ID: 1077318366

View in Genome Browser
Species Human (GRCh38)
Location 11:1929154-1929176
Sequence GTCCCTGCCGCCGGAGGTGC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 322
Summary {0: 1, 1: 0, 2: 1, 3: 15, 4: 305}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1077318355_1077318366 19 Left 1077318355 11:1929112-1929134 CCTGGAAGACACCGCAGAGGAGG 0: 1
1: 0
2: 3
3: 30
4: 292
Right 1077318366 11:1929154-1929176 GTCCCTGCCGCCGGAGGTGCAGG 0: 1
1: 0
2: 1
3: 15
4: 305
1077318359_1077318366 8 Left 1077318359 11:1929123-1929145 CCGCAGAGGAGGACGCGGAAGGT 0: 1
1: 0
2: 0
3: 9
4: 148
Right 1077318366 11:1929154-1929176 GTCCCTGCCGCCGGAGGTGCAGG 0: 1
1: 0
2: 1
3: 15
4: 305
1077318352_1077318366 29 Left 1077318352 11:1929102-1929124 CCTTTTGCCACCTGGAAGACACC 0: 1
1: 1
2: 1
3: 21
4: 205
Right 1077318366 11:1929154-1929176 GTCCCTGCCGCCGGAGGTGCAGG 0: 1
1: 0
2: 1
3: 15
4: 305
1077318353_1077318366 22 Left 1077318353 11:1929109-1929131 CCACCTGGAAGACACCGCAGAGG 0: 1
1: 0
2: 1
3: 25
4: 166
Right 1077318366 11:1929154-1929176 GTCCCTGCCGCCGGAGGTGCAGG 0: 1
1: 0
2: 1
3: 15
4: 305

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1077318366 Original CRISPR GTCCCTGCCGCCGGAGGTGC AGG Intronic
900158667 1:1213346-1213368 GACCCTGCCGCAGGCGGGGCTGG - Intronic
900304131 1:1994935-1994957 GTCCCTGCAGACAGAGGCGCTGG + Intronic
900415431 1:2532467-2532489 TTTCCTGCTGGCGGAGGTGCTGG - Intergenic
901098465 1:6701532-6701554 GACCCTCCCGCCGGGGGTTCCGG - Intronic
902285680 1:15407067-15407089 GTCCCTCCAGCTGGAGATGCTGG - Intergenic
904093444 1:27960401-27960423 GACCCAGCTGACGGAGGTGCTGG - Intronic
904667274 1:32132786-32132808 GTCCCAGCCTCCGGAGTAGCTGG - Intronic
905502560 1:38451218-38451240 TTCCCTGAGGCCGGAGCTGCAGG - Intergenic
905780824 1:40707552-40707574 GCCCCTGCCTCCCGAAGTGCTGG - Intronic
906956704 1:50381262-50381284 GCCCCGGCCTCCCGAGGTGCCGG + Intergenic
914045695 1:144090037-144090059 GTCTCAGCCTCCGGAGTTGCTGG - Intergenic
914132415 1:144870649-144870671 GTCTCAGCCTCCGGAGTTGCTGG + Intergenic
914830500 1:151167393-151167415 GTTGCTGCCGCCGGAAGTACAGG + Exonic
915502226 1:156327540-156327562 GCCCCGGCCTCCCGAGGTGCCGG + Intronic
915597413 1:156903510-156903532 GTCCCTGCCTCTGGAGGTCATGG + Intronic
915608146 1:156968019-156968041 AGCCCTGCCGCCTGTGGTGCTGG + Exonic
917006058 1:170418502-170418524 GCCTCGGCCTCCGGAGGTGCCGG + Intergenic
917825811 1:178819240-178819262 GCCTCAGCCGCCGGAAGTGCTGG + Intronic
920794818 1:209128727-209128749 GCCTCGGCCTCCGGAGGTGCCGG + Intergenic
920864958 1:209744276-209744298 GGCCATGCTGCTGGAGGTGCAGG + Intergenic
922937252 1:229432235-229432257 GGCCCTCCCGCCCGGGGTGCAGG + Intronic
1062843737 10:689530-689552 GGCGCTGCCCCTGGAGGTGCGGG - Exonic
1063367293 10:5499081-5499103 GCCGCTGCCGCAGGAGGAGCTGG - Exonic
1064444217 10:15379247-15379269 CTCCCTGCTGCAGGATGTGCTGG - Intergenic
1065756311 10:28934474-28934496 GCCTCGGCCTCCGGAGGTGCCGG + Intergenic
