ID: 1077315999

View in Genome Browser
Species Human (GRCh38)
Location 11:1919625-1919647
Sequence TTGGCCAGTGACTGGGTGGC CGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 280
Summary {0: 1, 1: 0, 2: 4, 3: 29, 4: 246}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1077315999_1077316008 16 Left 1077315999 11:1919625-1919647 CCGGCCACCCAGTCACTGGCCAA 0: 1
1: 0
2: 4
3: 29
4: 246
Right 1077316008 11:1919664-1919686 TCAAATGTCACTATAACACGAGG 0: 1
1: 0
2: 0
3: 5
4: 81
1077315999_1077316009 17 Left 1077315999 11:1919625-1919647 CCGGCCACCCAGTCACTGGCCAA 0: 1
1: 0
2: 4
3: 29
4: 246
Right 1077316009 11:1919665-1919687 CAAATGTCACTATAACACGAGGG 0: 1
1: 0
2: 0
3: 6
4: 90
1077315999_1077316010 27 Left 1077315999 11:1919625-1919647 CCGGCCACCCAGTCACTGGCCAA 0: 1
1: 0
2: 4
3: 29
4: 246
Right 1077316010 11:1919675-1919697 TATAACACGAGGGTGTGAGCCGG 0: 1
1: 0
2: 0
3: 3
4: 61
1077315999_1077316011 28 Left 1077315999 11:1919625-1919647 CCGGCCACCCAGTCACTGGCCAA 0: 1
1: 0
2: 4
3: 29
4: 246
Right 1077316011 11:1919676-1919698 ATAACACGAGGGTGTGAGCCGGG 0: 1
1: 0
2: 1
3: 6
4: 86

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1077315999 Original CRISPR TTGGCCAGTGACTGGGTGGC CGG (reversed) Exonic
900237110 1:1598165-1598187 TTGGCCAGTGACCAGGAGTCAGG + Exonic
901177951 1:7318320-7318342 TTGGTCAGTGACTGGTTGGCTGG + Intronic
901816277 1:11795179-11795201 CTGGCCAGTGGCTTGGTGCCAGG - Exonic
901839919 1:11947759-11947781 TCGGTCAGTTACTGGGTGGAGGG + Intronic
902715543 1:18270207-18270229 TTGGAGAGTGAGTGGATGGCAGG - Intronic
903213401 1:21830726-21830748 TGGGGGAGTGCCTGGGTGGCGGG + Intronic
903607400 1:24584954-24584976 GTGCCCAGTGAGTGGGTGGGCGG + Intronic
903808576 1:26022161-26022183 TTGGCCAGGGACAGGCTGGAGGG - Exonic
904698091 1:32341758-32341780 TTGGTCACTGTCTGGATGGCAGG - Intergenic
905938102 1:41840740-41840762 TCGTCCAGTGACTGGCTGGCTGG - Intronic
906108095 1:43306635-43306657 TTGGTGATTTACTGGGTGGCTGG + Intronic
907337463 1:53709800-53709822 CTGCTCAGTGACTGGGTGGGTGG + Intronic
907389946 1:54151646-54151668 TCTGCCAGTGACTGGGTGACTGG + Intronic
908081909 1:60589925-60589947 TTGACCACTGACTGTGTGCCAGG - Intergenic
908226357 1:62059921-62059943 TGGGCAGCTGACTGGGTGGCTGG + Intronic
908918538 1:69161992-69162014 TTGGCATGTGACTGGGTAGCAGG + Intergenic
909494140 1:76259469-76259491 TTGCACATTGACTGGGTGCCAGG - Intronic
910430261 1:87153076-87153098 TGGGCCAGCGTTTGGGTGGCAGG + Intronic
910803957 1:91171972-91171994 TTGGCCCGTGACTGTGAGTCTGG - Intergenic
911366870 1:96949267-96949289 TTGGCCACTCACTGGGTGTGAGG - Intergenic
