ID: 1077318002

View in Genome Browser
Species Human (GRCh38)
Location 11:1927824-1927846
Sequence CTAAGTCAGGGAGGCCAGGG CGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 448
Summary {0: 1, 1: 0, 2: 2, 3: 46, 4: 399}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1077317988_1077318002 28 Left 1077317988 11:1927773-1927795 CCTTCCCACCCGGAGGGGCTCCT 0: 1
1: 0
2: 1
3: 18
4: 180
Right 1077318002 11:1927824-1927846 CTAAGTCAGGGAGGCCAGGGCGG 0: 1
1: 0
2: 2
3: 46
4: 399
1077317994_1077318002 2 Left 1077317994 11:1927799-1927821 CCACGCACTGCGTCCAGCAAAAC 0: 1
1: 0
2: 0
3: 5
4: 75
Right 1077318002 11:1927824-1927846 CTAAGTCAGGGAGGCCAGGGCGG 0: 1
1: 0
2: 2
3: 46
4: 399
1077317989_1077318002 24 Left 1077317989 11:1927777-1927799 CCCACCCGGAGGGGCTCCTCAGC 0: 1
1: 0
2: 1
3: 18
4: 141
Right 1077318002 11:1927824-1927846 CTAAGTCAGGGAGGCCAGGGCGG 0: 1
1: 0
2: 2
3: 46
4: 399
1077317990_1077318002 23 Left 1077317990 11:1927778-1927800 CCACCCGGAGGGGCTCCTCAGCC 0: 1
1: 0
2: 3
3: 21
4: 301
Right 1077318002 11:1927824-1927846 CTAAGTCAGGGAGGCCAGGGCGG 0: 1
1: 0
2: 2
3: 46
4: 399
1077317991_1077318002 20 Left 1077317991 11:1927781-1927803 CCCGGAGGGGCTCCTCAGCCACG 0: 1
1: 0
2: 2
3: 21
4: 177
Right 1077318002 11:1927824-1927846 CTAAGTCAGGGAGGCCAGGGCGG 0: 1
1: 0
2: 2
3: 46
4: 399
1077317993_1077318002 8 Left 1077317993 11:1927793-1927815 CCTCAGCCACGCACTGCGTCCAG 0: 1
1: 0
2: 0
3: 22
4: 147
Right 1077318002 11:1927824-1927846 CTAAGTCAGGGAGGCCAGGGCGG 0: 1
1: 0
2: 2
3: 46
4: 399
1077317992_1077318002 19 Left 1077317992 11:1927782-1927804 CCGGAGGGGCTCCTCAGCCACGC 0: 1
1: 0
2: 1
3: 15
4: 163
Right 1077318002 11:1927824-1927846 CTAAGTCAGGGAGGCCAGGGCGG 0: 1
1: 0
2: 2
3: 46
4: 399

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1077318002 Original CRISPR CTAAGTCAGGGAGGCCAGGG CGG Intronic
900388756 1:2424010-2424032 CTCATGCTGGGAGGCCAGGGTGG - Intergenic
900695014 1:4004409-4004431 CTAAGGCAGAGGGGGCAGGGAGG - Intergenic
901145425 1:7061663-7061685 CTGAGGCAGGGAGAGCAGGGTGG + Intronic
901634673 1:10665027-10665049 CCAGGACAGGGAGGCCAGTGGGG - Intronic
901773179 1:11541415-11541437 CTTACTCAGGGAAGGCAGGGAGG - Intergenic
901913834 1:12482093-12482115 GTAAGTCAGGCAGGCTAGGAAGG + Intronic
901935121 1:12621451-12621473 CTGATTCAGGAGGGCCAGGGTGG - Intergenic
902175286 1:14645515-14645537 CCAAATCAGGAAGGCCAGGGAGG - Intronic
902866965 1:19286035-19286057 CCAGGAAAGGGAGGCCAGGGTGG + Intronic
902895910 1:19479959-19479981 CTCAGGCAGAGAGGACAGGGTGG - Intronic
903740036 1:25553411-25553433 CAAAGACACGGAGGCCATGGAGG - Intronic
904612633 1:31733801-31733823 CCCTGGCAGGGAGGCCAGGGAGG - Intronic
904752031 1:32746968-32746990 CTAAGTCAGCTAGGCCTGGCAGG - Intronic
905241328 1:36583374-36583396 CTAAGCTAGGGAATCCAGGGAGG - Intergenic
905956911 1:42004785-42004807 CTAAGTCAGTAGGTCCAGGGTGG - Intronic
906514370 1:46430187-46430209 CCAAGCCAAGGAGGCCAGTGAGG + Intergenic
906695913 1:47823441-47823463 CTGGGTCAGGGAGGCCAGATGGG - Intronic
907472616 1:54683852-54683874 CCAGGTCAGGGAGATCAGGGAGG - Intronic
908165030 1:61449387-61449409 CTATCTAAGGGATGCCAGGGTGG - Intronic
908302491 1:62776039-62776061 CACAGTCTGGGAGGCCAAGGTGG - Intergenic
909003204 1:70243799-70243821 CCAACTCTGGGAGGCCAAGGTGG + Intronic
909156937 1:72090280-72090302 CTAGGTGATGGGGGCCAGGGAGG + Intronic
912719544 1:112007979-112008001 CTGAGTCATGGAGGGAAGGGAGG - Intergenic
913696359 1:121329637-121329659 CTAATTTAGGGATGTCAGGGTGG + Intronic
914141202 1:144950416-144950438 CTAATTTAGGGATGTCAGGGTGG - Intronic
914575447 1:148963137-148963159 TTACGTGAGGGAGGCCAAGGTGG - Intronic
914764368 1:150625081-150625103 CTAAGTAATGGAGGCTAAGGGGG + Intronic
915801914 1:158802453-158802475 CTATGACGGGGAGGCCAAGGCGG - Intergenic
915871553 1:159565109-159565131 ATAAGGCAGGAAGGCCAGAGGGG - Intergenic
916059804 1:161090508-161090530 CTATCCCAGGGAGGCCAGGAAGG - Intergenic
917263918 1:173199156-173199178 CAAACTCTGGGAGGGCAGGGAGG + Intronic
917783369 1:178424707-178424729 CAGACTCTGGGAGGCCAGGGTGG - Intronic
918582484 1:186147208-186147230 CTAAGCCAGGGAGGGCAGAAGGG - Intronic
920091442 1:203455859-203455881 CTAAGCCAGGGAGAGCAGGCAGG + Intergenic