1068900890 10:62268513-62268535 GACCCTGCCGCGGAAGGTGAGGG - Intronic
1069752589 10:70753820-70753842 GTGCCTGCAGCCGGAGCTGTGGG + Exonic
1071784121 10:88880263-88880285 GTCCCTGCTGCCGCTGCTGCAGG - Exonic
1072664508 10:97384069-97384091 GTCCTGGCTGCCGGAGGTGGAGG - Intronic
1073032222 10:100535943-100535965 GTCCCTGGCGGCGGAGATGGCGG + Exonic
1075013683 10:118895180-118895202 GCCTCGGCCTCCGGAGGTGCCGG + Intergenic
1075051121 10:119182946-119182968 GCCTCGGCCTCCGGAGGTGCCGG - Intergenic
1077108219 11:850971-850993 GCCTCTGCTGCCGGAGGCGCGGG - Intronic
1077318366 11:1929154-1929176 GTCCCTGCCGCCGGAGGTGCAGG + Intronic
1077409499 11:2396870-2396892 GTCCCTGTGGCCAGAGCTGCGGG - Exonic
1077494913 11:2882262-2882284 GTCCCTGCCCCCGGTGGAGGTGG + Intergenic
1079173801 11:18120707-18120729 GCCTCGGCCTCCGGAGGTGCCGG + Intronic
1079320579 11:19448233-19448255 GTCCCTGCCTGAGGAGGTGTGGG + Intronic
1079609376 11:22412716-22412738 GTCCCAGCCTCCGGAGTAGCTGG - Intergenic
1081624237 11:44638204-44638226 GCCTCTGCCTCCGGAAGTGCTGG - Intergenic
1083422398 11:62561553-62561575 GTCCCTGCCTCCCGAGTAGCTGG - Intronic
1083821594 11:65174532-65174554 CTCCCTGACGCCAGAGGAGCTGG - Intergenic
1084028487 11:66467165-66467187 GTCCCTGCGGTCGCGGGTGCGGG + Intronic
1084268322 11:68016295-68016317 GGCCCTGAGGCAGGAGGTGCTGG + Intronic
1084407067 11:68980224-68980246 GAGCCTGCCGCCCGAGATGCAGG - Exonic
1084575629 11:69986289-69986311 GTCCCCGCCACCAGAGGTGGGGG - Intergenic
1085269925 11:75264252-75264274 CTGCCTGCCCCAGGAGGTGCTGG + Exonic
1085360254 11:75878607-75878629 GCCTCGGCCTCCGGAGGTGCCGG - Intronic
1087755120 11:102047335-102047357 GGCCTTGCCGCCGCGGGTGCAGG - Intergenic
1089170866 11:116510648-116510670 GTCCCCGCACCCGGAGCTGCTGG + Intergenic
1091722242 12:2821673-2821695 GTCCCTGCCGGGGGAGAGGCAGG - Exonic
1092331607 12:7590891-7590913 GCCTCGGCCTCCGGAGGTGCTGG - Intergenic
1092346396 12:7718629-7718651 GTCCCTTCCCCTGGAGGTCCCGG + Intergenic
1092383695 12:8019140-8019162 CTCCCTGCCGCAGGCGGTGAGGG - Intergenic
1093343713 12:18013220-18013242 GTCTCTGCCGCCCAAAGTGCTGG - Intergenic
1094839850 12:34338298-34338320 GTTCGTGCCCCCGGAGCTGCTGG + Intergenic
1094841021 12:34342748-34342770 GTCCATGCCTCCGGAGTGGCTGG + Intergenic
1094841594 12:34344705-34344727 GTTCGTGCCTCCGGAGCTGCTGG - Intergenic
1094841702 12:34345066-34345088 GTTCCCGCCGCCGGAGCTGCTGG - Intergenic
1096241186 12:49961311-49961333 GCCCCCGCCGCCGGCGGTGAGGG + Intergenic
1096309174 12:50505182-50505204 GGCGCTGCCGCCTGAAGTGCGGG + Exonic
1097212238 12:57380978-57381000 GTCTCTGCCTCCGAAAGTGCTGG - Intronic
1102089214 12:110172636-110172658 GCCTCGGCCTCCGGAGGTGCCGG + Intronic
1102248110 12:111367923-111367945 GTTCCTGCCTCCGCAGGTCCAGG + Intronic
1104712995 12:130997950-130997972 GCCTCAGCCTCCGGAGGTGCGGG - Intronic
1104869392 12:131983792-131983814 GTCCCTGCCCCCTGAGTAGCTGG + Intronic
1105240914 13:18609303-18609325 GGCGCTGCGGCCGGAGGAGCTGG + Intergenic