915562713 1:156696738-156696760 TTGGTCACTGAGTGGCTGGCGGG - Intergenic
916586124 1:166152086-166152108 CTGGCCAGTGCCTGGGCTGCTGG - Intronic
916808103 1:168279946-168279968 ATGGCGAGTGAGTGGATGGCGGG - Intergenic
920213333 1:204344820-204344842 TCAGCCAGTGACTGGGAAGCAGG + Intronic
923986438 1:239387240-239387262 CTGCCCAGCGCCTGGGTGGCGGG - Intronic
1068964001 10:62893523-62893545 TTAGACAGTGGCTGGGTGGAGGG + Intronic
1069515097 10:69070948-69070970 CTGGGCACTGACTGTGTGGCTGG + Intergenic
1069735591 10:70652040-70652062 GGAGTCAGTGACTGGGTGGCAGG - Intergenic
1069824456 10:71246552-71246574 TTGGTGAGTGACTGGGTTGAGGG + Intronic
1070912792 10:80132820-80132842 TTGGCCGGTGAGTGGGGCGCAGG + Exonic
1071672228 10:87619300-87619322 TTGGCAGGTGCCTGGGTGCCTGG - Intergenic
1072759171 10:98041733-98041755 ATGGCCACTGACTGTGTGCCAGG + Intergenic
1075440566 10:122476583-122476605 ACGGCCAGTCGCTGGGTGGCAGG - Intronic
1077315999 11:1919625-1919647 TTGGCCAGTGACTGGGTGGCCGG - Exonic
1078148717 11:8740815-8740837 TGGGGCAGTCACTGAGTGGCAGG - Intronic
1078611061 11:12819987-12820009 GTGGGCAGAGACTGGGTGGTTGG + Intronic
1078855652 11:15204696-15204718 ATGCCCGGTGAGTGGGTGGCTGG - Intronic
1079211617 11:18465917-18465939 TTGCTCAGTACCTGGGTGGCAGG - Intronic
1080298719 11:30759680-30759702 TTGGCCACTGATTAGGTGACTGG + Intergenic
1080383265 11:31795925-31795947 TTGGCCAGAGGCGGGGTGGAGGG + Intronic
1080663527 11:34316147-34316169 TTGCCCAGGGACGGGGTGTCTGG - Intronic
1080746999 11:35116971-35116993 AGGGCCAGTGCCTGGGAGGCTGG + Intergenic
1081311963 11:41585365-41585387 TTTCCCAGTGATTGGATGGCTGG + Intergenic
1081549241 11:44096377-44096399 TAGGCCGGGGACTGGGTGACCGG + Intronic
1081549258 11:44096423-44096445 TAGGCCGGGGACTGGGTGGCCGG + Intronic
1081549268 11:44096454-44096476 TGGGCCAGGCACTAGGTGGCTGG + Intronic
1081549280 11:44096485-44096507 TAGGCAGGGGACTGGGTGGCCGG + Intronic
1082866424 11:57903763-57903785 TGGGCCAGGGGCTGGGTGACTGG + Intergenic
1084536821 11:69762291-69762313 TGGGTCACTGACTGGATGGCTGG + Intergenic
1085200671 11:74699910-74699932 TTTGCTAGTGACAGGATGGCAGG + Intronic
1085608305 11:77922842-77922864 TTTTCCAGTGACTGGTTTGCTGG + Intronic
1086486071 11:87303351-87303373 TTTTCCACTGACTGGGTGGCTGG - Intronic
1088526723 11:110763743-110763765 TTGGCCAGTGACTGGCTGCCAGG - Intergenic
1088858648 11:113779732-113779754 TGGGTCAGTGACTGGTTAGCAGG - Exonic
1089894410 11:121914724-121914746 TTGGCCAGTCACTGGCTCCCAGG - Intergenic
1090475882 11:127019506-127019528 TTTGCCAGTGTGTGAGTGGCAGG + Intergenic
1092885740 12:12923112-12923134 TTGGCCAGGGCCTTGGGGGCGGG - Intergenic