920483685 1:206348003-206348025 CTAATTTAGGGATGTCAGGGTGG + Intronic
920566746 1:206980263-206980285 CTGAGTCAGGGAAGGAAGGGAGG + Intergenic
920827649 1:209436664-209436686 CAGAGTCAGGGAGCCCAGGTTGG - Intergenic
921808098 1:219478983-219479005 CTTAGTCTGGAAGGCAAGGGTGG - Intergenic
922070023 1:222183121-222183143 CAAAGTCAGGGAGTGCAGTGAGG + Intergenic
922479309 1:225928009-225928031 CTAACACTGGGAGGCCAAGGAGG - Intergenic
922741104 1:228014691-228014713 CCAAGCCGGGGAGGCCAGCGTGG + Intronic
922946485 1:229520220-229520242 CTAACTTTGGGAGGCCAAGGTGG + Intronic
923205027 1:231750677-231750699 CTAGGTGTGGGAGGCAAGGGTGG + Intronic
923413702 1:233734239-233734261 CTCATTCAGGCAGGCCAGAGAGG + Intergenic
923498601 1:234545798-234545820 ATAAGTCACTGAGCCCAGGGAGG + Intergenic
1063380956 10:5585474-5585496 CTAAGGAAGGGAGACAAGGGTGG - Intergenic
1063733334 10:8723846-8723868 CTGAGGCAGAGAGTCCAGGGTGG + Intergenic
1065859877 10:29863591-29863613 CTATGTTTGGGAGGCCAAGGTGG - Intergenic
1065960530 10:30730935-30730957 GTAAGGCAGGGAAGCCAGAGGGG + Intergenic
1067290067 10:44933887-44933909 CTAGGTCAGAGAGGGCAGTGGGG - Intronic
1069997378 10:72350990-72351012 CTAAGTCATGAAGGCCAAGCTGG - Intronic
1072608434 10:97001777-97001799 CTTGGTCAAGCAGGCCAGGGAGG + Intronic
1073104957 10:101027261-101027283 CTCAGTGAGGGAGGGGAGGGTGG - Intronic
1073571183 10:104582366-104582388 CCCAGGCAGGGAGGCCAGTGAGG + Intergenic
1073907913 10:108305838-108305860 ATAAATCAGGGAGGCCGAGGTGG + Intergenic
1074292064 10:112145036-112145058 CACAGTGAGGGAGGACAGGGTGG + Intergenic
1074413703 10:113249163-113249185 CTTAGTTAGGGAGGACAGGAAGG + Intergenic
1074813918 10:117130812-117130834 CAAAGCCAGGGAGGGAAGGGAGG + Intronic
1075589761 10:123683189-123683211 CTGAGTCAAGGAGGCCAGTGGGG + Intronic
1076783834 10:132739293-132739315 GTGAGGCCGGGAGGCCAGGGTGG - Intronic
1077015259 11:396475-396497 CCAGGGCAGGGAGGCCAGGGGGG - Intronic
1077102985 11:830379-830401 CGGAGCCAGGGAGGCCAGCGAGG - Intronic
1077318002 11:1927824-1927846 CTAAGTCAGGGAGGCCAGGGCGG + Intronic
1077525403 11:3061232-3061254 CTCACTTTGGGAGGCCAGGGCGG - Intergenic
1077877475 11:6320313-6320335 CGAAGGCAGGGAGGCCTGGCAGG - Exonic
1079234381 11:18677476-18677498 CGAACTTTGGGAGGCCAGGGCGG - Intergenic
1079458699 11:20660729-20660751 CGAAGTCTGGGAGTCCAGGGGGG + Intergenic
1080042346 11:27772088-27772110 CAAAGTTAGGGAGGCCAGGAGGG + Intergenic
1080701482 11:34647978-34648000 CTGAGGCAGGGAGGCCTGGGAGG + Intronic
1081713630 11:45233656-45233678 GCAAGTGAGGGAGGCCAGGACGG - Intronic
1082014466 11:47474256-47474278 AAAAAACAGGGAGGCCAGGGTGG - Intronic
1082018603 11:47512095-47512117 CTTACTCTGGGAGGCCAAGGAGG - Intronic
1082679646 11:56152465-56152487 CCAAGTCAGGGTGGCCAAGATGG - Intergenic
1083850377 11:65362567-65362589 GCAAGTGAGGGAGGCCAAGGAGG + Intergenic
1084264150 11:67996262-67996284 CGAGGTCAGGCAGTCCAGGGAGG - Intronic
1085043428 11:73340135-73340157 CTGAGGCAGGGTGTCCAGGGAGG - Intronic
1085452364 11:76642308-76642330 CAAACACAGGGAGACCAGGGAGG + Intergenic
1085849858 11:80107688-80107710 GGAAGTCTGGGAGGCCAGGTAGG - Intergenic
1086905203 11:92410767-92410789 TTCTGGCAGGGAGGCCAGGGAGG - Intronic
1089198138 11:116707331-116707353 CTAAGCAAGGGCGGTCAGGGCGG - Intergenic
1089283628 11:117391899-117391921 CCAAGCCAGGGGGGCCAGGTTGG - Intronic
1089730930 11:120518259-120518281 GAGAGTCATGGAGGCCAGGGTGG - Intronic
1090932616 11:131311852-131311874 CAAAGTCACAGAGGCAAGGGAGG - Intergenic
1091702567 12:2673800-2673822 CTAAGACAGGGAGGTTAGGCAGG - Intronic
1092843149 12:12562185-12562207 GCAAGTCCGGGAGGCGAGGGGGG - Exonic
1093875299 12:24342696-24342718 CAAAGTCAGGGAGGTCAGTTAGG - Intergenic
1095676957 12:44931604-44931626 GTAAGTCAAGGAGGCTTGGGAGG + Intergenic
1096609125 12:52789601-52789623 CAGAGGCAGGGAGGCCAGGGAGG + Intergenic
1097562045 12:61219733-61219755 CTAAGTGAGAGTGGGCAGGGAGG - Intergenic
1097694668 12:62764765-62764787 CTCAGTCAGGGAGGTCCAGGAGG + Intronic
1099194736 12:79602431-79602453 CGGAGACAGGGAGGCCAGTGTGG + Intronic
1101930124 12:109006939-109006961 AGGAGTCAGGGAGGCCAGGAAGG + Intronic
