ID: 1077316883

View in Genome Browser
Species Human (GRCh38)
Location 11:1923346-1923368
Sequence TGGTGGCTTTTGGGGGGCTC GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 341
Summary {0: 1, 1: 0, 2: 2, 3: 32, 4: 306}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1077316883_1077316896 18 Left 1077316883 11:1923346-1923368 CCCGAGCCCCCCAAAAGCCACCA 0: 1
1: 0
2: 2
3: 32
4: 306
Right 1077316896 11:1923387-1923409 CCTTCCCCAGCGCCTCCTCAGGG 0: 1
1: 0
2: 0
3: 51
4: 513
1077316883_1077316894 17 Left 1077316883 11:1923346-1923368 CCCGAGCCCCCCAAAAGCCACCA 0: 1
1: 0
2: 2
3: 32
4: 306
Right 1077316894 11:1923386-1923408 GCCTTCCCCAGCGCCTCCTCAGG 0: 1
1: 0
2: 2
3: 45
4: 322
1077316883_1077316900 25 Left 1077316883 11:1923346-1923368 CCCGAGCCCCCCAAAAGCCACCA 0: 1
1: 0
2: 2
3: 32
4: 306
Right 1077316900 11:1923394-1923416 CAGCGCCTCCTCAGGGCCCGAGG 0: 1
1: 1
2: 5
3: 24
4: 264

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1077316883 Original CRISPR TGGTGGCTTTTGGGGGGCTC GGG (reversed) Intronic
900370879 1:2331574-2331596 TGGTGGCCTTGGCTGGGCTCTGG + Intronic
900402197 1:2477160-2477182 TGGTGGCCTGTGGAGGGCCCCGG + Intronic
902612623 1:17606080-17606102 TGGTGGCTCTGGGGGAGCTTGGG - Intronic
902634461 1:17726057-17726079 TGGTGGCTGTTGGTGGGCCCTGG + Intergenic
902717485 1:18282501-18282523 TGATAGAGTTTGGGGGGCTCAGG + Intronic
903657967 1:24960524-24960546 TGTAGGCTTTAAGGGGGCTCTGG - Intronic
904287571 1:29462032-29462054 TGGTGGCTTTGTGGGTGCTGGGG + Intergenic
904377431 1:30090553-30090575 GGGTGGCTGTGGAGGGGCTCTGG + Intergenic
905290762 1:36920468-36920490 CGGTGGCTTCTGGGGGTCCCGGG - Intronic
906513450 1:46424384-46424406 TGGGGGATTTTGGAGTGCTCAGG - Intergenic
907010026 1:50954195-50954217 TGGTGGCCTTTGGGAGGCTGAGG - Intronic
907337530 1:53710165-53710187 GGGTGGTGTTTGGGGGGCTTGGG - Intronic
908970258 1:69820514-69820536 TGGGGTCTGTTGGGGGGCTAGGG - Intronic
909842070 1:80339387-80339409 TGGTGTCTTTTGGGGCATTCTGG + Intergenic
910663785 1:89702185-89702207 TGGTGGACTCTGGGGGGCTGGGG + Intronic
912768011 1:112433986-112434008 TGGTGGCCTTTGGGAGGCCAAGG - Intronic
914238787 1:145837056-145837078 TGGTGGACTTTGGGAGGCTGAGG + Intronic
915472409 1:156133888-156133910 GGGGTACTTTTGGGGGGCTCTGG - Intronic
915789669 1:158654655-158654677 TGGTGACTTCTCGGGGGCTGCGG + Exonic
916621644 1:166504295-166504317 TGGGGGCTGTTGGGGGGTTAGGG + Intergenic
917606678 1:176638406-176638428 TGGTGGGTTTTGTTGAGCTCCGG + Intronic
919419743 1:197355486-197355508 TGGGGGATTGCGGGGGGCTCAGG + Intronic
919667373 1:200304949-200304971 TGGTTGTTTTTGGGGGGCAAGGG - Intergenic
920534581 1:206729278-206729300 TGGTGGCTGTGGGGAGCCTCAGG + Intronic
920651484 1:207840550-207840572 TGGTGGCCTCTGTGGGGCCCAGG - Intergenic
923191520 1:231625410-231625432 TGGTGCCTTTTGGAGGGCGGAGG + Intronic
924296734 1:242594800-242594822 TGTGGGTTTTTGGGGGGCCCTGG + Intergenic
924381090 1:243465176-243465198 TGGTCTCTTTTGGGAGGGTCGGG + Intronic
1062944260 10:1448833-1448855 CGGTGGCTTCTGGGGGGGTATGG - Intronic
1063089523 10:2849894-2849916 TGGTGGCTTTTAGGGTCCTTGGG - Intergenic