1096875945 12:54630685-54630707 TTGGCCAGTCACAGGCTGCCTGG - Intergenic
1097188390 12:57208065-57208087 ATCGCCATCGACTGGGTGGCCGG + Exonic
1099804309 12:87498632-87498654 TCAGCCAGCTACTGGGTGGCAGG - Intergenic
1100619154 12:96255157-96255179 TTGGTGACTGACTGGGTGGGAGG + Intronic
1101175970 12:102151847-102151869 TTGGACAGTGAGTTGGTGCCAGG - Intronic
1101504037 12:105330607-105330629 TTGGCCAGTGCCGAGGTTGCTGG + Intronic
1102214104 12:111147906-111147928 TAGGCCAATGACTGGGCGCCTGG - Intronic
1102574597 12:113848382-113848404 GTGCCCACTGCCTGGGTGGCTGG + Intronic
1104639244 12:130456963-130456985 TTGGCCAGTAGCCAGGTGGCAGG - Intronic
1104979957 12:132569346-132569368 TTGGGCAGGGACTGGGTGGGAGG - Intronic
1105589056 13:21774451-21774473 TTGGAAAGTGAGTGGGTGGTGGG - Intergenic
1106714965 13:32378230-32378252 TTGTCCAGTTACAGAGTGGCTGG - Intronic
1108609679 13:52071772-52071794 GTGGCCACTGCATGGGTGGCAGG + Intronic
1109443987 13:62408729-62408751 GTTGCCAGGGGCTGGGTGGCGGG + Intergenic
1110377267 13:74807307-74807329 TTGGGCAATGACAGGGTGGCTGG - Intergenic
1110436481 13:75482157-75482179 TGGGGCAGACACTGGGTGGCTGG + Intergenic
1110834037 13:80063834-80063856 TTGGGCAATGACGGGTTGGCTGG + Intergenic
1111246932 13:85552122-85552144 GTGGCCTGTGACTGGGTGTGAGG + Intergenic
1111381840 13:87464834-87464856 TTGGCCAATGGGTGGGTGGGTGG + Intergenic
1111441018 13:88282732-88282754 TTAGCCAGCTACTTGGTGGCAGG + Intergenic
1112249823 13:97769484-97769506 GTGGTCAATGACAGGGTGGCTGG + Intergenic
1113991254 14:16029698-16029720 TAGGCCAGTGACGGTGTGGCGGG + Intergenic
1114046500 14:18880742-18880764 TTGGCCGGTGATTGGGGCGCGGG + Intergenic
1114117712 14:19638708-19638730 TTGGCCGGTGATTGGGGCGCGGG - Intergenic
1115475277 14:33807527-33807549 TCTGCCAGTGACATGGTGGCAGG + Intergenic
1117612036 14:57493880-57493902 TTGGCCACTTCCTGGGAGGCTGG + Intergenic
1121487677 14:94331167-94331189 GTGGCCAGTGTGGGGGTGGCAGG + Intergenic
1122422572 14:101586868-101586890 CTGGCATGTGACGGGGTGGCGGG - Intergenic
1122613662 14:103002253-103002275 CTGGCCCGTGACTGCGGGGCCGG - Intronic
1122789672 14:104178961-104178983 TTGGGCAGTGGGTGGGTGGCTGG + Intronic
1124632219 15:31344438-31344460 TTGGCAAATGTCTGGGTGGCTGG - Intronic
1125062187 15:35437741-35437763 TTTGCCACTGACTGGTTTGCTGG - Intronic
1125892631 15:43277637-43277659 GTGGCCTGTGAGTGGGAGGCAGG + Intronic
1128241013 15:66100977-66100999 TGAGCCAGTGAGTGGGTGGTGGG + Intronic
1128475384 15:67992912-67992934 TTGCCCAGTGAGTCAGTGGCAGG + Intergenic
1129227654 15:74179341-74179363 TGGGCCAGACACTGGGTGGAAGG - Intergenic
1132114529 15:99125844-99125866 TTCGCGAGTGACTGGCTGACAGG + Intronic