1101937478 12:109069956-109069978 GAATGGCAGGGAGGCCAGGGCGG + Intronic
1101997326 12:109534506-109534528 CAAGGCCAGGGAGCCCAGGGAGG - Intronic
1102205807 12:111090048-111090070 TGGAGGCAGGGAGGCCAGGGAGG + Intronic
1102576590 12:113859680-113859702 GTGAGACAGGGAGGCAAGGGAGG - Intronic
1102963923 12:117111900-117111922 CTGAGTCAGCGTGGCCAGGCAGG - Intergenic
1103487918 12:121295798-121295820 CTAAGTGAGAGTGGCCAGGAGGG + Intronic
1103854718 12:123958663-123958685 CACAGTCAGTGACGCCAGGGAGG - Intronic
1103974285 12:124692074-124692096 CTGATTCAGTGAGTCCAGGGTGG + Intergenic
1103988962 12:124785483-124785505 CTTTGACATGGAGGCCAGGGAGG - Intronic
1104706144 12:130948940-130948962 CTGAGTCAGAGACCCCAGGGTGG + Intergenic
1104785114 12:131444136-131444158 GAAAACCAGGGAGGCCAGGGCGG + Intergenic
1106410172 13:29505994-29506016 CCCAGGCAGGGAGGCAAGGGGGG + Intergenic
1106648463 13:31662839-31662861 CTAACTTTGGGAGGCCAAGGTGG - Intergenic
1107844093 13:44493210-44493232 CTAAATCAGGGAGGGCATTGGGG - Intronic
1108071962 13:46637290-46637312 GGCAGGCAGGGAGGCCAGGGAGG - Intronic
1110607574 13:77450700-77450722 CTAAGACTGGGAGGCCGAGGCGG + Intergenic
1113267898 13:108639724-108639746 CACAGTCTGGGAGGCCAGGTAGG + Intronic
1114543673 14:23482881-23482903 CCAAGTGGGGGAGGACAGGGTGG - Intronic
1115158922 14:30370784-30370806 CTAGGTTGGGGAGGCAAGGGTGG - Intergenic
1115750163 14:36481539-36481561 CAAAGTCTGGGAGGCAGGGGAGG - Intronic
1118634433 14:67734728-67734750 CTAAGGCAGTTAGGCCATGGGGG - Intronic
1118844037 14:69533029-69533051 CTAAGTCCAGGAGTCCTGGGGGG + Intergenic
1119703236 14:76769009-76769031 ACAAGTCAGTGAGGCCAAGGAGG - Intronic
1120299808 14:82692146-82692168 CTAAGTAATGGAGGCTAAGGGGG + Intergenic
1121728591 14:96170927-96170949 CGATGGCAGGGAGGCAAGGGTGG - Intergenic
1121912356 14:97802964-97802986 GTCAGGCAGGGAGGCCTGGGGGG + Intergenic
1122200586 14:100120291-100120313 CTAAGTCAGGAAGGGGAGAGGGG - Intronic
1123016517 14:105378105-105378127 ATGAGGCAGGAAGGCCAGGGAGG - Intronic
1124433317 15:29626092-29626114 CTAAGTTTGGGAGGCCGAGGTGG - Intergenic
1124632372 15:31345063-31345085 CAAAGGCGGGGAGGCCAGGGTGG - Intronic
1126469712 15:48995441-48995463 CACAGACAGGGAGGCCAGGAAGG + Intronic
1127490847 15:59461615-59461637 CTAAATGAGAGAGGCCAGGCTGG - Intronic
1127865852 15:63032085-63032107 CCATGACAGGGAGCCCAGGGTGG - Intergenic
1128350457 15:66885053-66885075 CTGAGTCAGAGAGGGCAGGGAGG + Intergenic
1128603226 15:69015407-69015429 CTAACGCAGGGAAGGCAGGGAGG - Intronic
1128684129 15:69671205-69671227 CCAAGTCAGGGAGCCAGGGGTGG + Intergenic
1129190446 15:73934367-73934389 AGACGTCAGTGAGGCCAGGGAGG - Intronic
1129233306 15:74208766-74208788 CCAAGTCTGGGAGGCCAGGTGGG - Intronic
1129723995 15:77892360-77892382 CAAGGCCAAGGAGGCCAGGGAGG - Intergenic
1129785878 15:78309753-78309775 GTGAGCCAAGGAGGCCAGGGTGG + Intergenic
1130069208 15:80632276-80632298 CTAAGTCGGGCAGGGCATGGTGG + Intergenic
1130526729 15:84713537-84713559 CAACCTCTGGGAGGCCAGGGAGG + Intronic
1131118400 15:89808289-89808311 CTTGGTCAGGGAGGTCAGGGCGG - Intronic
1131792102 15:95976076-95976098 CCAAGACAGGGAGCCCAGTGAGG + Intergenic
1132985139 16:2762189-2762211 CTAGGTCAGCAAGGCGAGGGAGG + Exonic
1133770462 16:8864711-8864733 CCAAGGGAGGGAGCCCAGGGTGG + Intronic
1133937039 16:10277766-10277788 CCAAGTCAGGGTGGCCAAGATGG - Intergenic
1134097092 16:11425060-11425082 CTAAGTCCTGGAGCCAAGGGAGG - Intronic
1134151481 16:11808740-11808762 CTAACACTGGGAGGCCAAGGCGG + Intergenic
1134669010 16:16040848-16040870 TGAAGGCAGGGAGACCAGGGTGG + Intronic
1135225386 16:20651587-20651609 CTCAGTCAGGCAGGCTAGAGTGG - Intronic
1136080660 16:27850572-27850594 CTGAGGCAGAGTGGCCAGGGAGG + Intronic
1136374422 16:29856912-29856934 GGAAGGCAGGGAGGCCAGAGAGG - Intergenic
1138177139 16:54910502-54910524 CTCACTCTGGGAGGCCAAGGAGG + Intergenic
1139555939 16:67710365-67710387 CTAACTTTGGGAGGCCAAGGCGG - Intronic
1139621244 16:68145053-68145075 CCACGGCAGGGAGGCCAAGGTGG - Intronic
1139916184 16:70429888-70429910 CTAAGCCTGGGAGGCCAAGGCGG - Intronic
1140480397 16:75259415-75259437 TTAAGTCTAGGAGGCCAGGTTGG + Intronic
1141639670 16:85333844-85333866 CTGGGTCAGGGAGGGCAGGCAGG - Intergenic