1063122477 10:3114669-3114691 TGGTGGCTCATGGGGCCCTCAGG + Intronic
1063174038 10:3535692-3535714 TGGGGACATTTGGAGGGCTCAGG - Intergenic
1063546157 10:6984039-6984061 TGGGGCCTGTTGGGGGGCTGGGG - Intergenic
1065670165 10:28107724-28107746 TGGTTGGTTTGGGGGTGCTCAGG - Intronic
1066061050 10:31723972-31723994 AGGTGGCAGTTGGGGGGCACGGG - Intergenic
1067461512 10:46461802-46461824 TGGTGGCCTTTGCCGTGCTCTGG - Exonic
1067625682 10:47922799-47922821 TGGTGGCCTTTGCCGTGCTCTGG + Intergenic
1069768215 10:70879559-70879581 TGGTGTCTGCTGGGTGGCTCTGG - Exonic
1069911799 10:71764618-71764640 TAGCAGCTTTTGGGGGGCACCGG + Intronic
1075027292 10:118994677-118994699 TGGTGGCTTTAGGGCAGCTTTGG - Intergenic
1076593342 10:131607249-131607271 AGATGGCTTTTTGGGGGCTCTGG - Intergenic
1076778029 10:132709088-132709110 GAGTGGCTTTTCTGGGGCTCTGG + Intronic
1076983954 11:222354-222376 AGGTGGGTTTGGGGGAGCTCAGG - Intronic
1077156528 11:1094554-1094576 TGGTGGTTATTGGAGGGCTGGGG - Intergenic
1077164251 11:1127979-1128001 TCTGGGCTTTTGGGAGGCTCTGG + Intergenic
1077182357 11:1222515-1222537 GGGTGGCTTGTGGGGGTCCCTGG - Intergenic
1077316883 11:1923346-1923368 TGGTGGCTTTTGGGGGGCTCGGG - Intronic
1080157820 11:29133415-29133437 AGGTGGCTGTTGGAGGGCTTAGG + Intergenic
1080507398 11:32929360-32929382 CGGTCGCTTTTGGGAGGCTGAGG - Intronic
1080810110 11:35695599-35695621 TGGTGTCTTTTAGGAGGTTCAGG - Intronic
1081940795 11:46939735-46939757 TGGTTACTTTTGGGAGGCTGAGG - Intronic
1083046778 11:59743748-59743770 TGGTTGCATTTGGGAGACTCAGG + Intronic
1083271121 11:61573106-61573128 GGTTGGCTTTGGTGGGGCTCTGG + Intronic
1083671749 11:64303882-64303904 TGGTGGATTTTGCAGGGCTGGGG + Intronic
1084179294 11:67438552-67438574 TGGTGGGTTTGGGAGGGCTATGG - Intronic
1084574819 11:69982355-69982377 CGGTGACTTTTAGGGGGTTCTGG - Intergenic
1085480365 11:76817403-76817425 ATGTGGGTTTTGGGGGGCCCTGG - Intergenic
1088005533 11:104934705-104934727 TTGGGGCTTGTGAGGGGCTCAGG + Intergenic
1088440695 11:109867154-109867176 TGGAGGCCTTTGGAGGGCTTTGG + Intergenic
1089596661 11:119585009-119585031 TGGTGGCTGTGGGGGGCCTGCGG + Intergenic
1090125082 11:124076173-124076195 TGGTGGGCTTTGGGGGCCTGGGG + Intergenic
1090415090 11:126535068-126535090 TGGTGGCCTTTTGGGGGCTCTGG + Intronic
1091637505 12:2208603-2208625 GGGTGGCATTTGAGGGACTCAGG + Intronic
1092091829 12:5810079-5810101 TTGCGGCATTTTGGGGGCTCTGG - Intronic
1092262382 12:6959604-6959626 TGGTGGGATTTGGGGGTCCCAGG + Intronic
1093599847 12:21008661-21008683 TGGTGCCTGTTGGGGGGGTGGGG + Intergenic
1095277934 12:40311727-40311749 TGATGGCTTTTGCGGTGCCCAGG + Intronic
1096242349 12:49966187-49966209 ATGTGGCTTCTGGGGGGGTCGGG - Intergenic
1096321747 12:50620225-50620247 TTGTGGCTTTTAGGAGGCTTGGG + Intronic
1096798053 12:54090810-54090832 GGGCGGCTTTTGGGGGGCAGGGG + Intergenic
1097622864 12:61962895-61962917 TGTTGGCTGGTGGGGGGCTAGGG - Intronic
1098380076 12:69860105-69860127 TGGAGCCTGTTGGGGGGCCCAGG - Intronic
1098707495 12:73708879-73708901 TGTTGGCTGTTGGGGGGCATAGG + Intergenic
1099729739 12:86484861-86484883 TGGTGCTTTTTGGTGGGCTGGGG - Intronic
