ID: 1077320895

View in Genome Browser
Species Human (GRCh38)
Location 11:1941438-1941460
Sequence GCCTCGGCCTCTCAAAGTGC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 684715
Summary {0: 2282, 1: 90269, 2: 217940, 3: 224476, 4: 149748}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1077320887_1077320895 13 Left 1077320887 11:1941402-1941424 CCAGCTGATCAACTCCTGACCTC No data
Right 1077320895 11:1941438-1941460 GCCTCGGCCTCTCAAAGTGCTGG 0: 2282
1: 90269
2: 217940
3: 224476
4: 149748
1077320889_1077320895 -1 Left 1077320889 11:1941416-1941438 CCTGACCTCAGGTGATCCACCCG 0: 13130
1: 55640
2: 86423
3: 98097
4: 93725
Right 1077320895 11:1941438-1941460 GCCTCGGCCTCTCAAAGTGCTGG 0: 2282
1: 90269
2: 217940
3: 224476
4: 149748
1077320890_1077320895 -6 Left 1077320890 11:1941421-1941443 CCTCAGGTGATCCACCCGCCTCG 0: 5257
1: 30546
2: 69308
3: 90324
4: 89601
Right 1077320895 11:1941438-1941460 GCCTCGGCCTCTCAAAGTGCTGG 0: 2282
1: 90269
2: 217940
3: 224476
4: 149748
1077320885_1077320895 22 Left 1077320885 11:1941393-1941415 CCCTGTTGGCCAGCTGATCAACT No data
Right 1077320895 11:1941438-1941460 GCCTCGGCCTCTCAAAGTGCTGG 0: 2282
1: 90269
2: 217940
3: 224476
4: 149748
1077320886_1077320895 21 Left 1077320886 11:1941394-1941416 CCTGTTGGCCAGCTGATCAACTC No data
Right 1077320895 11:1941438-1941460 GCCTCGGCCTCTCAAAGTGCTGG 0: 2282
1: 90269
2: 217940
3: 224476
4: 149748

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1077320895 Original CRISPR GCCTCGGCCTCTCAAAGTGC TGG Intergenic
Too many off-targets to display for this crispr