1141679911 16:85537923-85537945 CTGAGGCAGGGAGGCGAGCGTGG + Intergenic
1142024377 16:87804647-87804669 CGAGCTCAGGGAGGACAGGGAGG - Intergenic
1142600318 17:1050661-1050683 CTGAGTGAGTGGGGCCAGGGTGG + Intronic
1143266182 17:5639695-5639717 CTGAGCCAGGCAGGCAAGGGTGG + Intergenic
1143855592 17:9845621-9845643 CTGAACCAGAGAGGCCAGGGAGG - Intronic
1144443806 17:15308289-15308311 CTCATTCGGGGAGGCCAGTGTGG - Intronic
1144630047 17:16866719-16866741 CTGAGTCAGGAAGTCTAGGGGGG + Intergenic
1144774914 17:17780522-17780544 CTAGGACAGGGGGACCAGGGAGG + Intronic
1145014761 17:19388996-19389018 CCAAGTCAGGGAGGCCAACTGGG - Intergenic
1145104383 17:20103230-20103252 CTCAGGCAGAGAGGGCAGGGAGG - Intronic
1145242566 17:21248436-21248458 CCAAGGCAGGGAGGCCAGAGAGG - Intronic
1145260991 17:21354714-21354736 CTTAGCCAGGGAGGTCAGTGAGG - Intergenic
1145785528 17:27591415-27591437 CTAATGCAGGGAGGCCTCGGAGG + Intronic
1145869907 17:28265623-28265645 CTGAGTCAGGGTGGCCAAGATGG - Intergenic
1145870005 17:28266239-28266261 CTGAGTCAGGGTGGCCAAGATGG - Intergenic
1145870122 17:28266979-28267001 CTGAGTCAGGGTGGCCAAGATGG - Intergenic
1145870222 17:28267595-28267617 CTGAGTCAGGGTGGCCAAGATGG - Intergenic
1146381241 17:32329414-32329436 CTCAGTTTGGGAGGCCAAGGTGG + Intronic
1146483008 17:33220170-33220192 ATCAGTTGGGGAGGCCAGGGTGG - Intronic
1146636196 17:34507199-34507221 CAAAGTCAGGGAGCCCAGTTAGG + Intergenic
1146976981 17:37121918-37121940 AGGGGTCAGGGAGGCCAGGGAGG - Intronic
1147013870 17:37474581-37474603 CTGTGCCAGGGAGGCCAGTGAGG - Exonic
1147260957 17:39209707-39209729 CTGAGCCAGGTAGGCCAGGTGGG - Intergenic
1147460582 17:40565550-40565572 ATGAGTCAGGGAGGGCTGGGGGG - Intergenic
1147688972 17:42303971-42303993 GGAATTCAGTGAGGCCAGGGGGG + Intronic
1147968528 17:44207127-44207149 GAAAGTGGGGGAGGCCAGGGGGG + Exonic
1147982666 17:44284156-44284178 CTCAGTCAGGAAGGCCTGGAGGG + Intergenic
1148084741 17:44987409-44987431 CTAAGGGATGGAGGCCTGGGTGG - Intergenic
1148194526 17:45703712-45703734 CCCAGTGAGGGAGGCAAGGGAGG - Intergenic
1148325000 17:46778180-46778202 CCAAGTCAGGGATGCAAGGATGG - Intronic
1149322218 17:55493171-55493193 CTCATTCAGGGAGGTCAGGTTGG + Intergenic
1149578133 17:57728352-57728374 CTGAGTCTGAGAGGACAGGGAGG + Intergenic
1150692456 17:67377879-67377901 CAAAGTCAGGGAGGCAGGGAGGG - Intronic
1150699735 17:67436494-67436516 AGAAGGTAGGGAGGCCAGGGAGG + Intronic
1151205397 17:72502658-72502680 CTAAGTCAGGGTGGGGTGGGGGG + Intergenic
1151583375 17:74992828-74992850 CTAATGCTGGCAGGCCAGGGTGG - Intronic
1151662454 17:75525879-75525901 CTGGGGCGGGGAGGCCAGGGAGG + Intronic
1152239550 17:79154309-79154331 TTCAGGCAGGGTGGCCAGGGAGG - Intronic
1152351309 17:79785394-79785416 TTCAGTCACGCAGGCCAGGGAGG - Exonic
1152421224 17:80194204-80194226 GCAGGGCAGGGAGGCCAGGGCGG - Intronic
1153590104 18:6664836-6664858 CTAACACAGGGAGGTCAGGAGGG + Intergenic
1156909406 18:42392888-42392910 CTAATTCAGTGAGTCCAGGGTGG - Intergenic
1157305149 18:46511557-46511579 CTCAGTCATGGAGCCCAGTGAGG - Intronic
1157599535 18:48885619-48885641 CTTGGTCAGGGAGGCTAAGGCGG + Intergenic
1157934186 18:51855756-51855778 CCAAGTATGGGAGGCCAGGGAGG - Intergenic
1160518054 18:79489247-79489269 CACAGTCAGGCAGGCCAGGGCGG - Intronic
1160680577 19:410155-410177 CTGAGGCGGGGAGGGCAGGGAGG - Intergenic
1160971151 19:1768341-1768363 CTGAGTGAGTGAGGCCAGCGGGG + Intronic
1161506191 19:4645000-4645022 CTCAGTCCGGGGGCCCAGGGGGG - Intronic
1162141904 19:8590088-8590110 TAGAGGCAGGGAGGCCAGGGAGG + Intronic
1163087604 19:14993554-14993576 CTAAGACAGAGTTGCCAGGGTGG - Intronic
1163420979 19:17213490-17213512 CTGAATCAGGGAGGCCAGAGAGG - Intronic
1165093072 19:33396685-33396707 GAAAGGCGGGGAGGCCAGGGAGG + Intronic
1165790364 19:38487879-38487901 CTAACACTGGGAGGCCAAGGTGG - Intronic
1165810312 19:38607971-38607993 CCAGGTCAGGGACCCCAGGGAGG - Exonic
1166219811 19:41357145-41357167 CTCTGTCAGGGAGGTCAGAGAGG - Intronic
1166416688 19:42600412-42600434 AGAGGTCAGGGAGCCCAGGGAGG - Intronic
1166738774 19:45101790-45101812 CTGAGACAGGGAGGCCAGGGAGG + Intronic
1166777515 19:45322057-45322079 CCAAGACAGGTGGGCCAGGGTGG + Intronic