1101819532 12:108173248-108173270 TGGTGGCTGGTGGGAGGGTCTGG - Intronic
1102514309 12:113436134-113436156 TATTGGCTTTTGGGGGGTTTGGG - Intronic
1103791675 12:123476632-123476654 TGGTGGCTGCTGGGGGTCTTTGG - Intronic
1104588856 12:130068540-130068562 CGGGGGCTTCTGGGGAGCTCGGG - Intergenic
1104937980 12:132376710-132376732 TGGTGTCATGTGGGTGGCTCTGG - Intergenic
1105429105 13:20320995-20321017 TGTTGGGTTTTGCTGGGCTCAGG - Intergenic
1106416491 13:29550231-29550253 TGCTGGCTGGTGGGTGGCTCTGG - Intronic
1106559196 13:30833960-30833982 GGCTGGCTTTGGGGAGGCTCTGG + Intergenic
1107011292 13:35673665-35673687 TGGGGGGTTCTGGGGGGCGCTGG - Intergenic
1107873069 13:44764663-44764685 TGGTGGCTCTTGGGCGCCTGGGG - Intergenic
1108574053 13:51776760-51776782 GGGCGGCTTGTGGGGTGCTCAGG - Intronic
1109681095 13:65754330-65754352 GGATGGCTTTTAGTGGGCTCTGG + Intergenic
1110255057 13:73424181-73424203 TGATTACTTTTGGTGGGCTCTGG + Intergenic
1110684630 13:78357760-78357782 TGGTGGGTTTTGGTGGGTTTTGG - Intergenic
1113409828 13:110075255-110075277 TGGTGAGTGTTGGGGGGCTGAGG - Intergenic
1113955264 13:114097004-114097026 TGGTGGCTTTGGGGGTGATCTGG - Intronic
1117341374 14:54795134-54795156 TGGAGCCTTTAGGGTGGCTCTGG + Intergenic
1118709919 14:68510516-68510538 TGGGTCCTGTTGGGGGGCTCTGG + Intronic
1119240424 14:73054999-73055021 TCCTGGCTTTTGGGAGGCTGAGG + Intergenic
1119476759 14:74934931-74934953 TGGTGACTCTTGGGTGGCCCAGG + Intergenic
1119591033 14:75888156-75888178 TGGTGGCATTAGGAGGTCTCTGG + Intronic
1121071797 14:91030085-91030107 TGGAGCCTTTTGGGGTTCTCTGG - Intronic
1122396647 14:101437578-101437600 TGGTGGGTTCCGGTGGGCTCTGG + Intergenic
1125723552 15:41856731-41856753 TGGGGGCTTTTGGGATGCCCTGG - Intronic
1128021815 15:64398335-64398357 AGGTGGGTTTTGGGAGGCTGAGG + Intronic
1129356561 15:74995881-74995903 TGGGGGGGCTTGGGGGGCTCGGG - Intronic
1129465716 15:75723233-75723255 AGGAGGCTTTTGGGGGCCTGGGG - Intergenic
1129854817 15:78815863-78815885 TGGTGGCTTTTGGGAGGTTGAGG + Intronic
1132032481 15:98450170-98450192 GGGTGGCTCTTGGGGAGCTGTGG - Intronic
1132524249 16:406429-406451 GGGTGGCTGTGGGGGGGCTGGGG + Intronic
1132603089 16:782576-782598 TGATGGCTTTTGGGCACCTCTGG + Intronic
1133048407 16:3102187-3102209 TTGTGGCTTTGGGGCGGTTCTGG + Intergenic
1133446707 16:5867487-5867509 TGCTGGGTTTTGGGGTGCCCAGG + Intergenic
1134064572 16:11219587-11219609 TGGTGACTTCTGGGGGGCTGGGG - Intergenic
1134124932 16:11610067-11610089 TGATGGCTTTGGGGGGCCTCAGG + Intronic
1136034719 16:27530498-27530520 TGCTGCCTTTTGGGGGGATTTGG - Intronic
1136179125 16:28538863-28538885 TGGGGGCTGCTGGGGGGCGCTGG + Exonic
1136505369 16:30699231-30699253 TGTTGGCTTCTGGTGAGCTCGGG + Exonic
1137854082 16:51776063-51776085 TGGTGTTTTTTGGGAGGCTGAGG - Intergenic
1139366832 16:66438799-66438821 TGGTGGTTTGGGGGGGGCTCAGG - Intronic
1141769435 16:86080403-86080425 TGGTTCCTCTTGGGGGGCTCTGG - Intergenic
1142285855 16:89171316-89171338 TGATAGCTTTTGCGGGGTTCCGG - Intergenic
1142627980 17:1204075-1204097 TGGTGGCTTCTGCGGGGCCCAGG - Intronic
1142956286 17:3525009-3525031 TGGTGTTTTTTGGGGGGGTCAGG + Intronic