1132396607 15:101479518-101479540 GTGGCCATGGGCTGGGTGGCAGG + Intronic
1132662288 16:1066811-1066833 GTGGGGAGTGACTGGGTAGCAGG + Intergenic
1133634830 16:7654990-7655012 CTGGCCAGTGACTGGCTTTCTGG + Intronic
1135991922 16:27223592-27223614 TTGGACACTGAATTGGTGGCTGG - Intergenic
1136424793 16:30162532-30162554 TTGGGCAGTGACTGTGGGTCAGG + Intergenic
1137410988 16:48227938-48227960 TTGTCCAGGGGCTGGGGGGCAGG + Exonic
1138600228 16:58049657-58049679 ATGGTCAGTGTCTGGGTGCCTGG - Intergenic
1139365258 16:66428693-66428715 TTGGCCACTGGCTGCGTGCCAGG - Intronic
1139430583 16:66909047-66909069 TTGCACATTGACTGTGTGGCAGG - Intronic
1139632223 16:68237606-68237628 TGGGCCAGTGCCCGGGTGGGCGG - Intronic
1140249979 16:73287320-73287342 TGGGCCAGTGTGTGGGTGGTGGG + Intergenic
1140249995 16:73287375-73287397 TGGGCCAGTGTGTGGGTGGTGGG + Intergenic
1140250010 16:73287430-73287452 TGGGCCAGTGTGTGGGTGGTGGG + Intergenic
1140894489 16:79313177-79313199 TTGCCCAGTGCCTGTGTGCCAGG - Intergenic
1142190817 16:88716522-88716544 TGGGGCAGTGCCTGGGTGGGTGG - Intronic
1143474581 17:7195415-7195437 GGAGCCAGTGTCTGGGTGGCTGG + Intronic
1144374793 17:14628261-14628283 ATGGCCAGTGACCCGGTGTCAGG - Intergenic
1144720513 17:17466395-17466417 TTGGCCAGTGACTGGTCTACAGG - Intergenic
1146593200 17:34146609-34146631 GTGGCCAGTGACTGACTGACAGG - Intronic
1147386304 17:40084322-40084344 TTGGCTGGGGATTGGGTGGCAGG + Intronic
1147918272 17:43901205-43901227 TTGGTCAGCCACTGGGAGGCAGG + Intronic
1148107159 17:45124821-45124843 CGGGCCAGTGACTGAGTGGGTGG + Intronic
1148341395 17:46875536-46875558 CTGGGCTGTGACTGGGTGCCAGG + Intronic
1150151030 17:62808784-62808806 TCTGCCACTGACTGGGTGCCTGG - Intergenic
1150458243 17:65325620-65325642 TTGGCCAGGGATAGGGTGGAGGG + Intergenic
1150849658 17:68692634-68692656 TTGGCCAGGGATTGGGTAGATGG + Intergenic
1151226909 17:72654720-72654742 TTTGCCAGGCACTTGGTGGCTGG + Intronic
1151459257 17:74245080-74245102 TCGTCCAGTGACTTGGGGGCTGG + Intronic
1151729030 17:75900146-75900168 GGGGACAGTGACTGGGAGGCTGG - Intronic
1152036984 17:77879669-77879691 CAGGCCAGGGGCTGGGTGGCAGG + Intergenic
1153451889 18:5238700-5238722 CTGGGCAGTGACCGGGTTGCTGG - Intergenic
1154334038 18:13452006-13452028 TTAGGCAGTGTCAGGGTGGCAGG + Intronic
1155907714 18:31472301-31472323 TTGACCTGTGACTGTGGGGCAGG + Exonic
1156364620 18:36414546-36414568 TGGACAAGTGGCTGGGTGGCTGG - Intronic
1157804081 18:50645059-50645081 CAGGCCAGGGAGTGGGTGGCTGG + Intronic
1158854090 18:61525076-61525098 TTTGCCAGGGGCTGGGTGGGAGG + Intronic
1160092588 18:75841002-75841024 TTGGCCAGCTACTTGGTGGCAGG + Intergenic