1167032273 19:46970763-46970785 GGAGGTCAGGGAGGCCAGGGAGG + Intronic
1167485201 19:49758670-49758692 CTGAGGCAGGGAGGCCAGAGGGG - Intronic
1167725310 19:51208260-51208282 CTAACTTTGGGAGGCCAAGGTGG + Intergenic
1168225718 19:54993595-54993617 GCATGTTAGGGAGGCCAGGGTGG + Intronic
1168385524 19:55959958-55959980 CTAAATCATGGAGGCTTGGGGGG + Intronic
925133806 2:1512670-1512692 CACAGCCAGGGAGGTCAGGGAGG - Intronic
925296133 2:2778827-2778849 CTAAGACATGGAGGCCAGAGGGG - Intergenic
925321851 2:2976439-2976461 CGAGGTCAGGCAAGCCAGGGAGG + Intergenic
925368853 2:3329015-3329037 CTGATTCAGGGAGCCCAGGCTGG - Intronic
926002043 2:9341096-9341118 AAAAGTAAGAGAGGCCAGGGCGG - Intronic
926053435 2:9759229-9759251 CTGGGTCAGGGACTCCAGGGCGG + Intergenic
927464261 2:23325278-23325300 CTAAGTCTGGGAGATCAAGGTGG + Intergenic
927988300 2:27428928-27428950 CCAAGCCAGAGACGCCAGGGAGG - Intronic
928182746 2:29080930-29080952 CTCAGGAAGGGAGGCCAGGAGGG - Intergenic
931361356 2:61580627-61580649 CTAAATCTGGGAGGCCAAGGAGG + Intergenic
931807254 2:65819199-65819221 CTAAGTCTGGGCTGCCAGTGAGG - Intergenic
933559598 2:83874286-83874308 CCAAGTCAGGGTGGCCAAGATGG + Intergenic
933560462 2:83879372-83879394 CCAAGTCAGGGTGGCCAAGATGG + Intergenic
934122032 2:88849628-88849650 CTGAGGTAGGGAGCCCAGGGAGG - Intergenic
934168822 2:89321877-89321899 CTCAATCAGTGAGGACAGGGAGG + Intergenic
934198469 2:89860707-89860729 CTCAATCAGTGAGGACAGGGAGG - Intergenic
935772685 2:106441605-106441627 CTCTGTCTGGGAGGCCAAGGTGG + Intronic
935907386 2:107854309-107854331 CTCTGTCTGGGAGGCCAAGGTGG - Intronic
936092134 2:109508227-109508249 CTGAGTCAGGGAGGGCAGCACGG - Intergenic
936659283 2:114524249-114524271 GAATGTCAGGGAGGCCAGTGAGG + Intronic
936938250 2:117858836-117858858 CACAGTCAGGGAGACCAGCGGGG + Intergenic
936938270 2:117858923-117858945 CACAGTCAGGGAGACCAGCGGGG + Intergenic
937264617 2:120607997-120608019 CAAGGTCAGGGAACCCAGGGGGG + Intergenic
937314120 2:120920217-120920239 CCACGGCAGAGAGGCCAGGGAGG - Intronic
937481979 2:122271244-122271266 CTAAGTCTAGTTGGCCAGGGTGG + Intergenic
938067408 2:128288732-128288754 GAGAGTCAGGGAGGCCTGGGAGG + Intronic
938194420 2:129314313-129314335 CTCAGTCAGGACTGCCAGGGTGG + Intergenic
938447386 2:131389506-131389528 CTAGGTCAGGGCGGGCATGGGGG - Intergenic
944652406 2:201844298-201844320 CGAAGTCATGGGGGGCAGGGTGG + Intronic
944967127 2:204947561-204947583 CTAAGAGAGGGAGGGGAGGGAGG - Intronic
946233767 2:218309523-218309545 GTAACTCTGGGAGGCCAAGGGGG - Intronic
947832068 2:233148531-233148553 CCAGGTTAGGGAGGCCAGGCAGG + Intronic
948062490 2:235052030-235052052 CTCAGTCAGGGGTCCCAGGGTGG + Intronic
948205605 2:236161270-236161292 CAAAGCCACGGAGGGCAGGGCGG + Intergenic
948593196 2:239064128-239064150 CCAGGCCAGGGAAGCCAGGGCGG - Intronic
948882904 2:240869411-240869433 CAAACAGAGGGAGGCCAGGGAGG - Intronic
948897589 2:240934524-240934546 CCAGGTCAGTGAGGCCAGGGTGG - Intronic
1168953784 20:1820107-1820129 CTAGATCATGGATGCCAGGGTGG - Intergenic
1170612427 20:17925537-17925559 CTAGATCTGGGAGGTCAGGGAGG + Intergenic
1170893236 20:20393276-20393298 CTAAGTCATGGAGGCAACGGCGG + Intronic
1172291485 20:33780250-33780272 GTAGGTCAAGGAGGCCAGGGTGG + Intronic
1173125614 20:40333366-40333388 TGAAGGCAGGGAGGCCAGAGAGG - Intergenic
1173246208 20:41339645-41339667 CTATGTCAAGGTGGCCAGGAGGG - Intergenic
1173317631 20:41959347-41959369 CTAAGTCAGGGAGGAGAAGGAGG + Intergenic
1173864521 20:46305808-46305830 CTAAGGCAGGGAGCCCAGGAGGG - Intronic
1173888866 20:46487339-46487361 ATAAGTCAGTGAGGACAGGATGG - Intergenic
1173911926 20:46676869-46676891 CTACGCCAGGGTGGCCAGGAGGG + Intronic
1174170629 20:48616105-48616127 CTTAGTCAGGGCGGTCAGTGAGG + Intergenic
1174687335 20:52468477-52468499 CTGAGGCTGGGAGGCCAGTGTGG + Intergenic
1174918439 20:54677338-54677360 CTAGGGCAGGAAGGCCAGGGTGG + Intergenic
1175759219 20:61550032-61550054 TTGGGGCAGGGAGGCCAGGGAGG - Intronic
1175759288 20:61550256-61550278 GTAGGCTAGGGAGGCCAGGGAGG - Intronic
1175759296 20:61550278-61550300 TTGGGGCAGGGAGGCCAGGGAGG - Intronic
1176361228 21:5998404-5998426 GTAAGTCAGGGATGGCAGAGAGG + Intergenic
1177550270 21:22611801-22611823 CCAAGTTTGGGAGGCCAAGGTGG + Intergenic
