ID: 1077322444

View in Genome Browser
Species Human (GRCh38)
Location 11:1948299-1948321
Sequence AGGAAGAAAAGGTCTGAGTG AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 666
Summary {0: 2, 1: 0, 2: 2, 3: 46, 4: 616}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1077322437_1077322444 4 Left 1077322437 11:1948272-1948294 CCTGACCTTGGGGAACACCCAGC 0: 2
1: 0
2: 1
3: 27
4: 299
Right 1077322444 11:1948299-1948321 AGGAAGAAAAGGTCTGAGTGAGG 0: 2
1: 0
2: 2
3: 46
4: 616
1077322438_1077322444 -1 Left 1077322438 11:1948277-1948299 CCTTGGGGAACACCCAGCACCAA 0: 2
1: 0
2: 2
3: 16
4: 209
Right 1077322444 11:1948299-1948321 AGGAAGAAAAGGTCTGAGTGAGG 0: 2
1: 0
2: 2
3: 46
4: 616
1077322432_1077322444 21 Left 1077322432 11:1948255-1948277 CCGGTGCTGCGCGTGGCCCTGAC 0: 2
1: 0
2: 0
3: 7
4: 187
Right 1077322444 11:1948299-1948321 AGGAAGAAAAGGTCTGAGTGAGG 0: 2
1: 0
2: 2
3: 46
4: 616
1077322436_1077322444 5 Left 1077322436 11:1948271-1948293 CCCTGACCTTGGGGAACACCCAG 0: 2
1: 0
2: 4
3: 29
4: 249
Right 1077322444 11:1948299-1948321 AGGAAGAAAAGGTCTGAGTGAGG 0: 2
1: 0
2: 2
3: 46
4: 616
1077322430_1077322444 28 Left 1077322430 11:1948248-1948270 CCTGGGACCGGTGCTGCGCGTGG 0: 2
1: 0
2: 1
3: 10
4: 108
Right 1077322444 11:1948299-1948321 AGGAAGAAAAGGTCTGAGTGAGG 0: 2
1: 0
2: 2
3: 46
4: 616

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1077322444 Original CRISPR AGGAAGAAAAGGTCTGAGTG AGG Intronic
900719587 1:4166687-4166709 AGGGAGGAAAAGTCTGAGAGAGG - Intergenic
900847078 1:5112518-5112540 AGGAAGGAAAGGGCTAAATGAGG + Intergenic
901147198 1:7073243-7073265 AGAAAGAAGGGGTGTGAGTGTGG + Intronic
901519115 1:9769072-9769094 AGGAAGGAAAGGACAGAGGGAGG + Intronic
901981938 1:13043199-13043221 TGGAAGAAAGGGTATCAGTGAGG - Intronic
902000145 1:13185714-13185736 TGGAAGAAAGGGTATCAGTGAGG + Intergenic
902019393 1:13331481-13331503 TGGAAGAAAGGGTATCAGTGAGG + Intergenic
902859315 1:19233494-19233516 AGCCAGAAGAGGTATGAGTGTGG + Intronic
903348411 1:22702678-22702700 AGAAAGTAAAGGGCTGAGTTGGG + Intergenic
903645741 1:24895386-24895408 AGGAAATAAAGATCTGAATGGGG + Intergenic
905139330 1:35829031-35829053 AGCAAAAAAAGGTGTGTGTGTGG - Intronic
905225388 1:36475437-36475459 AGGAGAGAAAGGCCTGAGTGTGG + Exonic
905816862 1:40957984-40958006 AAGAAAAAATGGTCTGGGTGTGG + Intergenic
906288461 1:44603691-44603713 AGGAAGAAAAGGGCTGGGTGGGG - Intronic
906366541 1:45214887-45214909 AGGAAGAAAAAGCCTGAGCTTGG - Intronic
906493485 1:46286123-46286145 AGGATGAAAAGGGCTGACTCAGG + Exonic
906947962 1:50311514-50311536 AGGGAGAAGAGGTCAGAGTAGGG + Intergenic
907087734 1:51692579-51692601 AGGAAGAAAAGGAGGGAGGGAGG - Intronic
908103272 1:60813182-60813204 AGGAGGAAAAGGCCTGAGAGGGG - Intergenic
908372644 1:63498825-63498847 AGGAAGAAAAGGAGGGAGGGAGG + Intronic
909055618 1:70817268-70817290 AGGAAGGAAGGGACTGAGGGAGG + Intergenic
909179079 1:72397808-72397830 AGGAAGAAAAGCTGGGTGTGGGG + Intergenic
909234287 1:73132534-73132556 AGAAGGAAAATGTCAGAGTGAGG + Intergenic
909472889 1:76049334-76049356 AGGAAGAAAAGGTGGGGGAGGGG - Intergenic
909584800 1:77278228-77278250 AGAGAGAAAAGGTAGGAGTGGGG - Intergenic
909764425 1:79337805-79337827 AGGAAGAAAAGGTGGGAAAGGGG - Intergenic
909791411 1:79682528-79682550 AAGAAGATCAAGTCTGAGTGTGG - Intergenic
910307795 1:85786422-85786444 AGGAAGAACAGGTCTTGCTGGGG - Exonic
911292953 1:96080345-96080367 AGGAAGGAAAGGCCTGAGACTGG + Intergenic
911372502 1:97010930-97010952 AGGAAGGAAGGGTCTGGGAGAGG - Intergenic
911708685 1:101043884-101043906 AGGAGGAAAAGGTCAGAGGGGGG - Intergenic
912036818 1:105326512-105326534 AGGAAGAAAAGGTCTCTCTGGGG + Intergenic
912573803 1:110645210-110645232 AGGTGGAAAATCTCTGAGTGAGG + Intergenic
913255942 1:116953752-116953774 GGGATGAAAAGGGCTGGGTGTGG - Intronic
914085987 1:144455134-144455156 AGGAAGAAAAGGAGGGAGGGAGG + Intronic
914349406 1:146827128-146827150 AGGAATGATGGGTCTGAGTGGGG + Intergenic
914756366 1:150563732-150563754 AGGAAGAAAGGATTTGAGGGAGG + Intergenic
914801246 1:150964218-150964240 AGGAAGAAAAGGATGGTGTGTGG - Intronic
916026519 1:160837978-160838000 TGGAAGAAGAGGCCTGAGTGTGG - Intronic
916696725 1:167245021-167245043 AAAAATAAAAGGTCTGAGAGAGG + Intronic
916718626 1:167465619-167465641 AGAAAGAAAGGGGCTGGGTGCGG - Intronic
916888838 1:169097019-169097041 AGGAAGAGTAGGCCTGTGTGAGG + Intergenic
916937718 1:169646782-169646804 AGGAGGAAAAGGTGTCATTGGGG + Intergenic
916952610 1:169795762-169795784 AAGAAAAAGAGGTCTGAGAGGGG - Exonic
917069769 1:171137573-171137595 TGAAAGAGAAGGACTGAGTGTGG - Intergenic
918185406 1:182122305-182122327 GGGAAGAAGATGTCTGAGTGAGG - Intergenic
918703549 1:187635198-187635220 AGGAAGAAACGCTGTGAGTCTGG + Intergenic
918761897 1:188420709-188420731 AGGAAGAGAGGGACTGAGGGAGG - Intergenic
918844961 1:189597206-189597228 AGGAAGAATAGGTCAGAGATTGG - Intergenic
920247949 1:204602415-204602437 AGGAAGAGGAGGTGTGGGTGGGG + Intergenic
920767729 1:208849693-208849715 AGAAAGAAAAGAGCTGAGTGTGG + Intergenic
921075575 1:211697845-211697867 AGAGAGAAAAGGCCTGTGTGGGG - Intergenic
