ID: 1077320891

View in Genome Browser
Species Human (GRCh38)
Location 11:1941422-1941444
Sequence CTCAGGTGATCCACCCGCCT CGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 282315
Summary {0: 9760, 1: 41176, 2: 65950, 3: 79127, 4: 86302}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1077320887_1077320891 -3 Left 1077320887 11:1941402-1941424 CCAGCTGATCAACTCCTGACCTC No data
Right 1077320891 11:1941422-1941444 CTCAGGTGATCCACCCGCCTCGG 0: 9760
1: 41176
2: 65950
3: 79127
4: 86302
1077320885_1077320891 6 Left 1077320885 11:1941393-1941415 CCCTGTTGGCCAGCTGATCAACT No data
Right 1077320891 11:1941422-1941444 CTCAGGTGATCCACCCGCCTCGG 0: 9760
1: 41176
2: 65950
3: 79127
4: 86302
1077320886_1077320891 5 Left 1077320886 11:1941394-1941416 CCTGTTGGCCAGCTGATCAACTC No data
Right 1077320891 11:1941422-1941444 CTCAGGTGATCCACCCGCCTCGG 0: 9760
1: 41176
2: 65950
3: 79127
4: 86302

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1077320891 Original CRISPR CTCAGGTGATCCACCCGCCT CGG Intergenic
Too many off-targets to display for this crispr