ID: 1077320887

View in Genome Browser
Species Human (GRCh38)
Location 11:1941402-1941424
Sequence GAGGTCAGGAGTTGATCAGC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1077320887_1077320897 14 Left 1077320887 11:1941402-1941424 CCAGCTGATCAACTCCTGACCTC No data
Right 1077320897 11:1941439-1941461 CCTCGGCCTCTCAAAGTGCTGGG 0: 3703
1: 132968
2: 280371
3: 208243
4: 120614
1077320887_1077320895 13 Left 1077320887 11:1941402-1941424 CCAGCTGATCAACTCCTGACCTC No data
Right 1077320895 11:1941438-1941460 GCCTCGGCCTCTCAAAGTGCTGG 0: 2282
1: 90269
2: 217940
3: 224476
4: 149748
1077320887_1077320891 -3 Left 1077320887 11:1941402-1941424 CCAGCTGATCAACTCCTGACCTC No data
Right 1077320891 11:1941422-1941444 CTCAGGTGATCCACCCGCCTCGG 0: 9760
1: 41176
2: 65950
3: 79127
4: 86302
1077320887_1077320899 22 Left 1077320887 11:1941402-1941424 CCAGCTGATCAACTCCTGACCTC No data
Right 1077320899 11:1941447-1941469 TCTCAAAGTGCTGGGATTACAGG 0: 10757
1: 300314
2: 262016
3: 147673
4: 132180

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1077320887 Original CRISPR GAGGTCAGGAGTTGATCAGC TGG (reversed) Intergenic
No off target data available for this crispr