1178235393 21:30835671-30835693 CACAGTCAGGGAGGCCAGGGAGG - Intergenic
1178847128 21:36183202-36183224 AGAAGTCAGGGAGGCCAGGATGG - Intronic
1179762290 21:43540146-43540168 GTAAGTCAGGGATGGCAGAGAGG - Intronic
1180109993 21:45643220-45643242 CTGAGTACGGGAGGCCAGGCCGG - Intergenic
1181557094 22:23677440-23677462 CCTGGTCAGGGAGGACAGGGCGG - Intergenic
1181697280 22:24600100-24600122 CTTGGGCAGGGAGGACAGGGCGG + Intronic
1181796991 22:25318455-25318477 CTAAGGCCTGGAGGCCAGAGGGG - Intergenic
1182094218 22:27615165-27615187 GAGAGTCAGGGAGGCCAGGGTGG + Intergenic
1182426843 22:30278136-30278158 CTGAGGCAGGGAGGCCAGCGGGG + Intergenic
1183319571 22:37156850-37156872 CTGAGCCAGGGAGGGCAGGAAGG - Intronic
1183620070 22:38967034-38967056 CTTGGTCCGGGTGGCCAGGGTGG + Intronic
1183958263 22:41395616-41395638 CTAAAGCAGGGATACCAGGGAGG - Intronic
1184277833 22:43420303-43420325 CTAAGTCCCTGAGGCCTGGGCGG - Intronic
1184468693 22:44683614-44683636 CTAAGGCAGGGTGGCCTGGGAGG - Intronic
1184494032 22:44826919-44826941 GGAGCTCAGGGAGGCCAGGGAGG + Intronic
1184692036 22:46121837-46121859 CTAGGGCAGGGTGGGCAGGGAGG - Intergenic
1185295275 22:50049944-50049966 CTGGGGCAGGGAGGCCAGGAGGG + Intronic
950408248 3:12817680-12817702 CTCACTCAGGGAGGCCCTGGGGG + Exonic
950590363 3:13932474-13932496 CTGATTCAGGGAGGCTAGGGAGG + Intergenic
950876910 3:16283867-16283889 CAAATTCAGAGAGGTCAGGGAGG + Intronic
951328991 3:21343012-21343034 TTAACCCAGGGAGGCCAAGGCGG + Intergenic
953903169 3:46854675-46854697 CTGAGTCAGAGAGGTCAGGGAGG - Intergenic
954315089 3:49796822-49796844 ATTAGTCAAGGAGGCCAAGGAGG + Intronic
954315262 3:49797821-49797843 AGAAGTCAGGGAGCCCAGGCTGG - Intronic
954579323 3:51694702-51694724 GTAAGACAGGATGGCCAGGGAGG - Intronic
954698469 3:52439835-52439857 CTGAGCCAGGGTGGCCAGGCTGG - Intronic
955134030 3:56198431-56198453 CTGAAGCAGGGAGGCCAGGGAGG + Intronic
955575972 3:60363755-60363777 TGAAGCCAGGGGGGCCAGGGGGG - Intronic
955891250 3:63652329-63652351 ATCAGTCAGGGAGGTCAGCGAGG - Intergenic
959113951 3:102153599-102153621 TTAAAGCAGGGATGCCAGGGTGG + Intronic
959538345 3:107512507-107512529 CTAAGTCAGGATGGCCACAGGGG + Intergenic
961359515 3:126358026-126358048 CTTAGTCCTGGAGGGCAGGGTGG - Intergenic
963054169 3:141171060-141171082 CTAGTCCAGGGAGGCCAAGGTGG - Intergenic
966357754 3:179099912-179099934 CTCAGCCAGGGAGTCCAGGGAGG + Intergenic
967049933 3:185773598-185773620 CTAAGTTAGGAAGGCCAAGGAGG + Intronic
967730762 3:192904798-192904820 ATGAGTCAGGGATGCCAGGAAGG - Intronic
968616284 4:1579176-1579198 CCAGGGCAGGGAGGGCAGGGGGG - Intergenic
968679630 4:1908226-1908248 CTAGGTCAGAAAGGCCAGGTTGG + Intronic
969196362 4:5566759-5566781 CTTAGTTTGGGAGGCCAGTGGGG - Intronic
969524807 4:7698918-7698940 CAGAGGCAGGGAGGGCAGGGTGG + Intronic
969587344 4:8102021-8102043 CTTGTGCAGGGAGGCCAGGGTGG - Intronic
971474518 4:27059618-27059640 CAAAGGCAAGGAGGGCAGGGTGG + Intergenic
972237667 4:37152623-37152645 CTAAGTAAAGTAAGCCAGGGTGG + Intergenic
972739759 4:41878587-41878609 CGAAGTCAGGGTGCCCCGGGAGG + Intergenic
973199593 4:47485215-47485237 CTACGTCACGGAGGGCGGGGCGG + Intergenic
975235609 4:71991531-71991553 ATAAGGCAAGGAGGCAAGGGTGG + Intergenic
975299670 4:72775026-72775048 CTCAGGAAGGGAGGCTAGGGAGG + Intergenic
975693929 4:76993076-76993098 TCAAGTCAGGGAGGCCAGTTGGG + Intronic
977587027 4:98785313-98785335 CTAAGTCACAAAGGGCAGGGAGG - Intergenic
979664498 4:123295608-123295630 CCAACTCTGGGAGGCCAAGGCGG + Intronic
979741690 4:124159193-124159215 CTGGGCCAGGGAGGCCAGTGAGG - Intergenic
980740696 4:136946661-136946683 CTCAGGAAGGGAGGCCAGTGGGG + Intergenic
981422800 4:144570735-144570757 CTGAGTGAGGGAGGCAAGAGTGG + Intergenic
982313728 4:154010621-154010643 ATCAGTCAGGGAAGGCAGGGAGG - Intergenic
983940855 4:173532865-173532887 CTGACTCAGGGAGGCCAGGCTGG + Intergenic
984662489 4:182388232-182388254 CTACGTCAAGGAGACCAGGTGGG - Intronic
985862225 5:2480562-2480584 CTGAGTCAGGGACCCCATGGGGG + Intergenic
985941047 5:3136377-3136399 CTAACTCAGTGAGGCCAGTATGG - Intergenic
985998010 5:3607694-3607716 CTGGGTCAGGGAGGGCAGGCAGG + Intergenic
987003960 5:13689987-13690009 CACAGTCAGGTAGGCAAGGGAGG - Intergenic