1105248384 13:18673569-18673591 GCCTCGGCCTCCGGAGGTGCCGG + Intergenic
1105944092 13:25175153-25175175 GTCCCGGCCTCCCGAAGTGCTGG + Intergenic
1106104635 13:26723396-26723418 GCCTCGGCCTCCGGAGGTGCCGG + Intergenic
1106118633 13:26838711-26838733 GTCCCTGCGGACGGAAGTGTTGG + Intergenic
1107165709 13:37279902-37279924 GCCTCGGCCTCCGGAGGTGCCGG + Intergenic
1107737835 13:43416957-43416979 GCCCCGGCCTCCCGAGGTGCTGG - Intronic
1108024314 13:46162549-46162571 GCCTCGGCCTCCGGAGGTGCTGG + Intronic
1111418482 13:87977287-87977309 GCCTCGGCCTCCGGAGGTGCCGG - Intergenic
1111993027 13:95135661-95135683 GTCTCTGCCTCCAGAAGTGCTGG + Intronic
1112077396 13:95928941-95928963 GCCCCGGCCTCCCGAGGTGCCGG - Intronic
1116928580 14:50667913-50667935 GTCCAAGCCGGCCGAGGTGCAGG - Exonic
1117596757 14:57333339-57333361 GCCTCGGCCTCCGGAGGTGCCGG + Intergenic
1119223825 14:72929057-72929079 GTCCGTGCCGCCCGCAGTGCTGG - Intronic
1120309993 14:82815034-82815056 GCCTCGGCCTCCGGAGGTGCCGG - Intergenic
1120979562 14:90278356-90278378 GCGCCTGCCGCTGGAGGAGCTGG - Exonic
1121336177 14:93078778-93078800 GTCCCTGCGGGGGGAGGGGCAGG - Intronic
1122228455 14:100293026-100293048 GTCTCTGTCCCCGCAGGTGCTGG - Exonic
1122921753 14:104883165-104883187 GTCGCAGCCCCCCGAGGTGCCGG + Exonic
1123034393 14:105466063-105466085 GTCCAGGCCCCCGGAGCTGCTGG - Intronic
1124274895 15:28318375-28318397 GTCTCGGCCTCCGGAAGTGCTGG - Intronic
1124484680 15:30103880-30103902 GCCCCTCCCGCCGGAGGTGAGGG + Intergenic
1124518901 15:30393358-30393380 GCCCCTCCCGCCGGAGGTGAGGG - Exonic
1124539755 15:30572888-30572910 GCCCCTCCCGCCGGAGGTGAGGG + Intergenic
1124758897 15:32434694-32434716 GCCCCTCCCGCCGGAGGTGAGGG - Intergenic
1126573071 15:50172391-50172413 GCCTCGGCCTCCGGAGGTGCCGG + Intronic
1127191969 15:56540425-56540447 GCCTCGGCCTCCGGAGGTGCTGG + Intergenic
1127951491 15:63811558-63811580 GTCTCGGCCGCCGAAAGTGCTGG - Intronic
1128071485 15:64799791-64799813 GCCTCAGCCTCCGGAGGTGCCGG - Intergenic
1128565442 15:68697944-68697966 GTCCCTGCCTGCTGAGGTGCTGG + Intronic
1128669530 15:69564118-69564140 TTCACTGCCTCCGGAAGTGCTGG + Intergenic
1129064999 15:72894959-72894981 GTCCCTGGGGCTGGAGGTGGGGG - Intergenic
1129483177 15:75843640-75843662 GCCCCTCCCGCCGGAGATGAGGG + Exonic
1130001966 15:80055466-80055488 GTCTCGGCCGCCCGAAGTGCTGG - Intergenic
1131084990 15:89568394-89568416 GTCTCTGCCTCCCAAGGTGCTGG - Intergenic
1132186623 15:99806724-99806746 GCCCCTCCCGCCGGAGATGAGGG + Intergenic
1132429064 15:101745987-101746009 GCCCCTCCCGCCGGAGATGAGGG - Intergenic
1132691316 16:1183071-1183093 GTCCCTGCTGCTGGGGGTGTCGG - Intronic
1132902992 16:2268450-2268472 GCCCCTGTCGCCGGCGGTGGAGG + Intergenic
1133002344 16:2857681-2857703 GTTCCTGCCGCAGGAGGTCAGGG - Intronic
1133170587 16:3980482-3980504 GTCCCTGCCTCAGGAGAGGCTGG + Intronic
1133305736 16:4807224-4807246 GTCCCAGCCTCCGGAGTAGCTGG + Intronic
1134137920 16:11691962-11691984 GTCCCTGGCCCTGGAAGTGCCGG - Exonic
1134619044 16:15673751-15673773 GCCTCTGCCACCTGAGGTGCTGG + Intronic