921250353 1:213291662-213291684 AGGAAGAAAGGCTCTGTGTGTGG + Intergenic
922198722 1:223382813-223382835 AGGAAGAAATGGAGGGAGTGAGG + Intergenic
922333048 1:224594574-224594596 AGGCAGAAAGGGCCAGAGTGAGG + Intronic
923012696 1:230101331-230101353 AGGAAGAAAAGGACTGGCGGTGG - Intronic
923172802 1:231432410-231432432 AGGCAGAAAAGGTCAAAGGGAGG + Intergenic
923580928 1:235211723-235211745 AGGAAGAAAAAAGCTGGGTGTGG - Intronic
923639031 1:235733298-235733320 AGGAAGAAAAGTAATGAGGGGGG - Intronic
924030606 1:239881642-239881664 AGGAAGCAGATGGCTGAGTGTGG - Intronic
924158587 1:241206923-241206945 AGGAAGAAAAGGAGAGAGAGAGG - Intronic
924788981 1:247226415-247226437 AAGAAGAAAAAGAATGAGTGTGG - Intergenic
1062795500 10:342053-342075 AGGACCAACAGTTCTGAGTGAGG - Intronic
1063021077 10:2128120-2128142 AGGAGAAAAACGCCTGAGTGTGG - Intergenic
1063381700 10:5589930-5589952 TGGAAGCAGAGGTCTGAGGGTGG + Intergenic
1064181662 10:13121733-13121755 TGGCAGTACAGGTCTGAGTGGGG - Intronic
1064442406 10:15365478-15365500 AGGAAGAAAAGGACTGGGCATGG + Intronic
1064585896 10:16838934-16838956 AAAAAGAAAAGGGCTGGGTGTGG - Intronic
1064995411 10:21292440-21292462 AGGAAGAAAATGTATGGCTGGGG + Intergenic
1065039610 10:21678536-21678558 AGAAAGTAAAGGTCTGTTTGAGG + Intronic
1065466536 10:26030106-26030128 GGGAAGAATGGGGCTGAGTGTGG - Intronic
1066321843 10:34310542-34310564 TGTCAGAAAAGGTCTGAGAGAGG + Intronic
1066460067 10:35605430-35605452 AGAAAGCAAAGGTCTGAGCCAGG - Exonic
1066779807 10:38931856-38931878 AGGAAGAAAAGGAGGGAGGGAGG + Intergenic
1070008573 10:72450232-72450254 AGCAGGAAAAGATATGAGTGAGG + Intronic
1070116668 10:73535351-73535373 AGGTAGAACAGGTCTGGGTGGGG + Intronic
1071702487 10:87954884-87954906 AGGAAGAAAAGGAGAGGGTGAGG + Intronic
1072207843 10:93220826-93220848 AAGAAGCAAAGGTCGGAGAGCGG - Intergenic
1072880509 10:99222493-99222515 AGGAAGAATAAGTCAGAGTATGG + Intronic
1073126938 10:101156828-101156850 AGCAAAAATAGGACTGAGTGTGG - Intergenic
1073510411 10:104039297-104039319 AGGAAGGAAAGGCCAGAGGGTGG - Intronic
1073815107 10:107197787-107197809 AGGAGGAAAGGGTCAGAGGGAGG + Intergenic
1073866676 10:107812657-107812679 GGAAAAAAAAGGTCTGAATGTGG + Intergenic
1073883775 10:108014063-108014085 AGAAAGAAAATGTTTGACTGTGG - Intergenic
1074448210 10:113537800-113537822 AGGAAAAACAGGCCTGGGTGGGG - Intergenic
1074657200 10:115604606-115604628 AGGAGTAAGAGGTCTAAGTGTGG - Intronic
1074749139 10:116567027-116567049 AGGAAGGAAAGGACAGAGGGAGG - Intronic
1075091451 10:119446148-119446170 AGGAAGAGAAGGTGTGAGCTGGG - Intronic
1076106008 10:127824208-127824230 AGCAAGAAAAGGTCAGAGTATGG - Intergenic
1077261949 11:1627069-1627091 AGAATGAAAAGGGCTGTGTGTGG - Intergenic
1077263386 11:1635608-1635630 AGGAGCAAAGGGTCAGAGTGAGG + Intergenic
1077322444 11:1948299-1948321 AGGAAGAAAAGGTCTGAGTGAGG + Intronic
1078564124 11:12398842-12398864 TGGAAGATATGGTCTGACTGTGG + Intronic
1078643017 11:13113811-13113833 AGGTTTAAAAGATCTGAGTGGGG + Intergenic
1079566360 11:21887988-21888010 TGGAAGCCAAGGTCAGAGTGAGG + Intergenic
1079621201 11:22556818-22556840 GAGAAGAAAAGATATGAGTGTGG + Intergenic
1080659489 11:34284568-34284590 TGGAAGAAAAGGTGTGAGAGTGG + Intronic
1080926557 11:36763257-36763279 AGGAAGAAAAGGTGAGGGAGGGG + Intergenic
1081303181 11:41478417-41478439 AGAAAGATAAGGACTGAGTCGGG - Intergenic
1081840396 11:46196505-46196527 AGAAAGAAAAGTTCTGAGCCAGG - Intergenic
1081930325 11:46865801-46865823 AATAAGAAAAGGTCCGAGCGGGG + Intronic
1082768033 11:57184030-57184052 AGGGAGAGGAGGACTGAGTGGGG + Intronic
1082828742 11:57599787-57599809 AGGAAGAGAAGGTGTGGATGTGG - Intronic
1083262934 11:61532911-61532933 AGGAAGAAGAGGGATGTGTGTGG - Intronic
1083758025 11:64801837-64801859 AGGAAGAAGCAGCCTGAGTGGGG - Intronic
1083912524 11:65718637-65718659 AGGAGGCCAAGGTCTGAGAGGGG - Exonic
1084167949 11:67385389-67385411 AGGATGAAACAGTCTGAGAGGGG - Intronic
1084524815 11:69689912-69689934 AGCAAGAAAAGGTGGGGGTGGGG - Intergenic
1084559178 11:69893105-69893127 GGGAAGAAAGGCTCTGAGTTGGG + Intergenic
1084675981 11:70634786-70634808 AGGAGGCAAAGGTCGCAGTGAGG + Intronic
1084845529 11:71896340-71896362 AGGAAGAAAAGGGGTGAGATAGG + Intronic
1084863959 11:72040925-72040947 AGGGAGAAAAAGTCTCGGTGCGG + Intronic
1084881125 11:72172399-72172421 AGGTAGACAAGGCCTGAGGGAGG - Intergenic
1085218360 11:74851706-74851728 AGCAAGAAAGAGTCTGAGTTGGG - Intronic
1085425089 11:76397290-76397312 AGGAATGAAGGGGCTGAGTGTGG - Intronic
1085728383 11:78975142-78975164 AGGGAGAAAAGCTGTGAGGGAGG + Intronic
1086694925 11:89832505-89832527 AGGAAGAAAGGGACCGAGGGAGG - Intergenic
1086711223 11:90011991-90012013 AGGAAGAAAGGGACCGAGGGAGG + Intergenic
1087019546 11:93588578-93588600 AGGAAGAAAAGGTGTGGAAGAGG - Intergenic
1087177277 11:95107345-95107367 AAAAAAAAAAGGTCTGGGTGAGG + Intronic
1088301525 11:108363129-108363151 AGGCAGAAAGGGTCTTACTGTGG - Intronic
1088967598 11:114739371-114739393 AGGAAGGGAAGGAGTGAGTGAGG - Intergenic
1089830601 11:121324227-121324249 AGGAAGAAAGTGTAAGAGTGTGG - Intergenic
1091047021 11:132333995-132334017 AGGAAGACATGGACTTAGTGAGG + Intronic
