768 CGTGCTTGGCTGTGTCCTCAAGG + Intronic
1062180060 9:135186499-135186521 CGTGCAGGGCAGGGTCCTCCAGG - Intergenic
1203468152 Un_GL000220v1:105478-105500 CGCGCGGGGCTCTGGCCTACCGG + Intergenic
1203475973 Un_GL000220v1:149450-149472 CGCGCGGGGCTCTGGCCTACCGG + Intergenic