1135233002 16:20727385-20727407 GGCCCTCACCCCGGAGGTGCTGG + Intronic
1136148070 16:28327576-28327598 GTCCCAGCCTCCGGAGTAGCTGG - Intergenic
1136424293 16:30158942-30158964 GTCTCAGCCTCCTGAGGTGCTGG + Intergenic
1136490537 16:30605029-30605051 GTCGCTGCTTCCGGAGGAGCCGG - Exonic
1136513597 16:30754413-30754435 GTCCCAGCCTCCAGAAGTGCTGG + Intronic
1138434541 16:56989725-56989747 GGCCCTGGAGCGGGAGGTGCGGG + Intronic
1140513330 16:75524246-75524268 GTCCCAGCCTCCCGAAGTGCTGG + Intergenic
1141098428 16:81179457-81179479 GTCCCAGCCTCCTGAAGTGCTGG - Intergenic
1141523036 16:84594077-84594099 ATCCCTGCTGCCGCATGTGCGGG + Intronic
1141695078 16:85615256-85615278 ATCCCGGCCGCCGGCTGTGCAGG + Intronic
1142597020 17:1034848-1034870 CTCCCTGCCGCCGGGTGTGGGGG + Intronic
1142949088 17:3464229-3464251 GCCTCGGCCTCCGGAGGTGCCGG + Intronic
1143166051 17:4897738-4897760 GTCCCTGCCCCTGGAGTGGCTGG - Exonic
1143395647 17:6593460-6593482 CGCCCTGCCTCCGGAAGTGCTGG - Intronic
1144704442 17:17357996-17358018 ATCTCTGCAGCCTGAGGTGCTGG - Intergenic
1146259121 17:31410359-31410381 GTATCTGCAGCCGCAGGTGCAGG - Intronic
1146909049 17:36636472-36636494 GTCCCGGCCTCCCCAGGTGCTGG + Intergenic
1147045042 17:37745491-37745513 GTCCCGGCCGACGCAGGTGGTGG + Intergenic
1148826462 17:50397621-50397643 GTCGCCGCCGCCGGAGGGGTGGG + Intergenic
1149141133 17:53434991-53435013 GTTCCAGCCGCTGGTGGTGCTGG + Intergenic
1150822443 17:68446296-68446318 GTCCCTGCCACCCGAGAGGCTGG - Intronic
1151301936 17:73232894-73232916 GTCCCTGACCCAGGAGCTGCCGG + Intronic
1151370027 17:73642096-73642118 GCCCCTCCCGCAGGAGGCGCAGG + Intronic
1151601683 17:75109923-75109945 GTCCCTACCCCCGAAGGGGCGGG - Intergenic
1152071051 17:78133744-78133766 GCCCCTGCAGCCCCAGGTGCAGG - Intronic
1152409538 17:80116425-80116447 TTTCCTGCCCCCGGACGTGCAGG - Intergenic
1154265033 18:12873537-12873559 GCCTCGGCCTCCGGAGGTGCCGG + Intronic
1154397773 18:14007017-14007039 GTCTCGGCCTCCTGAGGTGCTGG - Intergenic
1154448056 18:14450605-14450627 GGCGCTGCGGCCGGAGGAGCTGG - Intergenic
1156282955 18:35658822-35658844 GTCCCAGCCTCCCGAGTTGCTGG + Intronic
1156325424 18:36070244-36070266 GTCCCTGCCTCCCAAAGTGCTGG + Intergenic
1158646788 18:59255227-59255249 GCCTCTGCCTCCTGAGGTGCCGG + Intergenic
1160725533 19:616410-616432 GTCCAGGCCGCCGGCGGCGCCGG - Exonic
1160834146 19:1116716-1116738 GCCCCAGCAGCAGGAGGTGCTGG - Intronic
1163159748 19:15457552-15457574 GGCCCTGGCGCTGGAGGAGCTGG - Exonic
1163948874 19:20565759-20565781 GTCTCTGCAGCCGGAGCTCCAGG - Intronic
1166735110 19:45079389-45079411 GTCCCTCCAGCCGGCGCTGCAGG - Intronic
1167045175 19:47045459-47045481 CTTCCTGCCGCCGGTGGTGCGGG + Exonic
1168717468 19:58537950-58537972 GTCCCAGCCTCCGGAGTAGCTGG + Intronic
925097905 2:1222519-1222541 CTGCCTGCTGCTGGAGGTGCTGG + Intronic
925097917 2:1222589-1222611 CTGCCTGCTGCTGGAGGTGCTGG + Intronic
925097940 2:1222729-1222751 CTGCCTGCTGCTGGAGGTGCTGG + Intronic
