ID: 1077320899

View in Genome Browser
Species Human (GRCh38)
Location 11:1941447-1941469
Sequence TCTCAAAGTGCTGGGATTAC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 852940
Summary {0: 10757, 1: 300314, 2: 262016, 3: 147673, 4: 132180}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1077320887_1077320899 22 Left 1077320887 11:1941402-1941424 CCAGCTGATCAACTCCTGACCTC No data
Right 1077320899 11:1941447-1941469 TCTCAAAGTGCTGGGATTACAGG 0: 10757
1: 300314
2: 262016
3: 147673
4: 132180
1077320886_1077320899 30 Left 1077320886 11:1941394-1941416 CCTGTTGGCCAGCTGATCAACTC No data
Right 1077320899 11:1941447-1941469 TCTCAAAGTGCTGGGATTACAGG 0: 10757
1: 300314
2: 262016
3: 147673
4: 132180
1077320892_1077320899 -8 Left 1077320892 11:1941432-1941454 CCACCCGCCTCGGCCTCTCAAAG 0: 847
1: 43499
2: 128645
3: 196417
4: 146482
Right 1077320899 11:1941447-1941469 TCTCAAAGTGCTGGGATTACAGG 0: 10757
1: 300314
2: 262016
3: 147673
4: 132180
1077320890_1077320899 3 Left 1077320890 11:1941421-1941443 CCTCAGGTGATCCACCCGCCTCG 0: 5257
1: 30546
2: 69308
3: 90324
4: 89601
Right 1077320899 11:1941447-1941469 TCTCAAAGTGCTGGGATTACAGG 0: 10757
1: 300314
2: 262016
3: 147673
4: 132180
1077320889_1077320899 8 Left 1077320889 11:1941416-1941438 CCTGACCTCAGGTGATCCACCCG 0: 13130
1: 55640
2: 86423
3: 98097
4: 93725
Right 1077320899 11:1941447-1941469 TCTCAAAGTGCTGGGATTACAGG 0: 10757
1: 300314
2: 262016
3: 147673
4: 132180

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1077320899 Original CRISPR TCTCAAAGTGCTGGGATTAC AGG Intergenic
Too many off-targets to display for this crispr