1202805462 11_KI270721v1_random:3612-3634 AGGAAGAAAAGGTCTGAGTGAGG + Intergenic
1091647079 12:2282064-2282086 AGGAAGATAAGGAATGAGGGAGG - Intronic
1091748956 12:3010800-3010822 AGGAAGACAAGGCCTCACTGTGG - Intronic
1091877773 12:3950663-3950685 AGGAAGGAGAGGAATGAGTGGGG - Intergenic
1092247143 12:6870009-6870031 AGGCAGAAAAGGTCTTACTTAGG + Intronic
1092869972 12:12797645-12797667 AGGAAGAAAAGGTCCCAGGGTGG + Intronic
1092885641 12:12922417-12922439 GGGAAGAAAGCGTCAGAGTGAGG + Intergenic
1092940260 12:13401398-13401420 AGGAAGATATGGTGTGAGTCAGG + Intergenic
1094017447 12:25880195-25880217 AGGAAGAAGAGCACTGAGTTTGG - Intergenic
1095922302 12:47543447-47543469 TGGAGGAAATGGTCTGTGTGGGG + Intergenic
1095989186 12:48022626-48022648 AAGAAGAAAAGGAGGGAGTGAGG + Intronic
1096575947 12:52552954-52552976 AGGGAGCAAAGGGCTCAGTGGGG - Exonic
1096780983 12:53991933-53991955 AGGAGGACAAGCTGTGAGTGGGG + Intronic
1096855115 12:54475391-54475413 AGGAAAAAAAGGTCGGGGGGAGG - Intergenic
1097161680 12:57050552-57050574 AGGAAGAGTAGGTATGAGGGAGG - Intronic
1097902346 12:64885710-64885732 AGTAAGAAAAAGGCTGGGTGTGG - Intergenic
1098099493 12:66999067-66999089 ATGAAGAAAATGTCTGAATGTGG - Intergenic
1098440040 12:70508034-70508056 AGGAAGAAAAGGTCAAAGAAAGG - Intergenic
1099079663 12:78160930-78160952 AGGAAGAAAGGGTGTAAGGGAGG - Intronic
1101724766 12:107379661-107379683 AGGAAGAAAAGGAATGAGAGAGG - Intronic
1101737364 12:107473045-107473067 AGTAAGCAAGGGGCTGAGTGAGG + Intronic
1102300147 12:111765892-111765914 AGGAAGAAAAGGCATGGGGGTGG - Intronic
1102562287 12:113770591-113770613 AGGGAGCAAAGGTCGGGGTGAGG + Intergenic
1103686701 12:122737903-122737925 AGAAAGGAAAGGGCTGGGTGCGG + Intergenic
1103834799 12:123810001-123810023 AATAAGAAAAGGTCGGAGAGTGG - Intronic
1103981074 12:124737333-124737355 TGGAAGAAAGGGGCTGGGTGGGG - Intergenic
1104359075 12:128115133-128115155 ATGAAGAAATGGGCTGGGTGTGG - Intergenic
1104463533 12:128972895-128972917 ACAAAGAAAAGGTATGTGTGGGG - Intronic
1104559203 12:129828773-129828795 AGGAAGAAAAGGAGGGAGGGAGG + Intronic
1105283242 13:18982211-18982233 AGGAAGAAATTGGCTGGGTGGGG - Intergenic
1105329001 13:19396926-19396948 TGGAAGAAAAGTTCTGGGAGTGG + Intergenic
1105495301 13:20925613-20925635 AGGCACAAGAGGGCTGAGTGCGG + Intergenic
1105897073 13:24725570-24725592 AAGAAGAGAAGCTCTGAGAGGGG + Intergenic
1106026775 13:25962766-25962788 GGCAAGAAAAATTCTGAGTGTGG - Intronic
1106525296 13:30535142-30535164 AGAAAGAGAAAGGCTGAGTGGGG - Intronic
1107760116 13:43669310-43669332 AGGAAGAGAAGGGCTCAGAGAGG - Intronic
1107800794 13:44106464-44106486 AAGAAAAAAAAGTCTGAGTTAGG + Intergenic
1107955026 13:45503574-45503596 AGGGAGATGAGCTCTGAGTGTGG + Intronic
1108020134 13:46119919-46119941 AGGAAGAAAGGGTGGGAGGGAGG + Intergenic
1108410509 13:50141842-50141864 AGGGTGAAAATGTCTGTGTGTGG + Intronic
1109823467 13:67687585-67687607 TGGAAGCAGAGGTCAGAGTGAGG - Intergenic
1109892201 13:68630227-68630249 AGGAAGAGAAGTTCTCAGTCTGG + Intergenic
1109961339 13:69636612-69636634 ATGAACAATAAGTCTGAGTGTGG - Intergenic
1110573942 13:77035147-77035169 AGGAAAAAGAGGTCAGAGAGTGG - Intergenic
1111257288 13:85687000-85687022 TGGAAGCAGAGATCTGAGTGTGG + Intergenic
1112001302 13:95212238-95212260 AAGAAGAAAATGTAGGAGTGAGG + Intronic
1112259627 13:97866647-97866669 AGGAGAAAGAGGTCTGAATGAGG - Intergenic
1113033199 13:106017232-106017254 AGGAAGAAAAAGTCTGAGGTAGG - Intergenic
1114066628 14:19064895-19064917 AGTGAGATAAGATCTGAGTGTGG + Intergenic
1114095638 14:19335128-19335150 AGTGAGATAAGATCTGAGTGTGG - Intergenic
1114385513 14:22250405-22250427 AAGAAGAAAAGGTGTGGGAGTGG - Intergenic
1115441962 14:33446091-33446113 TGGAAGAAAAGATTTCAGTGGGG - Intronic
1115466763 14:33723534-33723556 AAGAAAGAAAGGTCTCAGTGAGG - Intronic
1115596274 14:34912519-34912541 AGGAAGAAAGGTGCTGACTGGGG + Intergenic
1115888365 14:37999604-37999626 AGGAAGACAAATGCTGAGTGAGG + Intronic
1116271944 14:42782193-42782215 AGGAAGAAAAGGATTAAGTGGGG + Intergenic
1116669816 14:47827038-47827060 ATGAAAAAAAAATCTGAGTGTGG - Intergenic
1116732107 14:48636860-48636882 AGAAAGGAAAGGGCTGAGAGCGG - Intergenic
1116764606 14:49054645-49054667 AGGAAGAAAAGGTGTAAAAGTGG - Intergenic
1116847417 14:49877978-49878000 AAAAAGAAAAGGGCTGTGTGCGG - Intergenic
1117595622 14:57324433-57324455 AAGTAAAAAACGTCTGAGTGTGG - Intergenic
1118307032 14:64663377-64663399 AGGCTGCAAAGGTCTGAGTCAGG + Intergenic
1118809504 14:69262506-69262528 GGTAAGAAAAGGTCTCAGAGCGG + Intronic
1119480535 14:74955316-74955338 AGGAGGAGAAGAGCTGAGTGGGG + Exonic
1119724703 14:76914917-76914939 AGGGAGGAAAGGTCTGAAAGAGG + Intergenic
1120403690 14:84067249-84067271 AGCAAGAAGATGTCTTAGTGAGG + Intergenic
1120856411 14:89216553-89216575 AGGAAAAAGGGGCCTGAGTGTGG - Intronic
1120932299 14:89861025-89861047 AGAAATAAGAGGTCTGAGTTTGG - Intronic
1121140974 14:91541212-91541234 AGGAAGAAAATGTCAAAGTTGGG + Intergenic
1121391316 14:93577321-93577343 AGGTAGTAAGAGTCTGAGTGGGG + Intronic
1121986393 14:98510544-98510566 AGGAAGAAAAACTCTGAGAAAGG + Intergenic