925097952 2:1222799-1222821 CTGCCTGCTGCTGGAGGTGCTGG + Intronic
925097964 2:1222869-1222891 CTGCCTGCTGCTGGAGGTGCTGG + Intronic
925097989 2:1223009-1223031 CTGCCTGCTGCTGGAGGTGCTGG + Intronic
925098001 2:1223079-1223101 CTGCCTGCTGCTGGAGGTGCTGG + Intronic
925098013 2:1223149-1223171 CTGCCTGCTGCTGGAGGTGCTGG + Intronic
925098025 2:1223219-1223241 CTGCCTGCTGCTGGAGGTGCTGG + Intronic
925098035 2:1223289-1223311 CTGCCTGCTGCTGGAGGTGCTGG + Intronic
927497796 2:23562411-23562433 CTCGCTGCTGCCGGTGGTGCAGG - Exonic
927783243 2:25955564-25955586 ATCCCTGCAGCAGGAGGTGGAGG - Exonic
928542321 2:32294813-32294835 GCCTCGGCCTCCGGAGGTGCCGG - Intronic
928823627 2:35392189-35392211 TTCCCGGCCGCCTGGGGTGCAGG + Intergenic
929577894 2:43063754-43063776 GCCTCGGCCTCCGGAGGTGCCGG - Intergenic
931207139 2:60158847-60158869 GTCTCAGCCTCCGGAGTTGCTGG - Intergenic
932440992 2:71735133-71735155 GTCTCTGCCTCCTGAAGTGCTGG + Intergenic
932750827 2:74370690-74370712 GTCCCTGCAGCAGGAGGTGGAGG - Exonic
934246472 2:90311410-90311432 GTCTCAGCCTCCGGAGTTGCTGG + Intergenic
934564318 2:95330048-95330070 GTGGCTGCGGCCGGAGGTGAGGG - Intronic
935137650 2:100321808-100321830 GGCGCTGCGGCCGGAGGAGCTGG - Exonic
937096804 2:119240864-119240886 GTCCCTGCGGCCTGAGGTGAGGG - Intronic
938174022 2:129107848-129107870 GTCCCTGCCTCCACAGGTGCAGG + Intergenic
938562763 2:132489325-132489347 GTCCCTGCCCTCGGTGCTGCCGG - Intronic
940887499 2:159002170-159002192 GGACCTGCGGCCGGAGGGGCTGG + Intronic
941106976 2:161364988-161365010 GTCTCAGCCTCCTGAGGTGCTGG - Intronic
1168805980 20:672637-672659 GACCCTGCAGCCCGAGCTGCAGG + Intronic
1170811746 20:19679249-19679271 GCCTCGGCCTCCGGAGGTGCTGG - Intronic
1171861119 20:30404467-30404489 GCCTCGGCCTCCGGAGGTGCCGG + Intergenic
1172111150 20:32545755-32545777 GTCCCAGGGGCTGGAGGTGCAGG + Intronic
1172279178 20:33698738-33698760 GCCTCGGCCTCCGGAGGTGCCGG + Intergenic
1173859011 20:46269881-46269903 GCCCCTGCCTCCAGAGGTCCAGG - Intronic
1173980301 20:47218965-47218987 GCCTCTGCCTCCGGAAGTGCTGG - Intronic
1175111508 20:56651650-56651672 GCCCCTGCCTCCCGAAGTGCTGG + Intergenic
1175952728 20:62592089-62592111 GTCCCTGGCTCCAGAGGTGGGGG - Intergenic
1176112973 20:63418884-63418906 GTGCATGCCGCCGGTGGTGCTGG - Intronic
1176177826 20:63737041-63737063 GACCCTGCACCCGGAGGAGCTGG - Intronic
1176200536 20:63858378-63858400 GTCCCAGAGGCCGGAGGGGCAGG - Intergenic
1176448174 21:6840088-6840110 GGCGCTGCGGCCGGAGGAGCTGG + Intergenic
1176826344 21:13705110-13705132 GGCGCTGCGGCCGGAGGAGCTGG + Intergenic
1177609234 21:23423919-23423941 GTCTCTGCCTCCCGAAGTGCTGG - Intergenic
1177905284 21:26966247-26966269 CCCCCTGCCGCCGGCGGGGCTGG + Exonic
1178799401 21:35778466-35778488 GGCCCTGCCTCTGGAGGTTCTGG - Intronic
1179195090 21:39156878-39156900 GCCTCGGCCTCCGGAGGTGCCGG + Intergenic
1179209424 21:39313174-39313196 GTCCCCGCCGCCGGGGGTCGCGG - Intronic
1179803228 21:43821835-43821857 GCCTCGGCCTCCGGAGGTGCCGG + Intergenic