1161809676 19:6464687-6464709 TTCGCCATGGGCTGGGTGGCGGG - Exonic
1161956607 19:7499428-7499450 ATGGCCAGTGGCTGGGGTGCAGG + Intronic
1162042893 19:7980995-7981017 TTGGAGAGTGACTGTGAGGCTGG + Intronic
1162173661 19:8813064-8813086 CTGGCCAGTGACTTGGGGGTTGG - Intronic
1162332482 19:10038832-10038854 TTGGGCAGTGGCGGGGTGGGGGG - Intergenic
1163155821 19:15439461-15439483 CTGGCTAGTGCCTGGCTGGCTGG + Intronic
1164096991 19:22020559-22020581 TTGGGCAATGACGGGGTGGCTGG + Intergenic
1165583717 19:36893706-36893728 TTGGCCAATGATTGTGTGGAGGG - Intronic
1165995036 19:39838011-39838033 TTGGCCAGTGACTTTATGTCTGG - Intronic
1166390797 19:42407781-42407803 TTGGCCAGAGACTGGAGGGAGGG + Exonic
1167254416 19:48418697-48418719 TGGGCCTGTGACTGGGTGGATGG + Intronic
927935731 2:27075284-27075306 TTGGGCAGTGACAAGATGGCTGG + Intergenic
927956283 2:27209755-27209777 TTGGGCAGACACTGGCTGGCTGG + Intronic
928317982 2:30260522-30260544 TTAGCCAGGTACTAGGTGGCAGG + Intronic
930295110 2:49544590-49544612 CTGGGCAATGACGGGGTGGCTGG + Intergenic
931070070 2:58636907-58636929 TAGGTCAGGGACTGGGTTGCAGG + Intergenic
932416082 2:71574660-71574682 CTGGCCTGTGCCTGGCTGGCTGG + Intronic
934612776 2:95753246-95753268 TTTGCAAGTGGGTGGGTGGCTGG + Intergenic
934648134 2:96071177-96071199 TTTGCAAGTGGGTGGGTGGCTGG - Intergenic
934841513 2:97627007-97627029 TTTGCAAGTGGGTGGGTGGCTGG - Intergenic
934884752 2:98014576-98014598 TGGGCTAGTGACTGGTGGGCTGG - Intergenic
935432755 2:102993911-102993933 TGAGCCAGTCAGTGGGTGGCAGG - Intergenic
937087540 2:119181377-119181399 TTGGCCAGTGCCCAGGAGGCTGG - Intergenic
937765739 2:125658785-125658807 CTGGGCAATGACGGGGTGGCTGG - Intergenic
937785093 2:125886935-125886957 TTGGGCGATGACAGGGTGGCTGG + Intergenic
938048633 2:128146767-128146789 TTTGCCAATGGCAGGGTGGCTGG - Intronic
938179871 2:129170736-129170758 TGGGCAAGTGCCTGGGAGGCCGG + Intergenic
938266861 2:129934163-129934185 TTGGCCGGTGAGTGGGGCGCGGG - Intergenic
939069224 2:137518875-137518897 TCGGCCAGCTACTTGGTGGCAGG + Intronic
939715242 2:145575702-145575724 TTGGCCAGTGACTCTGTTTCTGG - Intergenic
940693553 2:156950637-156950659 ATGGTCAGTGACTGGGTGATGGG - Intergenic
941020129 2:160398843-160398865 TTGGCTGGTGACTGGCTGGATGG - Intronic
941441830 2:165547412-165547434 TTGGCAAGGGACTGGGAAGCAGG - Intronic
946347129 2:219119580-219119602 TGGGCCAGGGGCAGGGTGGCGGG - Intronic
947397125 2:229697328-229697350 GTTGCCAGTGACTGGGAGGAGGG + Intronic
1169292228 20:4362426-4362448 TTTGCCAGTTATTGGGGGGCAGG - Intergenic
1169889567 20:10437568-10437590 TTGACCAGTTACTGGGAAGCTGG - Intronic