1122506564 14:102235406-102235428 CGGAAGAAAAGGAAAGAGTGTGG + Intronic
1122569498 14:102685669-102685691 AGCTAGAAGAGGGCTGAGTGCGG + Intronic
1123061629 14:105597185-105597207 AGGGAAAGAAGGTCTGGGTGAGG + Intergenic
1123086367 14:105718915-105718937 AGGGAAAGAAGGTCTGGGTGAGG + Intergenic
1202937453 14_KI270725v1_random:104384-104406 AGGAAGAAAAGGAGGGAGGGAGG - Intergenic
1123436835 15:20260809-20260831 AGAAAAAAAAAGGCTGAGTGTGG - Intergenic
1123977013 15:25563353-25563375 AAAAAGAAAAGGTGTGAGTAGGG + Intergenic
1124172446 15:27388042-27388064 AGGAAGGAAAGGTGGGAGGGAGG + Intronic
1124172531 15:27388329-27388351 AGGAAGGAAAGGTGGGAGGGAGG + Intronic
1124385582 15:29205952-29205974 AGCAGGACAAGGACTGAGTGAGG - Intronic
1127420271 15:58798413-58798435 GGCAAGAAAAGGTCTGGGTGTGG - Intronic
1128179313 15:65587688-65587710 TGGGGGAAAAGGGCTGAGTGTGG + Intronic
1128408595 15:67369551-67369573 AGGAAGAAAAGGAAGGAGGGAGG + Intronic
1129693342 15:77726127-77726149 GGGAGAAAAAGGTCTCAGTGGGG - Intronic
1130089012 15:80803665-80803687 AGAAAAAAAGGGTCTGAGAGAGG + Intronic
1130408975 15:83628450-83628472 AGCAAGAAATGGGCTGAGCGTGG + Intergenic
1131172607 15:90189200-90189222 AGGAAGAAAAGGTAGGAAGGAGG + Intronic
1131270298 15:90943144-90943166 AATAAGAAAAGTTGTGAGTGGGG + Intronic
1131779864 15:95844502-95844524 AGGAATAAAACCTGTGAGTGGGG - Intergenic
1133187173 16:4108339-4108361 ATGAAGAAACGGTCTGATTAAGG - Intronic
1133829276 16:9306669-9306691 GGGAAGCAAAGGACTGAGTCTGG - Intergenic
1133932031 16:10240522-10240544 AGGAAGTATAGGTCTGTGTCTGG + Intergenic
1135224918 16:20647373-20647395 AGGTAGAAAAGAGCTGAGTCAGG - Intronic
1136043643 16:27599457-27599479 AGGGAGAGCAGGTCTGAGTGTGG - Intronic
1136047252 16:27624349-27624371 AGGAAGTGAAGGAGTGAGTGGGG - Intronic
1136130591 16:28218268-28218290 AGGAAGAAAGGGTGAGAGTCTGG + Intergenic
1136345719 16:29674445-29674467 AGGAACACAAAGTCTGCGTGGGG - Intronic
1136901093 16:34038714-34038736 AGGAAGAAAAGGAGGGAGGGAGG + Intergenic
1137517742 16:49163130-49163152 AGAAAGAAAAGGGCTCATTGAGG - Intergenic
1137801304 16:51264437-51264459 AGGAAGAGAAGATCAGATTGTGG + Intergenic
1138102549 16:54265305-54265327 AGACAGAAAAGGAGTGAGTGAGG - Intronic
1138215499 16:55201530-55201552 AGGAAGGAAAGGAGTGAGGGAGG - Intergenic
1138768596 16:59633926-59633948 AGGATGAAGAGGTCTCAGTAAGG + Intergenic
1139191535 16:64869137-64869159 GGGAAGAAAAGATGTGAGAGGGG - Intergenic
1139732569 16:68959296-68959318 AGGAAAAAATGGGCCGAGTGCGG + Intronic
1139984630 16:70888426-70888448 AGGAATGATGGGTCTGAGTGGGG - Intronic
1140500109 16:75426601-75426623 AGGAAGTAAAGGTTGCAGTGAGG + Intronic
1141448785 16:84082338-84082360 AGGAGGCACAGGTCTGAGTGAGG + Intronic
1141551291 16:84808367-84808389 AGAAAGAAAAGGTCTCAGGCCGG - Intergenic
1141859949 16:86709738-86709760 TGGAAGAAAAGAGCAGAGTGGGG - Intergenic
1142272845 16:89099851-89099873 AGGAAAAAAAGGTGAGAGAGAGG + Intronic
1142862181 17:2769263-2769285 AAAAAAAAAAGGTCTGGGTGCGG + Intergenic
1143116986 17:4586736-4586758 AGAAAGGAAAGGTCTGAGCTGGG + Intronic
1143149100 17:4796346-4796368 GGGAAGATAAAGCCTGAGTGGGG + Intronic
1143500144 17:7334102-7334124 AGGAACAGAAAGTCTGATTGGGG + Intergenic
1143509017 17:7385031-7385053 AGGAAGAGAAGGGCTCAGCGTGG + Intronic
1143638504 17:8181205-8181227 GGGAAGAAAAGTTCAGTGTGAGG + Intergenic
1143686894 17:8524541-8524563 AGGAAGAACAGGACAGAGGGTGG - Intronic
1143858230 17:9868547-9868569 AGCAGGAAAGGGGCTGAGTGAGG - Intronic
1143888380 17:10083917-10083939 AGGAAGACAAGTTCTCAGTCTGG + Intronic
1143898540 17:10156085-10156107 AAGAAGAAAAAGTCAGAGTTGGG - Intronic
1145063128 17:19744758-19744780 AGGAGGAAAAGGCCAGAGGGCGG + Intronic
1145709116 17:26952547-26952569 AGGAAGAAAAGGAGGGAGGGAGG + Intergenic
1146071015 17:29681381-29681403 AGGAAGGAAAGGACTGAATAAGG + Intronic
1146095192 17:29923326-29923348 AGAAAAAAAAGGGCTGGGTGTGG + Intronic
1146299357 17:31676204-31676226 AGGAAGGAAAGGTGGGAGGGAGG + Intergenic
1146610243 17:34298653-34298675 AGGAAGAAAAAGGCTGAGCATGG - Intergenic
1147492345 17:40881758-40881780 AGGATGAAGAGGCCTTAGTGTGG + Intronic
1147880096 17:43647812-43647834 AGGAAGAAGAAGTCTGGGTTGGG + Intronic
1148072392 17:44915839-44915861 AGGAAGGAAAGGGCTGAGTGGGG + Intronic
1148645304 17:49216752-49216774 ATGTAGAAAATGTCTGAGTCGGG - Intronic
1148661695 17:49339172-49339194 ACAAAGAAAAGGTCTGAGTTAGG + Intronic
1148910960 17:50942501-50942523 AGTAAGAAGAGGGCTGAGAGAGG - Intergenic
1149145062 17:53480397-53480419 AGGAGGAAAAGGTGAGAATGAGG - Intergenic
1149995182 17:61402429-61402451 AGGAGGGAAAGGTCTTAGGGAGG - Intronic
1150822604 17:68447663-68447685 AGGAAGGAAAGGGCCAAGTGTGG - Intronic
1150883612 17:69059396-69059418 AGGCAGACAAGATCAGAGTGAGG + Intronic
1150912799 17:69406368-69406390 AGGCAGAAAATGAGTGAGTGTGG + Intergenic
1150931803 17:69592922-69592944 AGGAAGGAAAGATGTGAGGGAGG - Intergenic
1151035767 17:70797390-70797412 AGGAAACAGAGGTCAGAGTGAGG - Intergenic
1151360249 17:73584375-73584397 CGGTAGAAAAGGGCTGGGTGAGG + Intronic