1179969048 21:44824331-44824353 GCCTCGGCCTCCGGAGGTGCCGG + Intergenic
1179985543 21:44918737-44918759 GTCGATGCCGCCTGAGGGGCAGG + Intronic
1180109328 21:45640741-45640763 GGCCCTGCCGCTGGGAGTGCTGG + Intergenic
1180823143 22:18845917-18845939 GTCTCAGCCGCCGGAGTAGCTGG + Intergenic
1180908444 22:19431805-19431827 GCCCCTGCCAGCGGAGGAGCCGG - Intronic
1180951862 22:19724047-19724069 GGCGCTGCCGCCGGGGCTGCTGG + Exonic
1181123569 22:20689016-20689038 GTCTCAGCCGCCGGAGTAGCTGG + Intergenic
1181189601 22:21128629-21128651 GTCTCAGCCGCCGGAGTAGCTGG - Intergenic
1181189820 22:21130090-21130112 GTCTCAGCCGCCGGAGTAGCTGG - Intergenic
1181209384 22:21280415-21280437 GTCTCAGCCGCCGGAGTAGCTGG + Intergenic
1181209602 22:21281866-21281888 GTCTCAGCCGCCGGAGTAGCTGG + Intergenic
1181442073 22:22941867-22941889 GGCCCTGCTGCTGGAGGTGCTGG - Intergenic
1181649500 22:24250990-24251012 GTCTCAGCCGCCGGAGCAGCTGG + Intergenic
1181684085 22:24516530-24516552 ATTCCTGCAGCAGGAGGTGCTGG + Intronic
1181707871 22:24659756-24659778 GTCTCAGCCGCCGGAGCAGCTGG - Intergenic
1181708086 22:24661217-24661239 GTCTCAGCCGCCGGAGTAGCTGG - Intergenic
1182572327 22:31248599-31248621 CTGCCTGCAGCCAGAGGTGCCGG + Exonic
1182961144 22:34476393-34476415 GTCCCTGTGGCTGGAAGTGCAGG + Intergenic
1183064936 22:35356282-35356304 GTCTCTGCCGCCCAAAGTGCTGG - Intergenic
1183241294 22:36659927-36659949 CTCCCTGCCACCAGAGCTGCAGG + Intronic
1183782580 22:40008239-40008261 GTCTGTGCCGCGGGAGGCGCGGG + Intronic
1183995861 22:41631874-41631896 GCCTCGGCCTCCGGAGGTGCCGG - Intronic
1184816742 22:46877945-46877967 TTCCCTGCCCTTGGAGGTGCTGG + Intronic
1203217346 22_KI270731v1_random:13567-13589 GTCTCAGCCGCCGGAGTAGCTGG - Intergenic
1203273282 22_KI270734v1_random:71823-71845 GTCTCAGCCGCCGGAGTAGCTGG + Intergenic
949168225 3:966459-966481 GTTTCTGCCGCCGGAGTAGCCGG + Intergenic
950024813 3:9812989-9813011 GTCTCTTGCGCCGGAGGGGCTGG + Exonic
951264328 3:20548516-20548538 GCCTCGGCCTCCGGAGGTGCCGG - Intergenic
953153026 3:40342655-40342677 GTCCCAGCCTCCGGAGTTGCAGG + Intergenic
953959402 3:47256009-47256031 GCCCCGGCCTCCCGAGGTGCCGG + Intronic
955363228 3:58291125-58291147 GCCTCGGCCTCCGGAGGTGCCGG - Intronic
956666786 3:71649624-71649646 GTCCATGCCCCCGCATGTGCTGG - Intergenic
956746513 3:72315095-72315117 GTCCTTGCCTCAGAAGGTGCTGG - Intergenic
963491610 3:146008588-146008610 GTCCCAGCCTCCGGAGTAGCTGG - Intergenic
964569245 3:158094621-158094643 GGCCCTGCTGGCGGAGGCGCCGG - Intergenic
965566955 3:170129812-170129834 GTCTCTGCCTCCGGAGTAGCTGG + Intronic
967168715 3:186806841-186806863 GTGCGGGCCTCCGGAGGTGCAGG + Intronic
967914636 3:194569508-194569530 GTCTCTGCCTCCGAAAGTGCTGG - Intergenic
968056306 3:195694614-195694636 GTCCCTGTCGCAGGAGATGAAGG + Intergenic
969662662 4:8539267-8539289 GTCCCTGCCACCAGGGGAGCTGG + Intergenic
971594965 4:28515524-28515546 GCCTCAGCCTCCGGAGGTGCCGG - Intergenic
975578192 4:75883878-75883900 GTCCCAGCCTCCCGAAGTGCTGG - Intronic