1143024993 17:3936306-3936328 TGAGGGCTTCTCGGGGGCTCCGG + Exonic
1143195253 17:5071412-5071434 TGGTGGTTTTTGGGAGGCTGAGG + Intergenic
1143739470 17:8941995-8942017 TGGGGGCTTCAGGGAGGCTCAGG + Intronic
1143865433 17:9919546-9919568 TGGTGGTTGTTGGTGGGCGCGGG - Intronic
1143967679 17:10768407-10768429 TGATTGCTTTGGTGGGGCTCTGG + Intergenic
1143969635 17:10786141-10786163 TGGTGGAGTGTGGGGAGCTCAGG - Intergenic
1144971205 17:19110999-19111021 TGGGGGTTTTTTGGGGGCTCGGG + Intergenic
1144991507 17:19237162-19237184 TGGGGGTTTTTTGGGGGCTCGGG + Intronic
1145761865 17:27429931-27429953 TGGGGGCTTCTGGGGAGCCCAGG + Intergenic
1146088211 17:29850071-29850093 TGGTGCCTGTTGGGGGACTTGGG - Intronic
1146639259 17:34527645-34527667 TGGTGGGTTTCGGGGGGGTTGGG + Intergenic
1147665226 17:42142812-42142834 TTGTGGCTGTTGGCGGGCTCAGG - Intronic
1147904852 17:43816182-43816204 TGGTGTCTCGTGGGGAGCTCAGG + Intronic
1149520116 17:57312380-57312402 TGGTGGTGTTTGAGAGGCTCCGG + Intronic
1151265717 17:72953553-72953575 TTGTTTCTTTTGGGGGGCTCTGG - Intronic
1152509868 17:80779313-80779335 TGGTGTCTTGTTGAGGGCTCTGG + Intronic
1152647808 17:81477818-81477840 TGGTGGCTGTGTGGGGGCACAGG + Intergenic
1152933766 17:83124294-83124316 TGGGGGCTTGTTGGGGGCACAGG + Intergenic
1153183935 18:2466272-2466294 AGGTGGCTCTTGTGTGGCTCTGG - Intergenic
1156016501 18:32552904-32552926 TGGTGGCTCTGCTGGGGCTCAGG - Intergenic
1160298420 18:77657957-77657979 CGGGGGCTTGTGGTGGGCTCTGG + Intergenic
1160506828 18:79432049-79432071 TGGGGGCCTTCGGGGGGCTCGGG + Intronic
1160712740 19:560123-560145 TGGTTGCTTTTGGGAGGCCGAGG - Intergenic
1161411709 19:4121597-4121619 TGGGGGATTCTGGGGGGGTCAGG - Intronic
1161709828 19:5841683-5841705 TGGCCGATGTTGGGGGGCTCTGG - Intergenic
1161733552 19:5977291-5977313 TGGTGCCTTCTCGGGGGATCTGG + Intronic
1161767006 19:6213629-6213651 TGTGGGGTGTTGGGGGGCTCTGG + Intronic
1161767110 19:6213954-6213976 GGGTGGCTTCTGGGGGGGTGGGG + Exonic
1161904894 19:7149410-7149432 TCGTGGCTTTTGGGAGGAACAGG - Intronic
1162077690 19:8199298-8199320 TGGTGGCTCATGGGAGGCTGAGG + Intronic
1163533203 19:17862661-17862683 TTGTCGCCTTTGGGGGGCTGTGG + Intronic
1163721177 19:18898947-18898969 TGGTGACATCTGGGAGGCTCCGG + Intergenic
1165212713 19:34248604-34248626 TGGTGGCCTTTGTGGTGCTTTGG - Intergenic
1165721521 19:38082537-38082559 TGCTGGCTTCCGGGGGGCTCCGG - Exonic
1165819624 19:38666219-38666241 TGATTGCTTTTGGGGGGGACAGG - Intronic
1166300228 19:41908668-41908690 TGGTGGCACCTGGGGGGCACAGG + Intronic
1167377404 19:49119404-49119426 AGGTGGGATTTGGGGGGCGCTGG + Exonic
1167411608 19:49347424-49347446 TGACGGCATTTGGTGGGCTCAGG - Intronic
1168682514 19:58326543-58326565 GGGTGGCTTTGGGAGGGCTGAGG - Intergenic
926717752 2:15938709-15938731 TGGTGGCGATTAGGGGGCTAGGG + Intergenic
927274526 2:21251276-21251298 TCCTGGCTTTTAGCGGGCTCTGG + Intergenic
927301207 2:21517695-21517717 TGTTGTCCTTTGGTGGGCTCAGG + Intergenic
927932102 2:27051878-27051900 GGGTGGCCTTCGAGGGGCTCGGG - Intronic
928181455 2:29071471-29071493 TGGTGGCTGGTGGGCTGCTCAGG + Exonic
929825336 2:45305566-45305588 TGGTGGCTGTTGGTGGCCTTGGG - Intergenic