1172313583 20:33936338-33936360 TGTGCCAGCGTCTGGGTGGCGGG + Intergenic
1173901713 20:46595411-46595433 GTCAGCAGTGACTGGGTGGCCGG - Intronic
1175522036 20:59608245-59608267 GTGGCCATGGACTGTGTGGCGGG + Intronic
1175689393 20:61054660-61054682 TTTGGCAGTGATTGGGTGCCTGG - Intergenic
1176649441 21:9531370-9531392 TAGGCTGGTGACTGGGTGTCAGG - Intergenic
1178500721 21:33123691-33123713 TTTGTCAGTGGCTGGGTGGAGGG - Intergenic
1180316014 22:11277826-11277848 TAGGCCAGTGACGGTGTGGCGGG - Intergenic
1180465036 22:15603378-15603400 TTGGCCGGTGATTGGGGCGCGGG + Intergenic
1181509729 22:23383789-23383811 TTGGCCAGCAAGTGGGGGGCAGG - Intergenic
1181855647 22:25779890-25779912 TTGGGCAGGGAGTGGGTGGCAGG + Intronic
1183542418 22:38437171-38437193 TTGGCCAGCGAATGTGGGGCGGG + Intronic
1184109754 22:42387802-42387824 GTGGTCAGAGAGTGGGTGGCAGG - Intronic
1184412367 22:44332494-44332516 CTGGCCAGGGTCTGGCTGGCAGG - Intergenic
1184979266 22:48084596-48084618 TTGGAGAGCGACTGGTTGGCTGG + Intergenic
952343000 3:32460641-32460663 TTGCCCAGTGAGGTGGTGGCGGG - Intronic
954081934 3:48217560-48217582 GTGGCCAGAGACTGTGTGCCAGG - Intergenic
955102530 3:55865050-55865072 TTGGCCTGTGACGTGGTTGCAGG - Intronic
955348771 3:58179398-58179420 TTGGACAGTGTCTGGCTGGGAGG - Intergenic
955707980 3:61748250-61748272 TTGTCCTGTGTTTGGGTGGCTGG + Intronic
956074649 3:65491757-65491779 TTGGGATGTGACTGGGTGGCTGG - Intronic
963015504 3:140820553-140820575 TCAGCCATTGACTGGGTGGTGGG + Intergenic
964747629 3:160026927-160026949 TTGGTCAGTGACTGGCTTACAGG - Intronic
966780522 3:183580210-183580232 TGGGCCACGGAGTGGGTGGCAGG - Intergenic
967831892 3:193926781-193926803 TTGGGCGATGACGGGGTGGCTGG - Intergenic
967889513 3:194355089-194355111 TTGGAAAGTGAGTGGGAGGCCGG - Intergenic
968978773 4:3835569-3835591 CTGGCCAGAGCCTGGCTGGCAGG + Intergenic
969297618 4:6279092-6279114 GTGACCAGTGACTGGGAGACGGG - Intronic
969630699 4:8334246-8334268 TTGGGCAGTGACTGGCTAGAAGG + Intergenic
970667003 4:18348196-18348218 TTGACCGGTAACTGGGGGGCAGG - Intergenic
971817329 4:31505865-31505887 TTGGGCTGTGACAGGGTGGCTGG - Intergenic
972396006 4:38660492-38660514 TTTGCCAGTGACTGGTTGGAGGG - Intergenic
972922465 4:43960641-43960663 TTGGTCAGTGAGTAGGTGGGGGG + Intergenic
972944351 4:44236129-44236151 TTGGGCAGTGGCTGAGTTGCTGG - Intronic
975386616 4:73766720-73766742 TTGGGCAATGACAGGGTGGCTGG + Intergenic
987964647 5:24855748-24855770 TAGGCCAGTGAGTGGGTGGCGGG - Intergenic
988739144 5:34052699-34052721 TTTGACAGTGAGTGGGTGCCAGG - Intronic
991013691 5:61910095-61910117 TTGGGCAACGACGGGGTGGCTGG + Intergenic
993500505 5:88661022-88661044 TTGGCGCGCGACTGGGAGGCCGG - Intergenic