975633342 4:76422987-76423009 GCCTCGGCCTCCGGAGGTGCCGG + Intergenic
975683338 4:76897308-76897330 GCCCCTGCCGCTGCAGCTGCGGG + Exonic
976340989 4:83944408-83944430 GCCTCGGCCTCCGGAGGTGCCGG - Intergenic
978172814 4:105694438-105694460 GTCTCAGCCTCCTGAGGTGCTGG + Intronic
978994419 4:115131745-115131767 TTCCCTGCCTCCTGTGGTGCTGG - Intergenic
979622251 4:122811441-122811463 GCCTCAGCCTCCGGAGGTGCCGG + Intergenic
981366635 4:143911999-143912021 GTCCAAGCCGGCCGAGGTGCAGG - Intergenic
982709832 4:158747223-158747245 GCCTCGGCCTCCGGAGGTGCTGG - Intergenic
983904563 4:173169581-173169603 CTCCCCGCCGCCGGAGTTGAGGG - Intronic
984811331 4:183798183-183798205 GTCCCTGCCGGGGGAGGAGCCGG + Intergenic
985550957 5:533413-533435 GTTGCTGCCTCCGGATGTGCGGG + Intergenic
989574638 5:42978945-42978967 GCCTCGGCCTCCGGAGGTGCCGG + Intergenic
992442858 5:76811854-76811876 GCCTCGGCCTCCGGAGGTGCCGG + Intergenic
992561617 5:77958095-77958117 CTCCCGGCCGCCCGAGGTGGGGG - Intergenic
993391376 5:87322488-87322510 GTCCCTGGTGCCGGAGGTTGGGG + Intronic
993658010 5:90596536-90596558 GCCTCTGCCTCCCGAGGTGCGGG - Intronic
997457421 5:134027454-134027476 CTCCCTGCAGCCTGAGCTGCTGG - Intergenic
997582369 5:135026028-135026050 GACCCTGCAGCCGGAGCAGCGGG + Intergenic
998706576 5:144768894-144768916 GTCTCTGCCTCCAAAGGTGCTGG + Intergenic
999748488 5:154609561-154609583 TTCCCTTCCACCGGAGGGGCAGG - Intergenic
1000103558 5:158037742-158037764 GCCTCTGCCTCCCGAGGTGCCGG - Intergenic
1001528641 5:172446641-172446663 TTGCCTCCCACCGGAGGTGCAGG - Intronic
1001942521 5:175750725-175750747 GTCCCTGCCGCCCGGGGTGCTGG - Intergenic
1002524516 5:179807544-179807566 GGCCCTGCCCCCGGTGGTGTAGG + Intronic
1003139218 6:3456943-3456965 GGCCCTGCGGGCGGCGGTGCGGG + Intronic
1005532372 6:26721060-26721082 GTCCGTTCCGCCGGCGGGGCCGG - Intergenic
1005538423 6:26780605-26780627 GTCCGTTCCGCCGGCGGGGCCGG + Intergenic
1007631593 6:43275952-43275974 GCCCCTGCCCCCGGAGAAGCGGG + Intronic
1008952148 6:57172642-57172664 CTCGCTGCCGCCGGAGGGGCCGG + Exonic
1010980730 6:82365630-82365652 TTACCTGCCGCGGGATGTGCTGG + Exonic
1012428573 6:99141626-99141648 GCCTCGGCCTCCGGAGGTGCCGG + Intergenic
1013220601 6:108074417-108074439 GTCGCTGCCCCCGGACCTGCCGG - Exonic
1018371005 6:163168389-163168411 GTCCCTGGGGCCGGGGTTGCGGG + Intronic
1018976618 6:168572178-168572200 GTCCCGGCACCCGGAGATGCGGG - Intronic
1018976795 6:168572860-168572882 GTCCCAGCACCCGGAGATGCGGG - Intronic
1018976941 6:168573418-168573440 GTCCCAGCACCCGGAGATGCGGG - Intronic
1019662296 7:2231490-2231512 GTCCCAGCCTCCGGAGTAGCTGG - Intronic
1021647259 7:22800496-22800518 GCCTCGGCCTCCGGAGGTGCCGG + Intergenic
1021672595 7:23047122-23047144 GCCTCGGCCTCCGGAGGTGCCGG - Intergenic
1022357396 7:29629147-29629169 GTCTCTGCCTCCCAAGGTGCTGG - Intergenic
1022734524 7:33063243-33063265 GTCCCTTCCGCCGCAGCCGCGGG + Intergenic
1026706853 7:72701511-72701533 GTCCCAGCCTCCCGAAGTGCTGG + Intronic
1028987395 7:97018841-97018863 GTCGCGGCCGCTGGGGGTGCCGG + Intergenic