931077070 2:58727209-58727231 TGGTGGCTTGGGGGTAGCTCAGG + Intergenic
932485673 2:72082903-72082925 TGCTGGCTTTTGAGGAGCCCTGG - Intergenic
932886049 2:75550092-75550114 GGATGGCTTCTGGGAGGCTCTGG + Intronic
933730985 2:85456142-85456164 TGGTGGCTCTTTGGAGGCTCAGG + Intergenic
934603806 2:95679318-95679340 TGGTGCCCTTTGGGAGGATCTGG + Intergenic
934657095 2:96122098-96122120 TGGTGGCTTAAGGGGAGCACAGG - Intergenic
935188606 2:100757327-100757349 TGGTGGGCTTTGGGGAGGTCAGG - Intergenic
937212047 2:120280538-120280560 TGGGGCCTTTTGGGGGGCGGGGG + Intronic
937294174 2:120799784-120799806 TGGAGCCTTCTGGGGGACTCAGG - Intronic
938086420 2:128405044-128405066 TGGTGGCTGTGCTGGGGCTCTGG + Intergenic
938540539 2:132280729-132280751 TGGTGGCATCTGGTGAGCTCTGG - Intergenic
938732794 2:134159597-134159619 GGGAGGCTTTTGGGAGGCTGAGG + Intronic
938738117 2:134204917-134204939 TGGTTGCTTTTGGTAGGCTAGGG + Intronic
939380636 2:141431018-141431040 TTTTGGCTTTTGGGAGGCTAAGG + Intronic
940615476 2:156044031-156044053 TGGGGCCTGTTGGGGGGCTAGGG - Intergenic
940639118 2:156329555-156329577 TGGTGGCTGCCGGCGGGCTCCGG + Exonic
942552580 2:177134853-177134875 TGGTGGCTATTGGGAGGCCAAGG + Intergenic
944821705 2:203439465-203439487 TGGTCTCTTTTGGGGGGAGCAGG + Exonic
944970130 2:204983390-204983412 TGGTGGCTGTGGGGGGAGTCGGG + Intronic
946155332 2:217803314-217803336 TGATGCCTTTTTGGGGGCTGGGG - Exonic
946427698 2:219608254-219608276 TGGTGACTCCTGGGGGCCTCTGG - Exonic
948711489 2:239828287-239828309 TGGTGGCTCTGGGGGAGCTCAGG - Intergenic
948975638 2:241461833-241461855 GGGTGGCTCTTGGAGGGTTCAGG + Intronic
1171869461 20:30513733-30513755 TGGTGGCATCTGGTGAGCTCTGG - Intergenic
1173252848 20:41373808-41373830 TGGTGGCTAATCTGGGGCTCTGG + Intergenic
1174322675 20:49754423-49754445 GGGTGGCATTTGGGGAGCTATGG + Intergenic
1174661739 20:52219700-52219722 AGGTGGCTTGTGGGCTGCTCTGG - Intergenic
1175321578 20:58092000-58092022 TGGGGGTGTTTGGGGAGCTCTGG + Intergenic
1178253133 21:31023731-31023753 TGATGGCTTTGCAGGGGCTCAGG - Intergenic
1179080008 21:38161897-38161919 TGGTGGGATTTGGAGAGCTCTGG + Intronic
1179901423 21:44396407-44396429 TGGAGGCTTGTGGAGGGCTGTGG + Intronic
1180796947 22:18610516-18610538 TGGAGGCCTTGGGGAGGCTCCGG + Exonic
1180914176 22:19473878-19473900 TGCTTGGTTTTGGGGGCCTCTGG - Intronic
1181224777 22:21384755-21384777 TGGAGGCCTTGGGGAGGCTCCGG - Exonic
1181253855 22:21550058-21550080 TGGAGGCCTTGGGGAGGCTCCGG + Exonic
1181358573 22:22317820-22317842 TGGAAGGGTTTGGGGGGCTCAGG - Intergenic
1182360597 22:29744359-29744381 TGGTGGCTTGTGGGAGGCGGGGG + Intronic
1183383135 22:37500482-37500504 TGGTGGATAGTGGGGGGCTGGGG - Intronic
1183386475 22:37518318-37518340 TGGGGGGTGTTGGGGAGCTCTGG - Intronic
1183701377 22:39453129-39453151 GGGGGGCTGTTGGGGGGCTTGGG + Intergenic
1183731165 22:39619373-39619395 TGATGGCTTTGAGGGGCCTCAGG - Exonic
1184399386 22:44264958-44264980 TGGTTGTGTTTTGGGGGCTCTGG - Intronic
1184437028 22:44485296-44485318 TGGTGTTTTTTGGGGGGTTTTGG + Intergenic
1184523031 22:45007220-45007242 TGGCGGGTTTTGGGGGGGGCCGG - Intronic