993666014 5:90697077-90697099 TTGGCCAATGACAATGTGGCAGG + Exonic
994291266 5:98031161-98031183 TTGGGCGATGACGGGGTGGCTGG + Intergenic
998481769 5:142468872-142468894 TTTGCCAGGGGCTGGGTGGGGGG + Intergenic
999324803 5:150637260-150637282 TTGGCCAGTGAGTGGATTGTGGG - Intronic
999451162 5:151679338-151679360 TGAGTGAGTGACTGGGTGGCAGG + Intronic
1001281141 5:170387287-170387309 TTAGCCAGTGTCCGGGTGACAGG + Intronic
1006079468 6:31557007-31557029 TTGGGCACTGCCTTGGTGGCTGG + Intronic
1007041689 6:38727849-38727871 TTTTCCAGTGACTGGGTGGCAGG + Intronic
1007890718 6:45287591-45287613 TTTGCCAGGGACTGGGAGGATGG + Intronic
1008765293 6:54905254-54905276 TTTACTACTGACTGGGTGGCAGG + Intronic
1011552483 6:88542529-88542551 TTAGCCATTGTCTGGGTGGCTGG - Intergenic
1011806938 6:91082498-91082520 GTGGGCTGTGACTGGGAGGCAGG + Intergenic
1011926010 6:92645559-92645581 ATGCCCAGTAACTGGATGGCTGG - Intergenic
1013033630 6:106360384-106360406 TTGGCCTGTGACAGGCTGGCAGG - Intergenic
1014145485 6:117993478-117993500 TTGAGCAGTTACTGTGTGGCAGG + Intronic
1017005887 6:150027776-150027798 TGGGCCAGTGACCGGGGGACTGG + Intergenic
1018178167 6:161196919-161196941 TTGGGCACTTACTGGGTGCCCGG + Intronic
1019919927 7:4157092-4157114 CCAGCCAGTGACTGGGTTGCAGG + Intronic
1020822514 7:12988327-12988349 ATGGCCCGAGACTGGGAGGCTGG - Intergenic
1021645037 7:22781707-22781729 TTGGCCAGTGCCTGGATGGAAGG - Intergenic
1022539808 7:31125137-31125159 TTTTCCAGGGACTGGGTGGCAGG + Intergenic
1024049929 7:45612378-45612400 CTGGCCAGTGAGTGGCAGGCTGG + Intronic
1024866202 7:53907138-53907160 TTGGGCAATGACGGGGTGGCTGG - Intergenic
1025844594 7:65184997-65185019 TTTTCCAGTGACTGGTTTGCTGG - Intergenic
1025894922 7:65691335-65691357 TTTTCCAGTGACTGGTTTGCTGG - Intergenic
1026980988 7:74526458-74526480 TGGGCCAGTGACAGTGTGGGTGG + Intronic
1031009608 7:116512274-116512296 GTGACAAGTGACTGGGAGGCAGG - Intergenic
1032488353 7:132305438-132305460 CGGGCCAGGGACTGAGTGGCTGG - Intronic
1032590347 7:133186563-133186585 TTAGCCATTGACTGGTTGTCTGG - Intergenic
1033084331 7:138328420-138328442 TTGCCCAGGGCCTGGGTGCCAGG + Intergenic
1033282609 7:140016840-140016862 TTTCCCAGTGACTGGGTCGTAGG - Intronic
1034355915 7:150450763-150450785 TTGGCCAGGGGCTGGGGCGCCGG - Exonic
1035691008 8:1559811-1559833 GTGCCCAGGAACTGGGTGGCCGG + Intronic
1037589917 8:20303867-20303889 TCGGCCAGTGAGTGGGAGCCGGG - Exonic
1037728411 8:21503349-21503371 TTGGCCAGTGACAGTGGGGATGG + Intergenic
1038260399 8:25988103-25988125 TTGGCCACTCACTGGATAGCAGG + Intronic
1041751195 8:61262742-61262764 GTGCACAGTGACAGGGTGGCAGG + Intronic