1151389887 17:73779183-73779205 AGGAAGCAGAGGCCTGAGTGAGG - Intergenic
1152368081 17:79869000-79869022 AGGAAGGAAAGGTGTGAGCCGGG - Intergenic
1152647760 17:81477634-81477656 TGGAAGAAAAGGGCTGGGAGGGG - Intergenic
1153104875 18:1514723-1514745 AGCAAGAGAAGGTGTGAGTGGGG - Intergenic
1153125339 18:1784458-1784480 AGGAAGGAAGGGTCAGAGTTAGG - Intergenic
1155016424 18:21845298-21845320 AGAATGAAAAGGGCTGGGTGTGG - Intronic
1155389815 18:25323083-25323105 AGGAAGAAAGGAACTGTGTGGGG + Intronic
1156109618 18:33709874-33709896 AGGAAGCAGTGGTCAGAGTGGGG - Intronic
1156595826 18:38546546-38546568 AGGAGGAAAAGCTCTGAGCCAGG - Intergenic
1156674696 18:39513654-39513676 TAGAAGGAGAGGTCTGAGTGGGG - Intergenic
1156983446 18:43320996-43321018 AGGAAGTAAAGGTGGGAGGGAGG - Intergenic
1157161276 18:45316367-45316389 GGGAAGAGGAGGTCGGAGTGTGG + Intronic
1157211983 18:45751047-45751069 AAGAAATAAAGGGCTGAGTGCGG + Intronic
1158614025 18:58969362-58969384 ATGAAGAAAGGGTATGAGAGTGG - Intronic
1158903277 18:61986344-61986366 GGGTAGAAAGGGTCAGAGTGAGG - Intergenic
1158994514 18:62904205-62904227 AGGAAGAAAGAATCTGAATGTGG + Intronic
1159368772 18:67504932-67504954 AAAAAAAAAAGGCCTGAGTGTGG - Intergenic
1159801731 18:72908563-72908585 AGTAAGCAGAGGTCTGAGTGTGG + Intergenic
1160381274 18:78457924-78457946 AGGAAGAGAAGCTGTGTGTGAGG - Intergenic
1161839638 19:6671627-6671649 AGAAAGAAAAAGGCTGGGTGCGG - Intergenic
1161918708 19:7250235-7250257 AGGAAGAAAAGGGAAGAGAGGGG + Intronic
1162397647 19:10426578-10426600 AGCAAGTAAAGGGCTGGGTGCGG + Intronic
1162499766 19:11045931-11045953 AGAAAAAAAAAGTCTGGGTGTGG + Intronic
1162998532 19:14351460-14351482 AGGGACAAAAGTTCTGAGTTGGG - Intergenic
1163183858 19:15622807-15622829 AGGGAGAGGAGGTCTGAGTTTGG + Intronic
1163475732 19:17525114-17525136 AGGAAGGAAAGTCCAGAGTGTGG - Intronic
1164441988 19:28285422-28285444 GGGAAGAAAAGGTTGGAGGGTGG + Intergenic
1164755480 19:30685951-30685973 AGGTAGAAAATGTCTGGGTGGGG + Intronic
1165136435 19:33672859-33672881 AGAAAGAAGAGGCCTGAATGGGG + Intronic
1165311631 19:35032038-35032060 TGGGAGAAAAGGTCTGGGGGTGG - Intronic
1165531045 19:36401823-36401845 TGATAGAAAAGGTCTGAGTGCGG - Intronic
1165785901 19:38461762-38461784 AGAAAGAAAAAGGCTGGGTGTGG + Intronic
1165824787 19:38699462-38699484 AGGAAGGATAGGGCTGGGTGTGG + Intronic
1166293098 19:41875918-41875940 AGGGAAATGAGGTCTGAGTGGGG - Intergenic
1166676767 19:44745854-44745876 AGGAAGTGAGGGTCTGAGTGAGG - Intergenic
1166676775 19:44745894-44745916 AGGAGGTAAGGGTCTGAGGGAGG - Intergenic
1166676886 19:44746369-44746391 AGGAGGTGAAGGTCTGAGGGAGG - Intergenic
1166676897 19:44746409-44746431 AGGAAATAAGGGTCTGAGGGTGG - Intergenic
1166712255 19:44944977-44944999 AGGAGGAAAGGGTGGGAGTGGGG + Intronic
1167039518 19:47014618-47014640 AAGAAGAAAAGGGCTGGGTGAGG - Intergenic
1167111746 19:47466429-47466451 AGGAGGAGGAGGTCTGGGTGAGG + Intronic
1167334452 19:48875835-48875857 AGGAAGGCAAGGTCTGGGTGAGG - Exonic
1167371269 19:49083768-49083790 AGAAAGAAAAGGGCTGGGTGTGG - Intergenic
1167706346 19:51083240-51083262 AGGAAGAGATGGACTGAGAGAGG + Intronic
1168645716 19:58057849-58057871 AGGATCAGAAGGTCTGAGGGAGG + Intergenic
926218739 2:10921375-10921397 AGGACGAGAAGTTCTGGGTGTGG - Intergenic
926445259 2:12934126-12934148 AGGAAGCAAAGGAGAGAGTGAGG - Intergenic
926909881 2:17842708-17842730 AAGAAGAAAGGGGCTGAGCGTGG + Intergenic
927004499 2:18834055-18834077 AAGAACTGAAGGTCTGAGTGAGG + Intergenic
927060648 2:19416346-19416368 AGGAAGGAAAGGACGGAGGGAGG - Intergenic
927280881 2:21305406-21305428 AGTAAGAAAGGGACCGAGTGAGG + Intergenic
927283704 2:21334775-21334797 AGGAAGAAAAGGACAGAGAAAGG + Intergenic
928683808 2:33728014-33728036 ACGGAGAAAAGGTCTGGCTGTGG + Intergenic
931442693 2:62302553-62302575 AGCAAGAAACAGGCTGAGTGCGG - Intergenic
931682519 2:64763332-64763354 AGGAAGGAAAGGACTGGATGGGG + Intergenic
932071602 2:68626329-68626351 AGGAAGGAAAGGTGAGAGGGAGG - Intronic
932497630 2:72154313-72154335 GGGAGGAAAAGGACTGAGTTTGG - Intergenic
933109453 2:78379129-78379151 AGGAAGGAAAGGAGGGAGTGAGG + Intergenic
933211036 2:79568959-79568981 AGGAAGTAAAGGTTGCAGTGAGG + Intronic
933586116 2:84180997-84181019 AGGAAGAAAAGGTTTAAGAAGGG + Intergenic
935038080 2:99398405-99398427 AGGCACAAAGGGTCTGAGTCAGG - Intronic
935042279 2:99444108-99444130 AGGAAGAAAAGGGCTGGGCGCGG - Intronic
935534127 2:104273448-104273470 AGGAAGATAATTTCTGAGAGTGG - Intergenic
936302498 2:111314590-111314612 TGGAGGAAAAGCTCTCAGTGAGG + Intergenic
937187861 2:120062780-120062802 AAGAATAAAAGGTTTAAGTGAGG + Intronic
937247415 2:120502739-120502761 AGGAACCAAAGCCCTGAGTGGGG + Intergenic
937425729 2:121797041-121797063 AGGAAGAAGAAGAGTGAGTGAGG - Intergenic
938029628 2:127981410-127981432 AGGAGGACTAGGTCGGAGTGCGG - Intronic
938484020 2:131685021-131685043 AGTGAGATAAGATCTGAGTGTGG + Intergenic
939336994 2:140842681-140842703 AGGAATAAAGATTCTGAGTGAGG - Intronic
939928426 2:148201965-148201987 AGGAAGAGAAGTTCTCAGTCCGG + Intronic
940536370 2:154950110-154950132 AGGGAGAAAGGGTGGGAGTGGGG + Intergenic