1185399141 22:50607009-50607031 TGGGGGCGGTTGGGGGACTCGGG - Intronic
949723256 3:7015131-7015153 TGCTGGCTTATGGGGGGGTGGGG - Intronic
950122677 3:10492234-10492256 TGGGGGCTTTTCGGGGGGTGGGG + Intronic
950329716 3:12146768-12146790 TGATGGCTTTGGGGGCACTCTGG + Intronic
951778179 3:26333655-26333677 TGGTGGCTTCCGGGTGGCTCAGG + Intergenic
951893407 3:27587565-27587587 TCCTAGCTTTTGGGGGGCTAAGG - Intergenic
953017372 3:39090893-39090915 TAGTGGCTTATGGGGTGCTCAGG - Intronic
954368338 3:50157492-50157514 TGGGGGCTTTTCTGGGGCTGGGG + Intronic
954372684 3:50176971-50176993 TGGGGCCTTTTGGGGAGTTCAGG - Intronic
954620618 3:51993452-51993474 TGGGGGCTTTTGGGAAGCTCGGG - Intergenic
956169835 3:66424279-66424301 TGGTGGGGTTTGGTGGGCTTGGG - Intronic
956173447 3:66451531-66451553 TGGTGCCGTTTGGGGGACTCTGG - Intronic
957719036 3:83970390-83970412 ATGTGGGTTTTGGGGGGCCCTGG + Intergenic
958539505 3:95452146-95452168 TTGTTGCTTTTTGGGAGCTCAGG - Intergenic
958728630 3:97936327-97936349 TGGTGGCTTTGGGGAAGCTGTGG + Intronic
960435245 3:117618613-117618635 TTCTAGCTTTTGGGAGGCTCAGG + Intergenic
961649155 3:128408822-128408844 AGGTGGCTCCTGGGGCGCTCTGG + Intergenic
961723079 3:128908819-128908841 TGGTGGGTTTGGGGGGGTTCAGG + Intronic
964734005 3:159897924-159897946 AGGTGGTTTGTGGGTGGCTCTGG - Intergenic
965381048 3:167988616-167988638 TGGTGGGATGTGGGGGGCACTGG - Intergenic
967700402 3:192585689-192585711 TTGTGGGTGTTGAGGGGCTCGGG - Intronic
968901844 4:3435706-3435728 GGGTGGCTTCTGGTGGGATCCGG - Intronic
969906908 4:10405652-10405674 TGGTGGGTTTTGGCGGGTTTTGG + Intergenic
970015699 4:11510111-11510133 TGGTGGATTTTGGTGGGGACAGG + Intergenic
974010466 4:56601981-56602003 TGGTTGCCTTTGGGGGCCTAGGG + Intronic
975685205 4:76913885-76913907 TTGTGGTTTATGGGGGGCACAGG - Intergenic
977209022 4:94196236-94196258 TGGTGGCCTTTGGGGGCATTAGG + Intergenic
978221903 4:106287078-106287100 TTGTGGCTTATGGGGTCCTCTGG + Intronic
979540021 4:121870406-121870428 GGCTGGCTTTTGAGGGGCGCGGG - Exonic
980075447 4:128288370-128288392 AGGTGGCTTGTGGGAGGCTGGGG + Exonic
982245614 4:153347420-153347442 TGGTAGGTGTTGGGGGGCTTAGG + Intronic
983649607 4:170025867-170025889 TGGGGGCTTTCGCTGGGCTCTGG - Intronic
984195892 4:176658030-176658052 TGGAGACTTTTGGGGGTCTTGGG - Intergenic
984803173 4:183733098-183733120 GGGTGGCTTTTCGGGGCTTCAGG - Intergenic
985665169 5:1178366-1178388 GGGTGGCTTTTGTGTGGCTGCGG - Intergenic
986407461 5:7440595-7440617 TGGTGGTGTTTGGGGGACTCTGG - Intronic
988420921 5:31005397-31005419 TGTTGGCATCTGGGGGGCTAGGG - Intergenic
991281770 5:64922869-64922891 TGGATGCTTTTGGAGGGCGCGGG + Intronic
992149394 5:73887971-73887993 TGGGGACATTTGGGAGGCTCAGG - Intronic
992745060 5:79811276-79811298 TGGTGGCTGTGGGAGGGCTGTGG + Intergenic
994054502 5:95400288-95400310 TGGTGACTTTTGGGAGTCCCTGG + Intronic
997152558 5:131514039-131514061 TTGTGGTTTTTGGGGGGTTTTGG - Intronic
997965415 5:138352659-138352681 TGGTGGCTGTTGGGGGGGGTGGG + Exonic
998163147 5:139824872-139824894 TGGTGGGTTGTGGGGATCTCGGG + Intronic
998635357 5:143948821-143948843 TGGTTGCTTTGAGGGGGCTAAGG + Intergenic