1029525593 7:101092037-101092059 GCCTCGGCCTCCGGAGGTGCCGG + Intergenic
1029730208 7:102433701-102433723 GTCCCTGCGGCTGGGGGGGCCGG + Intronic
1031293252 7:119966793-119966815 GTCTCAGCCTCCTGAGGTGCTGG - Intergenic
1032620751 7:133528901-133528923 GTCCCTAGAGCCAGAGGTGCAGG - Intronic
1033234844 7:139630222-139630244 GCCCCTGCCCCCGGAGTTTCAGG + Intronic
1034268300 7:149791572-149791594 GGCCCTGCAGCCGGACGTGTGGG + Intergenic
1034421081 7:150991282-150991304 GTACCTGCTGCAGAAGGTGCTGG - Exonic
1034522068 7:151628139-151628161 CTCCCAGCTGCCGGAGGAGCTGG - Intronic
1034886709 7:154803892-154803914 GTCCCAGTCCCCGGAGGTGATGG - Exonic
1035633544 8:1126895-1126917 GGCCCTGCCTCAGGAGGAGCTGG - Intergenic
1036033612 8:4996158-4996180 CTCCCTGCAGCCTAAGGTGCAGG + Intergenic
1036664681 8:10730722-10730744 GGCCCTGGCGGCGGAGGGGCGGG - Intronic
1037080654 8:14781341-14781363 TTCTCTGCCTCCGGAGGAGCTGG + Intronic
1037946493 8:22992902-22992924 GTCCCTGCTGGCAGAGGTGTGGG - Intronic
1039473470 8:37827436-37827458 GTCCCTGCAGCCCCAGGGGCAGG + Intronic
1041884809 8:62796132-62796154 GTCTCTGCCTCCGAAAGTGCTGG - Intronic
1044134955 8:88574631-88574653 TTCCCTGCCCCCAGAGGTGGAGG - Intergenic
1044240500 8:89882705-89882727 TTACCTGCAGGCGGAGGTGCTGG - Intergenic
1045192058 8:99893122-99893144 GTACCTGCCGCAGGAGGGGAAGG - Intronic
1045389329 8:101700173-101700195 GTCCCAGCCTCCTGAGTTGCTGG + Intronic
1047388718 8:124432577-124432599 GCCTCGGCCTCCGGAGGTGCCGG - Intergenic
1048554033 8:135457771-135457793 GTCCCCGCCGCTGGGGGCGCGGG + Exonic
1049571126 8:143370783-143370805 GTCCCTCCCGCAGGGGCTGCAGG + Intronic
1050219039 9:3365050-3365072 GTCCCGGCCTCCCGAAGTGCTGG - Intronic
1053047995 9:34936318-34936340 GCCTCGGCCTCCGGAGGTGCCGG + Intergenic
1057099527 9:92344917-92344939 GTCTCTGCCTCCTGAAGTGCTGG - Intronic
1057758321 9:97853938-97853960 GCCGCCGCAGCCGGAGGTGCTGG + Exonic
1059935227 9:119303776-119303798 GTCCCTGCTGCTGGATTTGCAGG + Intronic
1060351662 9:122866654-122866676 GCCTCGGCCTCCGGAGGTGCCGG + Intronic
1060399374 9:123339293-123339315 CTTCCTGCCGCCTGAGGAGCGGG - Intergenic
1061712745 9:132499034-132499056 GTCCCTGCCGGCGGCGGGGAAGG - Intronic
1061975174 9:134064609-134064631 GTCTCTGCCTCCTGAAGTGCTGG - Intronic
1062095703 9:134702067-134702089 GGCCCTGCCTCCTGGGGTGCTGG + Intronic
1203521017 Un_GL000213v1:44430-44452 GGCGCTGCGGCCGGAGGAGCTGG - Intergenic
1203449539 Un_GL000219v1:99387-99409 GAGGCTCCCGCCGGAGGTGCAGG + Intergenic
1186515040 X:10160709-10160731 GTCCGTGTCGCTGGTGGTGCGGG - Intronic
1191009759 X:55748117-55748139 GCCTCGGCCTCCGGAGGTGCCGG + Intronic
1191253545 X:58270354-58270376 GGCCCTGGCGCAGGAGATGCTGG + Intergenic
1194803604 X:98300884-98300906 GTGCCTGCCCCCAGAGGTGGAGG - Intergenic
1200063265 X:153492963-153492985 ATGCCTGCTGCCCGAGGTGCTGG - Intronic
1200070637 X:153527357-153527379 GTCCCTGCCTTCGGGGCTGCTGG + Intronic
1201948208 Y:19535448-19535470 GCCTCCGCCTCCGGAGGTGCCGG + Intergenic