940713546 2:157191648-157191670 TGGAAGACTGGGTCTGAGTGTGG - Intergenic
940745210 2:157559966-157559988 AGGAAGAAAAGGAGGGAGGGAGG + Intronic
941229844 2:162898037-162898059 AGGAATAAAATATCTGAGTTTGG - Intergenic
941268881 2:163400376-163400398 AGGAAGAAAAACACTGAGGGTGG + Intergenic
941424975 2:165331574-165331596 AGGAAGAGAAACTCTCAGTGAGG - Intronic
942734222 2:179092161-179092183 TGGAAGAAAGGGTATCAGTGAGG - Intergenic
942932236 2:181508850-181508872 AGAAAGAAAAGGGCTGGGTATGG + Intronic
944474768 2:200092465-200092487 GGTAATAAAAGGTCTGAATGTGG + Intergenic
945299481 2:208202362-208202384 AGAAATAAAAGGTCTGGGTAAGG + Intergenic
945564474 2:211379931-211379953 ATCAAGAAAAGGACTGTGTGAGG - Exonic
945598913 2:211833611-211833633 AGGAAGAAAAGATATGAATTTGG + Intronic
945662271 2:212700991-212701013 AGGTAGAAATGGTCTGGGTGAGG - Intergenic
945957801 2:216102234-216102256 AGGGAGTAAAGCTCTGAGTGAGG - Exonic
946001925 2:216489554-216489576 AGGAGGAAAAGGAGTTAGTGTGG - Intergenic
946511999 2:220367911-220367933 AGGATGAAAAAGTCTGATTATGG - Intergenic
946537355 2:220646432-220646454 AGAAAGAAAAAGGCAGAGTGTGG - Intergenic
947615486 2:231554454-231554476 AGGAAGGAAATGTGTGAGTCTGG - Intergenic
947711131 2:232316578-232316600 GGGAGGAAAGGCTCTGAGTGAGG + Intronic
947909572 2:233792216-233792238 AGGAAGAGGAGGTCCGAGAGAGG - Intronic
948157265 2:235793324-235793346 ATGCTGAAAAGGACTGAGTGTGG - Intronic
948811274 2:240479660-240479682 AGGAGGAAAAGGTGTGGGGGAGG + Intronic
1169757253 20:9056002-9056024 AAGAAAAGAAGGTCAGAGTGAGG + Intergenic
1170270208 20:14518832-14518854 AGGAAGCACAGATATGAGTGAGG + Intronic
1170549791 20:17467083-17467105 AGGAGGATAAAGTCTGAGAGGGG - Intronic
1170903152 20:20485847-20485869 AATAAGAAAAGGGCTGGGTGTGG + Intronic
1171442725 20:25178276-25178298 AGGAGGAAAAGGAATGTGTGTGG + Intergenic
1172363724 20:34332902-34332924 TGGCAGAAAGGGGCTGAGTGTGG + Intergenic
1173174443 20:40753841-40753863 AGGAAGAAAATTGATGAGTGTGG + Intergenic
1173849201 20:46207285-46207307 AGGAGGAAGAGGACTGAGAGGGG + Intronic
1174777182 20:53354681-53354703 AGGAAGACAAGGGCAGAGTTAGG + Intronic
1175132511 20:56800284-56800306 AGCAAGTACAGGTGTGAGTGTGG - Intergenic
1175208927 20:57336196-57336218 AGGAAGAAAGCTTTTGAGTGTGG - Intronic
1175231025 20:57473407-57473429 AGGAAGAGAGGGCCAGAGTGTGG - Intergenic
1175342930 20:58246322-58246344 AGGAAGTAGAGGACTGGGTGAGG - Intergenic
1178443234 21:32615279-32615301 AGGAAGAAAAGGGGTGGATGGGG + Intergenic
1179163273 21:38915110-38915132 AGGGAGAAGAGGTCTCAGAGAGG + Intergenic
1179452061 21:41474154-41474176 AGGAAGTAAGGGGGTGAGTGAGG + Intronic
1179452444 21:41475328-41475350 AGGAGGTGAAGGTGTGAGTGAGG + Intronic
1179841759 21:44080827-44080849 ATGAAGAAAAAGACTGGGTGCGG - Intronic
1180485109 22:15787484-15787506 AGTGAGATAAGATCTGAGTGTGG + Intergenic
1180784171 22:18537614-18537636 AGAAAGTTAAGTTCTGAGTGTGG - Intergenic
1181127738 22:20711667-20711689 AGAAAGTTAAGTTCTGAGTGTGG - Intronic
1181134849 22:20757832-20757854 AGGAAGAAAAAGGCTGGGTGCGG - Intronic
1181241073 22:21476966-21476988 AGAAAGTTAAGTTCTGAGTGTGG - Intergenic
1182202949 22:28592132-28592154 ATGAAGAGAAGCTATGAGTGGGG + Intronic
1182238696 22:28897295-28897317 AGAAAGAAAAGCACTGAGAGAGG - Intronic
1182276006 22:29189104-29189126 AGGCAGAAAAGGTGTGTGAGGGG + Intergenic
1183136805 22:35896746-35896768 AAAAAGAAAAGGTTTGGGTGAGG - Intronic
1183442375 22:37830424-37830446 AGGAAAAAAGGGTCTGTCTGTGG - Intergenic
1183628694 22:39020552-39020574 AGGAAGGAAAGAGCTCAGTGTGG + Intronic
1183632173 22:39040311-39040333 AGGAAGGAAAGAGCTCAGTGTGG + Intergenic
1183637994 22:39076712-39076734 AGGAAGGAAAGAGCTCAGTGTGG + Intronic
1183648719 22:39141445-39141467 AGGAATGAAAGGTCAGAGTTGGG + Intronic
1184293493 22:43510035-43510057 AGGAAGAACAGGGCTGAGGAGGG + Intergenic
1184672576 22:46023112-46023134 AGGAAGAAAAGGAGGGAGAGAGG + Intergenic
1185233577 22:49698594-49698616 AGGTGGAAAAGGGCAGAGTGAGG + Intergenic
1203290053 22_KI270735v1_random:28005-28027 AGGAAGAAAAGGAGGGAGGGAGG - Intergenic
949163421 3:909392-909414 ATGAAGAATAGGGCTGACTGGGG + Intergenic
949896994 3:8775262-8775284 AGGAAGCAGGGGTCTGAGTCTGG - Intronic
950855144 3:16097696-16097718 GGGAAGAGAAGGTATGAGGGAGG - Intergenic
951345037 3:21537693-21537715 AGGCCGAAAAGGAGTGAGTGAGG + Intronic
951804284 3:26627479-26627501 AGGAAGAAAAGAAGAGAGTGAGG + Intronic
952345129 3:32476658-32476680 AGGAAGGAAAGGACAGAGGGAGG + Intronic
952741820 3:36741574-36741596 AGGAAGACAAGATTTGAGTTGGG + Intergenic
953612465 3:44458676-44458698 GGGAAGAAAAGGTCAGAGAGAGG - Intronic
954122833 3:48510148-48510170 AAAAAGAAAAAGACTGAGTGAGG - Intergenic
956247738 3:67203213-67203235 GGGAAGAAAAGCTCTTGGTGTGG - Intergenic
956834149 3:73081836-73081858 AGGAAGAAGAGGTCAGAGAAGGG - Intergenic
957349506 3:79004874-79004896 AAGAAGAAAAGGTCTTTGTAAGG + Intronic
957740745 3:84265041-84265063 AGGAAGGAAGGGAGTGAGTGGGG - Intergenic
958591780 3:96168849-96168871 AGGAAGAGAGGTTCTCAGTGTGG - Intergenic
958830267 3:99079064-99079086 ATGAGTAAATGGTCTGAGTGGGG + Intergenic