999004602 5:147961849-147961871 TGCTGGCTTGTGGGGAGGTCTGG + Intergenic
999057580 5:148596508-148596530 TGCTGGCATTTTGGGGGCTGGGG + Intronic
999208877 5:149870466-149870488 TGGTGGCTTCAGGAGGGCACTGG + Intronic
1004381193 6:15134019-15134041 TGGTGGCATGTGGGAGGCTGAGG - Intergenic
1006292152 6:33146444-33146466 TGGGGGCCTTTGGGGGCCTTTGG + Intergenic
1006454670 6:34124950-34124972 TGGAGGCCTTTGGGGGCCTCTGG - Intronic
1007359124 6:41342658-41342680 TGGTGGCTTTAGGGAGTCCCTGG - Intronic
1007707238 6:43798353-43798375 TAGTGGGTTTTGTGGGGCACTGG + Intergenic
1009340988 6:62554837-62554859 TGAGGGCTTTTGGAGGGTTCAGG + Intergenic
1009838537 6:69037020-69037042 TGGTGGCTTTTGGCAGGTTATGG + Intronic
1010753410 6:79640100-79640122 TGTTAGTTTTTGGGGGGCACTGG + Intronic
1011557346 6:88584974-88584996 GGGTTGCTTTTGGGGCGATCAGG - Intergenic
1012713218 6:102634901-102634923 ATGTGGGTTTTGGGGGGCTTTGG + Intergenic
1014292252 6:119572182-119572204 TGGGGGCTTTGGGGGGGTTGGGG - Intergenic
1017298359 6:152826753-152826775 TCGTGGCTTTTAGGGGGCTTTGG + Intergenic
1019660193 7:2219809-2219831 GGGTGGCTTGTGGCAGGCTCTGG - Intronic
1019739465 7:2665531-2665553 GGGCGGCTTCTGGCGGGCTCAGG + Intergenic
1020029904 7:4925425-4925447 AGTTGGCTTTTGGGGGGCTCAGG - Intronic
1023222142 7:37930269-37930291 TGGTGGCTTCTGAGATGCTCTGG - Intronic
1023679412 7:42669391-42669413 GGGAGGCTTTTGGGAGGCTGAGG + Intergenic
1024165941 7:46730280-46730302 TGGTGGCATTTGGGAGGCTGAGG + Intronic
1025025793 7:55515151-55515173 GGGTGGCCTCTGGGGGGCTGAGG + Intronic
1026788004 7:73313791-73313813 TGGTGGGCTGTGGGGGGCTGAGG + Intronic
1029027845 7:97436644-97436666 TGGTGGGGGTTGGGGGGCTGTGG + Intergenic
1029045226 7:97620746-97620768 TGGTGGCTTATGGAGAGTTCAGG - Intergenic
1029171163 7:98629976-98629998 TGGTGGGTTTGGGGGCGCTGAGG + Intergenic
1029576422 7:101406512-101406534 AGGGGGCTGTTGGGGGGCTATGG + Intronic
1033779352 7:144650691-144650713 GGGTGGCGGTGGGGGGGCTCAGG - Intronic
1034730211 7:153380743-153380765 TGGTGGCTGGTGGGGGGCGGGGG + Intergenic
1035035536 7:155891789-155891811 TGGTGGCTGTTGTGGGGATGGGG + Intergenic
1035287846 7:157817474-157817496 TGGTGGCTCTGGGGTGGCTCCGG - Intronic
1035925336 8:3721978-3722000 TACTGGCTTGTGGGGGGCTTGGG - Intronic
1036442440 8:8793475-8793497 TGCTGGCTTTTGTGGGGCTTAGG - Intronic
1037896379 8:22659015-22659037 TGGTGGCCTTGTGGGGCCTCAGG - Intronic
1038141990 8:24855900-24855922 TGGTGGTTTATGGCAGGCTCAGG - Intergenic
1039473085 8:37826076-37826098 TGGGGGCTTTTGAGGGGGCCCGG + Intronic
1039853731 8:41395005-41395027 TGGTGGCGGTTGGGAGGCTGAGG + Intergenic
1039922755 8:41904855-41904877 AGGTGACTCTTGGTGGGCTCTGG - Intergenic
1042490657 8:69393899-69393921 TGGGGGTTTTTGGGGGGATGCGG - Intergenic
1045318757 8:101065489-101065511 TGGTGGCTACTGGGAGGCTGAGG - Intergenic
1045838998 8:106558265-106558287 TGCTGGCTTTTGGGCTGCTTTGG - Intronic
1048884401 8:138898088-138898110 TGGGGCCTTTTGGAGGGCTTAGG - Intronic
1049376681 8:142292710-142292732 AGGTGGCGTTCTGGGGGCTCGGG - Intronic
1051772563 9:20594678-20594700 TGGTGGGTTTTGGCGGGTTTTGG - Intronic
1053060402 9:35026384-35026406 TGGTGGGTTTTGGCCGGCTTTGG - Intergenic