988631933 5:32940729-32940751 GTAAGACAGGGAGGTCAGTGAGG + Intergenic
989988740 5:50735846-50735868 CTAGGTCAGGTAGGGCAGTGGGG + Intronic
990478321 5:56183909-56183931 CGAAGCCAGGGAGCCCAGAGAGG + Intronic
990823903 5:59875616-59875638 CTAAATAAGGGATGCCAGTGGGG - Intronic
991950016 5:71938569-71938591 CTAAGGCAGTGGGGCCAGGCTGG - Intergenic
992527898 5:77629941-77629963 CGCAAGCAGGGAGGCCAGGGTGG + Exonic
992869747 5:80994116-80994138 GGTAGTCTGGGAGGCCAGGGCGG + Intronic
994283007 5:97928499-97928521 TAAAGTCAGGGAGGACATGGTGG - Intergenic
996117818 5:119637434-119637456 TTATTTCAGGGAGGCCAGGATGG - Intergenic
996747469 5:126857658-126857680 CAATGCCAGGGAGGCCAGGCAGG - Intergenic
996913135 5:128678866-128678888 CTAAGTCACAGGGGGCAGGGTGG - Intronic
997599700 5:135130906-135130928 CTGGGTCAGGGAGGACAGTGGGG + Intronic
998151406 5:139759484-139759506 TTTCGTCAGGGAGCCCAGGGCGG - Intergenic
998167763 5:139854221-139854243 CAAAGGCCGGGAGGCCAGAGAGG - Intronic
999417297 5:151409640-151409662 CTGAGTCAGGAGGTCCAGGGTGG - Intergenic
1000070815 5:157739531-157739553 CTAAGGCAAGGAGCCCTGGGAGG - Exonic
1001020235 5:168176528-168176550 TTTAGACAGGGAGGGCAGGGAGG - Intronic
1001674502 5:173500716-173500738 AGAAGCCAAGGAGGCCAGGGAGG + Intergenic
1003540216 6:7011874-7011896 CAGAGTCCAGGAGGCCAGGGCGG + Intergenic
1003587547 6:7406770-7406792 GCTACTCAGGGAGGCCAGGGTGG - Intronic
1003852506 6:10239702-10239724 CAAAGTCTCGGAGACCAGGGAGG - Intergenic
1005031554 6:21513413-21513435 CTAAGGTAAGGAGGCCAGGGAGG + Intergenic
1006108065 6:31728525-31728547 CTGAGTCCGGGAGGCCGCGGAGG + Intronic
1006277757 6:33019729-33019751 CTTAGTCAAGGAGGGAAGGGAGG + Intergenic
1006799525 6:36751048-36751070 GCAGGTGAGGGAGGCCAGGGAGG + Intronic
1006810292 6:36816049-36816071 CTAAGGCAGGATGGCCAGGTGGG - Intronic
1007141430 6:39578576-39578598 CAAACTTTGGGAGGCCAGGGTGG - Intronic
1007399739 6:41597046-41597068 CCTATTCCGGGAGGCCAGGGCGG - Intronic
1008351188 6:50492325-50492347 CTAAGCCAAGGAGGTGAGGGAGG - Intergenic
1008598748 6:53068093-53068115 TTATTTCAGGGCGGCCAGGGGGG - Intronic
1010683709 6:78826653-78826675 TTAACTCAGGGAGGCCATTGGGG - Intergenic
1011371784 6:86644775-86644797 CAAATGCAGTGAGGCCAGGGAGG - Intergenic
1013405581 6:109839908-109839930 CCAAGTCTGGGTAGCCAGGGAGG + Intergenic
1013428117 6:110033332-110033354 CCTGGTCAGGGAGGCCTGGGGGG - Intergenic
1016982617 6:149866628-149866650 AGAATTCAGGGAGGCCAGGGTGG + Intergenic
1016986222 6:149897827-149897849 ATAAGGCAGGGAGGACGGGGTGG - Intronic
1017962363 6:159233340-159233362 CTGAGCCTTGGAGGCCAGGGAGG - Exonic
1018095554 6:160384558-160384580 CTAAGCCAGGGGAGCCAGTGGGG + Intronic
1018848941 6:167574036-167574058 AGAGGCCAGGGAGGCCAGGGGGG - Intergenic
1018900053 6:168046501-168046523 TTTAGTCAGGGTGGCCAGGAGGG + Intergenic
1019703128 7:2483880-2483902 CAGAGCCAGGGGGGCCAGGGGGG + Intergenic
1019959693 7:4448932-4448954 CAAAGACAGAGAGACCAGGGAGG + Intergenic
1020686659 7:11304585-11304607 GAAATTCAGGGAGGGCAGGGTGG + Intergenic
1021878277 7:25069096-25069118 CTAAGAAAGAGAGCCCAGGGAGG + Intergenic
1023175867 7:37434826-37434848 TGTAGTCAGGGAGGTCAGGGAGG - Intronic
1025256722 7:57388866-57388888 TTAGGTCAGGGAGGCCACGAGGG - Intergenic
1027454058 7:78365286-78365308 GTACGACAGGGAGGCCAGGGAGG + Intronic
1028574650 7:92333514-92333536 CGGAGTCAGGGAGGTCAGAGAGG - Intronic
1029335311 7:99893818-99893840 TGGAGTCAGGGAGGCCAGGGAGG - Intronic
1029372440 7:100158248-100158270 CGAGGCCAGGGCGGCCAGGGCGG + Exonic
1029415099 7:100437417-100437439 CCAACTCTGGGAGGCCAAGGCGG + Intergenic
1029419522 7:100465675-100465697 ATAGTTCAGGGAGGCCAAGGCGG + Intronic
1029467251 7:100734077-100734099 CCAAGCTAAGGAGGCCAGGGGGG + Exonic
1029693555 7:102198549-102198571 CTACGGCATTGAGGCCAGGGAGG - Intronic
1034158464 7:148974753-148974775 CAAAGTTTGGGAGGCCAAGGTGG + Intergenic
1034275939 7:149823891-149823913 ATAGGGCAGGGAGGCCTGGGGGG + Intergenic
1034456715 7:151174641-151174663 CAAGGTCCGTGAGGCCAGGGTGG + Intronic
1034673344 7:152873152-152873174 CATAAGCAGGGAGGCCAGGGTGG + Intergenic
1034922309 7:155093974-155093996 CTAAGCAAGGCTGGCCAGGGTGG - Intergenic