958881896 3:99681504-99681526 AGGTAGAAAGAGTTTGAGTGGGG + Intronic
959317669 3:104829022-104829044 AAGAAGAAAAGCTCTGAATAAGG - Intergenic
960283899 3:115806224-115806246 AGGAAGAAAAGTACTGAATTTGG - Exonic
960383798 3:116995290-116995312 AGGAGAAAAAGGTCTGAGCTTGG + Intronic
960649230 3:119927772-119927794 AGTAAGGAAAGGACTGAGTATGG + Intronic
960978725 3:123201998-123202020 AGGAAGAAGAGGACTGGGAGGGG - Intronic
961204685 3:125072568-125072590 AGGAAGAAGAGGACTGAGTTTGG - Intergenic
961657322 3:128450355-128450377 AGGAGGAAAAGGACTGTGTTTGG - Intergenic
961756186 3:129128532-129128554 CTGTGGAAAAGGTCTGAGTGAGG - Intronic
963235772 3:142954041-142954063 AGGAAGAAAAGGTTTGTAGGAGG - Intronic
963716944 3:148813574-148813596 ATGAAGGAAAGGTTTTAGTGAGG - Intronic
963939110 3:151083115-151083137 AGGAGGAAAAGGTGAGAATGAGG + Intergenic
964748000 3:160029726-160029748 AAAAAGAAAAGGGCTGGGTGCGG - Intronic
965590205 3:170356060-170356082 AGGAAGAAAAGGTGGGGGGGCGG + Intergenic
966624274 3:181999828-181999850 CAGATGAAAAGGTCTGAGGGAGG - Intergenic
967830014 3:193910523-193910545 AGGGAGAAAGGCCCTGAGTGAGG + Intergenic
967906935 3:194509210-194509232 AGGAAGAAAATGTCAGCCTGTGG + Intergenic
968914209 4:3490108-3490130 AGGGAGAAAAGGAATGAATGGGG - Intronic
969018759 4:4124357-4124379 AGGAAGAAAAGGGCTGGGATAGG - Intergenic
969548466 4:7848118-7848140 AGGAAGGAAGGGAGTGAGTGAGG + Intronic
969580425 4:8061412-8061434 AGGAAGAAAAGGGGAGAGGGAGG + Intronic
969786534 4:9462157-9462179 AGGAAGAAAAGGGCTGGGATAGG + Intergenic
970122160 4:12768162-12768184 AGGAAGGAAAGGACGGAGGGAGG + Intergenic
970422113 4:15914954-15914976 AGGAAGAAATGGTCAAGGTGGGG + Intergenic
971173524 4:24258839-24258861 ATGAATAAATGGTCTGAGAGTGG - Intergenic
971953117 4:33380172-33380194 AGGCAAATAAGGTCAGAGTGAGG + Intergenic
972321434 4:37976957-37976979 AGGAAGAAAAGCCCTGGGGGTGG + Intronic
972369450 4:38408883-38408905 AGGAAGAAAAGGAGGGAGGGAGG + Intergenic
972386509 4:38571693-38571715 AGGAATGAAAGGTCTGAGGAGGG + Intergenic
972493078 4:39606350-39606372 AAAAAAAAAAGGGCTGAGTGTGG + Intronic
972846571 4:42998566-42998588 AGGAAAAAAATGTCTGTTTGTGG + Intronic
973233411 4:47868344-47868366 AAGAAAAAAAGGTCGGAATGGGG + Intronic
973806709 4:54533694-54533716 TGGAAGAAAGGGTATCAGTGAGG - Intergenic
974696880 4:65387659-65387681 AGGTAGAACAGGGCTGAGTCAGG + Intronic
975812905 4:78188066-78188088 AGGTAGAATTTGTCTGAGTGGGG + Intronic
975842258 4:78487421-78487443 AGGAAGGAAAGGTGTGTGTTTGG - Intronic
975944312 4:79686221-79686243 AGTAAGGGAAGGACTGAGTGAGG - Intergenic
975961665 4:79916034-79916056 ATGAAGAGAAGTTCTGAGTTTGG + Intronic
976677370 4:87718256-87718278 AGGAAGCAGAGGTAGGAGTGTGG + Intergenic
976772466 4:88668478-88668500 AGGAAGAAAATGACCTAGTGTGG + Intronic
977336851 4:95710351-95710373 AGGAAGAAAGGGACAGAGGGAGG - Intergenic
977584480 4:98760002-98760024 AGGATGAAAAGGACAGAGTGTGG - Intergenic
978917795 4:114147555-114147577 AGGAAGCAAAGGGCTGTGTCCGG + Intergenic
979589127 4:122458189-122458211 ATGAAGAAAAGGTCAGATTAGGG + Intergenic
980597737 4:134976512-134976534 AGGAAGAATAAGGCTGGGTGTGG + Intergenic
981434284 4:144701995-144702017 AGAAAAAATAGGGCTGAGTGTGG + Intronic
981702588 4:147623013-147623035 AGCTTGAAAAGGGCTGAGTGAGG - Intronic
982066017 4:151655018-151655040 AGGAACAGAAGCTCTGTGTGTGG - Intronic
982514403 4:156326698-156326720 AGGAAGAAAGAGTGTGACTGGGG + Intergenic
983045430 4:162981295-162981317 AGGAAAGAAAGGTCAGAGTGAGG - Intergenic
983453015 4:167930351-167930373 AGGCAGAAAAGTTCTGAGGAAGG + Intergenic
983709320 4:170694425-170694447 AGGAAAAAAGGGTGTGTGTGGGG + Intergenic
984599336 4:181708486-181708508 ATGAAGAAAAGGTTTGGGTTTGG + Intergenic
984836619 4:184028424-184028446 AGCAAGAAATGGGCTGGGTGTGG + Intergenic
985811619 5:2094354-2094376 CGGCAGGAAAGGTCTGTGTGAGG + Intergenic
985920734 5:2970858-2970880 AGGAAGGGAAGGTGTGAGGGAGG - Intergenic
986607939 5:9540873-9540895 AGAAAGAAAAGCTCTTTGTGTGG + Intronic
986780864 5:11064450-11064472 AGGAAGAACAGGGCTCAGAGTGG + Intronic
987448584 5:18053398-18053420 AGGAAAAAATGGTCAAAGTGGGG + Intergenic
987708100 5:21480962-21480984 ATGAAGAAGAGTTCTTAGTGAGG + Intergenic
988751677 5:34193993-34194015 ATGAAGAAGAGTTCTTAGTGAGG - Intergenic
989066683 5:37469722-37469744 ATGAAGAAGAGTTCTTAGTGAGG + Intronic
990053903 5:51545774-51545796 AGAAAGAAAAAGTCTGAGTAAGG + Intergenic
990118677 5:52422091-52422113 AGATAGAAAAGATCTGAGAGAGG + Intergenic
990158132 5:52902863-52902885 TGGAAGAAAAGGGCTGGGCGCGG - Intronic
990226813 5:53664589-53664611 TGGAAGAAAGGGTATCAGTGAGG - Intronic
990259814 5:54010135-54010157 AGGAAGAAATGAAGTGAGTGGGG - Intronic
990657963 5:57978866-57978888 AGAAAGAGAAGGTGTCAGTGGGG + Intergenic
990851047 5:60205218-60205240 AGGAAGACAGAGCCTGAGTGTGG - Intronic
991736995 5:69636739-69636761 ATGAAGAAGAGTTCTTAGTGAGG - Intergenic
991739431 5:69654772-69654794 ATGAAGAAGAGTTCTTAGTGAGG - Intergenic
991758070 5:69898407-69898429 ATGAAGAAGAGTTCTTAGTGAGG + Intergenic
991788569 5:70216463-70216485 ATGAAGAAGAGTTCTTAGTGAGG - Intergenic
