ID: 1077320897

View in Genome Browser
Species Human (GRCh38)
Location 11:1941439-1941461
Sequence CCTCGGCCTCTCAAAGTGCT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 745899
Summary {0: 3703, 1: 132968, 2: 280371, 3: 208243, 4: 120614}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1077320886_1077320897 22 Left 1077320886 11:1941394-1941416 CCTGTTGGCCAGCTGATCAACTC No data
Right 1077320897 11:1941439-1941461 CCTCGGCCTCTCAAAGTGCTGGG 0: 3703
1: 132968
2: 280371
3: 208243
4: 120614
1077320887_1077320897 14 Left 1077320887 11:1941402-1941424 CCAGCTGATCAACTCCTGACCTC No data
Right 1077320897 11:1941439-1941461 CCTCGGCCTCTCAAAGTGCTGGG 0: 3703
1: 132968
2: 280371
3: 208243
4: 120614
1077320889_1077320897 0 Left 1077320889 11:1941416-1941438 CCTGACCTCAGGTGATCCACCCG 0: 13130
1: 55640
2: 86423
3: 98097
4: 93725
Right 1077320897 11:1941439-1941461 CCTCGGCCTCTCAAAGTGCTGGG 0: 3703
1: 132968
2: 280371
3: 208243
4: 120614
1077320890_1077320897 -5 Left 1077320890 11:1941421-1941443 CCTCAGGTGATCCACCCGCCTCG 0: 5257
1: 30546
2: 69308
3: 90324
4: 89601
Right 1077320897 11:1941439-1941461 CCTCGGCCTCTCAAAGTGCTGGG 0: 3703
1: 132968
2: 280371
3: 208243
4: 120614
1077320885_1077320897 23 Left 1077320885 11:1941393-1941415 CCCTGTTGGCCAGCTGATCAACT No data
Right 1077320897 11:1941439-1941461 CCTCGGCCTCTCAAAGTGCTGGG 0: 3703
1: 132968
2: 280371
3: 208243
4: 120614

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1077320897 Original CRISPR CCTCGGCCTCTCAAAGTGCT GGG Intergenic
Too many off-targets to display for this crispr