1035018821 7:155788583-155788605 CGAGGGCAGGGAGGGCAGGGAGG + Intergenic
1036314791 8:7711924-7711946 AAAAGCCAGGGAGGCAAGGGGGG + Intergenic
1037163599 8:15800323-15800345 CTAAGGCTGGGAGGCTAAGGTGG + Intergenic
1037514729 8:19619172-19619194 CTGAGTCAGGAAGGGCAGGTAGG + Intronic
1037833584 8:22203111-22203133 CTAAGTCAGGGATTCCACTGTGG + Intronic
1038345182 8:26725910-26725932 GAAGGTCAGGTAGGCCAGGGTGG - Intergenic
1038439054 8:27558943-27558965 CTCAGAGAGGGAGCCCAGGGCGG + Intergenic
1040656798 8:49519776-49519798 CTCACTGTGGGAGGCCAGGGTGG - Intergenic
1041143528 8:54847110-54847132 TCAAGTCAGAGACGCCAGGGAGG + Intergenic
1041368789 8:57137004-57137026 CTAAGTCAGGCAGGTCAGTTAGG - Intergenic
1045091835 8:98753860-98753882 CTAAGACAAGGAGACCAGTGGGG - Intronic
1046113248 8:109752174-109752196 CCAAGTCAGGCAGGACAGTGAGG - Intergenic
1047726187 8:127685958-127685980 CTAAGTCAGGGAGGTCAGCAAGG - Intergenic
1048993417 8:139774576-139774598 CTAAGGCAGGTGAGCCAGGGAGG - Intronic
1049256010 8:141614312-141614334 CAACATCAGAGAGGCCAGGGAGG + Intergenic
1049533150 8:143166476-143166498 TTAAGTCAGAGATGCCTGGGAGG + Intergenic
1049662200 8:143824493-143824515 ATAAGCAAGGGAGGCCAGGCAGG + Intronic
1049726878 8:144150914-144150936 CTATGTATGGCAGGCCAGGGTGG - Intronic
1051441465 9:17087754-17087776 CCAATTCAGGGAGGCCGAGGTGG + Intergenic
1052764512 9:32627032-32627054 CTAACTTTGGGAGGCCAAGGAGG - Intergenic
1053617966 9:39788775-39788797 ACTAGTCATGGAGGCCAGGGTGG - Intergenic
1053896510 9:42746493-42746515 ACTAGTCATGGAGGCCAGGGAGG + Intergenic
1054266192 9:62918654-62918676 ACTAGTCATGGAGGCCAGGGTGG + Intergenic
1056005998 9:82271915-82271937 TTAAGGCAGGGAGTCCAGGAAGG + Intergenic
1056567953 9:87791441-87791463 GTAGGTGAGGGAGGCCAGGTGGG + Intergenic
1057227309 9:93299190-93299212 CGAAGACAGGGAGGCCCGGACGG - Exonic
1057540918 9:95969119-95969141 CAATGTCAGGGAGGCCAGAGTGG + Intronic
1057569109 9:96190327-96190349 CTGAGTCAGTGGTGCCAGGGAGG - Intergenic
1057751034 9:97793289-97793311 GTAAGTGAGGGAGGCAAGGGAGG + Intergenic
1057884105 9:98816729-98816751 TTGAGTCAGGGAGGCGGGGGTGG - Intronic
1059000367 9:110342330-110342352 CTGAGTCAGCGGGTCCAGGGTGG - Intergenic
1059410589 9:114129799-114129821 CTAATACAGGGAGACCAGAGAGG - Intergenic
1059759597 9:117325499-117325521 CAAATTCAGGGAGGAGAGGGGGG - Intronic
1059805582 9:117796692-117796714 CTGAGTCCTGGAGGCCAGGTAGG + Intergenic
1059896981 9:118877243-118877265 CTGAGCAAGGGAGGACAGGGAGG - Intergenic
1060371532 9:123077786-123077808 CTAAATAAGTGAGTCCAGGGAGG - Intronic
1061483225 9:130907326-130907348 CAAGGGCAGGGAGGCGAGGGAGG - Intronic
1061958374 9:133975350-133975372 CCAAGTGTGGGAGGCCAGGTAGG - Intronic
1062196293 9:135276055-135276077 CCTTGTTAGGGAGGCCAGGGAGG - Intergenic
1062483424 9:136762964-136762986 CTCAGGCAGCGAGGCCAGGCAGG + Intronic
1186476013 X:9858222-9858244 CAACGTCAGGGAGGCCTAGGGGG - Intronic
1186505971 X:10092527-10092549 CTAATTCAGTGAGTCTAGGGTGG - Intronic
1186626275 X:11297014-11297036 CTGAGTCAGAGTGGCCAGGCGGG - Intronic
1187227234 X:17385264-17385286 TTAATTCTGGGAGGCCAAGGTGG + Intronic
1187510228 X:19910919-19910941 CTAACTCAGCGAGGCTAGGTTGG + Intergenic
1187819832 X:23275599-23275621 CTAATTCAGCAAGTCCAGGGTGG + Intergenic
1187991797 X:24882053-24882075 CGGAGTCAGGGAAACCAGGGAGG + Intronic
1188452037 X:30317583-30317605 TTTAGACAGGGGGGCCAGGGAGG - Intergenic
1189331413 X:40146852-40146874 CTGCGTCGGGGAGGCCAGGAAGG - Intronic
1192616265 X:72625911-72625933 CTTAGTTTGGGAGGCCAAGGGGG - Intronic
1195258626 X:103112326-103112348 CTAAGTCAGGAACTCCTGGGTGG - Intergenic
1197777041 X:130125301-130125323 CTAGGTCAAAGAGGACAGGGAGG - Intergenic
1198691794 X:139292771-139292793 CCCAGTCAGGGTTGCCAGGGAGG - Intergenic
1199871619 X:151903423-151903445 CTGAGCCAGGGAGGCCAGGAAGG + Intergenic
1199896081 X:152129228-152129250 TTGAGCCAGGGAGGCCAGGAAGG - Intergenic
1199951182 X:152707255-152707277 CTGAGCCAGGGAAGCCAGGAAGG + Intergenic
1199953827 X:152726478-152726500 CTGAGCCAGGGAGTCCAGGAAGG + Intergenic
1199955860 X:152741976-152741998 CTGAGCCAGGGAGGCCAGGAAGG - Intergenic
1199958500 X:152761206-152761228 CTGAGCCAGGGAAGCCAGGAAGG - Intergenic