1053208783 9:36210032-36210054 AGGTTTCTTTTGGGGGGGTCAGG - Intronic
1053313900 9:37036382-37036404 TTTTGGCTTTTGTGGGGCTTTGG + Intergenic
1053787659 9:41663933-41663955 GGGCGGCTTTTGGGGGGCAGGGG + Intergenic
1054157465 9:61650834-61650856 GGGCGGCTTTTGGGGGGCAGGGG - Intergenic
1054175936 9:61875275-61875297 GGGCGGCTTTTGGGGGGCAGGGG + Intergenic
1054477239 9:65581839-65581861 GGGCGGCTTTTGGGGGGCAGGGG - Intergenic
1054661603 9:67705533-67705555 GGGCGGCTTTTGGGGGGCAGGGG - Intergenic
1056459754 9:86798200-86798222 TGGGAGATTTTGTGGGGCTCTGG + Intergenic
1056951417 9:91043402-91043424 TTGCAGCTTATGGGGGGCTCTGG - Intergenic
1056979088 9:91291298-91291320 TGGTGTCTGTTGGGGGGGTGGGG + Intronic
1058005450 9:99908808-99908830 TGGTGTCTTCTGTGGGGCCCTGG - Intronic
1058577498 9:106419685-106419707 TGGTGGGTTTTTGAGGGATCTGG - Intergenic
1060866877 9:127007528-127007550 TGGTGTATGGTGGGGGGCTCAGG + Intronic
1061820484 9:133225001-133225023 TGGTGGCTGATGAGGGGCCCCGG - Intergenic
1061882470 9:133575144-133575166 TGGGGGCTGCTGGGGGGCTGGGG - Exonic
1061959266 9:133979731-133979753 TGGGGCCTGTTGGGGAGCTCGGG - Intronic
1062238784 9:135525057-135525079 TGGTGGCTGATGAGGGGCCCCGG + Intronic
1062291536 9:135797451-135797473 GGGTGTGTTTTGGGGGGCACTGG - Intergenic
1062310008 9:135930409-135930431 TGGTGGGGACTGGGGGGCTCCGG - Intergenic
1062591426 9:137276514-137276536 TGGGGTCCTTTGGGGGCCTCAGG - Intergenic
1203761310 EBV:13869-13891 TGGGGGCTTCTGGGGGGACCGGG - Intergenic
1203762239 EBV:16941-16963 TGGGGGCTTCTGGGGGGACCGGG - Intergenic
1203763168 EBV:20013-20035 TGGGGGCTTCTGGGGGGACCGGG - Intergenic
1203764097 EBV:23085-23107 TGGGGGCTTCTGGGGGGACCGGG - Intergenic
1203765026 EBV:26157-26179 TGGGGGCTTCTGGGGGGACCGGG - Intergenic
1203765955 EBV:29229-29251 TGGGGGCTTCTGGGGGGACCGGG - Intergenic
1203766884 EBV:32301-32323 TGGGGGCTTCTGGGGGGACCGGG - Intergenic
1185745722 X:2572040-2572062 ATGGGGCTTTTGGGGGCCTCAGG - Intergenic
1186487727 X:9946445-9946467 GGGCGGCTTCTGGGGGCCTCAGG + Intronic
1186861486 X:13676820-13676842 AGGTGGCGGTTGGGGGGCTGGGG - Intronic
1187734828 X:22292883-22292905 TGGTAGCTTTTGAGGGGCGTCGG - Intergenic
1188448690 X:30285801-30285823 TGGTGACTTTTGGGTTGCTCAGG - Intergenic
1191753457 X:64568586-64568608 TGTTGGGTTGTGGGGGGCTAGGG - Intergenic
1192434785 X:71136545-71136567 TTGTCAGTTTTGGGGGGCTCTGG - Exonic
1193363766 X:80606340-80606362 ATGTGGGTTTTGGGAGGCTCTGG + Intergenic
1193615279 X:83680172-83680194 TGGGGCCTGTTGGGGGGCTGGGG - Intergenic
1194501392 X:94685586-94685608 TGGAGCAGTTTGGGGGGCTCAGG + Intergenic
1195492950 X:105494658-105494680 TGGTCCCTTTTTGGGGGGTCAGG + Intronic
1195774257 X:108385871-108385893 TGGGGCCTTTTGGGGGGGTAGGG - Intronic
1196132558 X:112172994-112173016 TGGGGCCTGTTGGGGGGGTCGGG + Intergenic
1196592349 X:117501080-117501102 TGGGGCCTGTTGGGGGGCTGGGG + Intergenic
1197307520 X:124862236-124862258 TGGTGCCTTTTGCGGGGCAATGG - Intronic
1198757699 X:139998194-139998216 TGGGGCCTGTTGGGGGGCTGGGG - Intergenic
1202115270 Y:21465705-21465727 TGGTGGCTATGGGAGGGGTCTGG - Intergenic