1041773966 8:61503837-61503859 ATGGGCAGTGACTGGGTCTCAGG + Intronic
1045216594 8:100155513-100155535 TTGGCCAGTCATTGAGGGGCAGG - Intergenic
1047426469 8:124751215-124751237 TTAGACAGTGAAAGGGTGGCCGG - Intergenic
1048960569 8:139573465-139573487 TAGGCCAGTGATTAGGTGGTGGG - Intergenic
1049588340 8:143442058-143442080 CTGGCAAGGGACTGTGTGGCTGG - Intronic
1050457293 9:5846302-5846324 TGGGCCACTGGGTGGGTGGCGGG - Intergenic
1050535451 9:6626810-6626832 ATGACCAGTGCCTGAGTGGCAGG - Intronic
1051233379 9:14975335-14975357 TTGGCCAGTGACTTGGTCTCTGG - Intergenic
1051243989 9:15090762-15090784 TTGGGCAGTGACTTGGTTGCTGG - Intergenic
1051339655 9:16099897-16099919 ATGGCCAGTGAGAGGGTGGGTGG - Intergenic
1052528235 9:29649522-29649544 TTGGCCTGTGACTTGGGGGCAGG + Intergenic
1052912676 9:33897725-33897747 TTGGGCAGTGAATGCGTGGGAGG - Intronic
1053607469 9:39675507-39675529 TTGGCCTTTGACTGTGGGGCAGG - Intergenic
1053865320 9:42431865-42431887 TTGGCCTCTGACTGTGGGGCAGG - Intergenic
1054246066 9:62666902-62666924 TTGGCCTTTGACTGTGGGGCAGG + Intergenic
1054560188 9:66701435-66701457 TTGGCCTTTGACTGTGGGGCAGG + Intergenic
1055785634 9:79866308-79866330 TTGTGCTGTCACTGGGTGGCTGG - Intergenic
1056430878 9:86526705-86526727 TTGGACAGTGACTTGAGGGCTGG + Intergenic
1057772667 9:97982789-97982811 TTGGCCCCAGACTGTGTGGCAGG + Intergenic
1060385763 9:123226755-123226777 TTGGGGAGTGAGGGGGTGGCGGG + Intronic
1060684326 9:125594525-125594547 TTGATCAGTGACTTTGTGGCAGG - Intronic
1061300398 9:129701354-129701376 TTGACCACTAACTGGGTGCCAGG + Intronic
1061512179 9:131068120-131068142 TTGGCCTGTCACTGGGTCGCAGG - Exonic
1061571838 9:131482586-131482608 GTGGCCAGGGCCTGGGTGGAAGG + Intronic
1062543646 9:137052448-137052470 TTGGCACATGACTGGGTGGGGGG - Intronic
1062649741 9:137569438-137569460 TGGGTGAGTGACTGGCTGGCTGG - Intronic
1203627182 Un_KI270750v1:34918-34940 TAGGCTGGTGACTGGGTGTCAGG - Intergenic
1187156439 X:16724452-16724474 TTGGCCACTGGCTGGGTGTCCGG - Intronic
1194265324 X:91746029-91746051 TGGGCGAGTGACTGGGAGGTGGG - Intergenic
1197746224 X:129933261-129933283 TTGGCATGTGGGTGGGTGGCTGG - Intergenic
1197892237 X:131279048-131279070 TTGGCCAGGGAGTGGCTGGTTGG - Intronic
1199981360 X:152922302-152922324 TTCCTCAGTGACTGAGTGGCAGG - Intronic
1200582475 Y:4966491-4966513 TGGGCGAGTGACTGGGAGGTGGG - Intergenic
1202281996 Y:23199191-23199213 CTGGCCAGTGCCTGGGTTCCAGG + Intergenic
1202283895 Y:23219328-23219350 CTGGCCAGTGCCTGGGTTCCAGG - Intergenic
1202433668 Y:24813576-24813598 CTGGCCAGTGCCTGGGTTCCAGG + Intergenic
1202435571 Y:24833714-24833736 CTGGCCAGTGCCTGGGTTCCAGG - Intergenic