991791006 5:70234513-70234535 ATGAAGAAGAGTTCTTAGTGAGG - Intergenic
991813320 5:70491568-70491590 ATGAAGAAGAGTTCTTAGTGAGG - Intergenic
991816451 5:70512849-70512871 ATGAAGAAGAGTTCTTAGTGAGG - Intergenic
991818892 5:70530890-70530912 ATGAAGAAGAGTTCTTAGTGAGG - Intergenic
991837473 5:70774289-70774311 ATGAAGAAGAGTTCTTAGTGAGG + Intergenic
991881016 5:71216827-71216849 ATGAAGAAGAGTTCTTAGTGAGG - Intergenic
991883453 5:71234848-71234870 ATGAAGAAGAGTTCTTAGTGAGG - Intergenic
991943226 5:71875180-71875202 AGGGTGAAAAAGTCTGAATGTGG - Intergenic
992426719 5:76665103-76665125 AGGAATAAAAAGTTTGAGTAAGG + Exonic
992441187 5:76799125-76799147 AGGAAGTAAAGCTCTGTGTGGGG - Intergenic
992949548 5:81844811-81844833 AGGAAGAAAAGGAGGGAGGGAGG + Intergenic
993870689 5:93250559-93250581 AGGAAAAAAAAATCTGAGAGTGG + Intergenic
994420183 5:99521952-99521974 ATGAAGAAGAGTTCTTAGTGAGG + Intergenic
994487024 5:100393188-100393210 ATGAAGAAGAGTTCTTAGTGAGG - Intergenic
994591228 5:101775265-101775287 AGGGAGAAAAGGTGTAAGGGAGG - Intergenic
994648181 5:102495792-102495814 AGGGAAAAAAGGCCTGAGTCTGG + Intronic
995261744 5:110112242-110112264 AAGAAGAAAAGGGATGAGGGTGG + Intergenic
995967596 5:117927755-117927777 AAGAAGAAACTGTCTCAGTGTGG + Intergenic
996465158 5:123792290-123792312 AGGAGCAAAAGGGCTGAGTGTGG - Intergenic
996823868 5:127659858-127659880 AGGAAACAGAGGTATGAGTGTGG + Intergenic
997369973 5:133353377-133353399 AGGAAGCAAAGGTCTGCATGTGG + Intronic
997428214 5:133818876-133818898 TGGAAGAGAAGGGCTGGGTGGGG - Intergenic
998812621 5:145981502-145981524 AGGAAGAGGAGGTGTGCGTGTGG - Intronic
999211037 5:149888791-149888813 TGGAAGAAAATGGCTGGGTGCGG + Intronic
999255981 5:150210241-150210263 AGGAAGAAGAGGGCAGGGTGGGG + Exonic
999771752 5:154781124-154781146 AGGAAGAAAACCTCTGAGCTTGG + Intronic
999799134 5:155017163-155017185 AGGAAGCAAAAGTCAGACTGTGG + Exonic
1000424856 5:161078721-161078743 AGGAAGAAAAAGCCAGTGTGTGG - Intergenic
1000543251 5:162567179-162567201 AGGACCAAAAGCTCTGAGGGTGG + Intergenic
1000600862 5:163273219-163273241 AGGAAGACAAGTTCTCAGTCTGG + Intergenic
1001321861 5:170688980-170689002 AGGAAGAAAGGGTGGGAGGGAGG + Intronic
1002303127 5:178268774-178268796 AGAAAGAACAGACCTGAGTGAGG + Intronic
1002343716 5:178533785-178533807 AGGAAGGAAACGGCTGGGTGTGG - Intronic
1002669854 5:180857785-180857807 AAAAAAAAAAGGTCTGGGTGCGG - Intronic
1002851429 6:1000115-1000137 AGCAACAAAAGGTCAGAGTTCGG - Intergenic
1002974564 6:2061265-2061287 AGGGAGACAGGGTGTGAGTGAGG - Intronic
1003126592 6:3360905-3360927 AGGAACAGAAGGTCAGAGCGTGG + Intronic
1003328845 6:5112874-5112896 AGACAGAAATGGGCTGAGTGTGG + Intronic
1003857669 6:10292709-10292731 ATGAAGAAAAGGGCCGGGTGCGG + Intergenic
1004223393 6:13766031-13766053 AGGAAGAAGATGTCTGAGGAGGG + Intergenic
1004447067 6:15710162-15710184 AGGAAGGAAGGGAGTGAGTGAGG - Intergenic
1004544533 6:16584940-16584962 AGCAATAAAATGTCTGGGTGTGG + Intronic
1004700935 6:18078896-18078918 AGGATGGGAAGTTCTGAGTGAGG + Intergenic
1004995473 6:21187523-21187545 AAGAAAAAAAGGTGTGGGTGTGG - Intronic
1005549831 6:26900646-26900668 ATGAAGAAGAGTTCTTAGTGAGG - Intergenic
1006516135 6:34546764-34546786 AGGAAGGAAAGGTCAGGGTGGGG + Intronic
1006770543 6:36549026-36549048 AGGAAGATAAGGTTTGAGCTGGG - Intergenic
1007007852 6:38383997-38384019 AGGAAGATAATGTATGACTGAGG - Intronic
1007685299 6:43663737-43663759 ACAAAAAAAAGGGCTGAGTGCGG + Intronic
1008276592 6:49550546-49550568 AGGAAGAAGAGGAGTGACTGGGG + Intergenic
1008706673 6:54169060-54169082 AGGAGGTAGAGTTCTGAGTGTGG + Intronic
1009020099 6:57939572-57939594 ATGAAGAAGAGTTCTTAGTGAGG - Intergenic
1009332965 6:62447046-62447068 AAGAAGAAAAGTTCAGAGAGTGG - Intergenic
1010304626 6:74304669-74304691 AGGATGAAAATGTATGAGTAGGG + Intergenic
1011638524 6:89398186-89398208 AGTAAGGAAAGGTCAGAGGGAGG + Intronic
1011697904 6:89929637-89929659 AGGAAGGTGAGGTCTGAGTTAGG + Exonic
1012020954 6:93918371-93918393 TGGAACAAAAGGGCTGAGTAAGG + Intergenic
1012053057 6:94368202-94368224 AGGAAGAAATGGCCTGAGGATGG - Intergenic
1012313506 6:97757020-97757042 AGGCAGAAAAGGTGAAAGTGAGG - Intergenic
1012345487 6:98180292-98180314 AGGAAGAAAAGGAAGGAGAGAGG - Intergenic
1012532305 6:100252328-100252350 AGGAGGAGCAGGTCTGAGGGAGG + Intergenic
1012627289 6:101419671-101419693 AGGAAGAAACAGGCTGAGAGAGG + Intronic
1013980331 6:116121260-116121282 AGGAACAAAAGGTCTCCCTGGGG - Exonic
1015101960 6:129492017-129492039 AGGAGGAATATTTCTGAGTGGGG - Exonic
1015879590 6:137857757-137857779 ATGAAGAAACGGCCTCAGTGAGG - Intergenic
1016575508 6:145565639-145565661 AGAAAGGAAAGTCCTGAGTGAGG + Intronic
1017758834 6:157552557-157552579 AGGAAGCAAAGGACTCAATGAGG + Intronic
1017767091 6:157615915-157615937 AGGAAGAAGAGGTGAGAGAGGGG + Intronic
1018289651 6:162278844-162278866 AGGAGGGGAAGGTGTGAGTGAGG + Intronic
1019338528 7:496307-496329 AGGGAGAAAAGGAGGGAGTGAGG + Intergenic
1019503796 7:1380422-1380444 AGGGAGAAAAGGGCTGTGTGAGG + Intergenic
1020064624 7:5177823-5177845 AGGAAGAAAAAATCTGAGCAGGG + Intergenic
1020902980 7:14028630-14028652 AGCAAGCAAGGCTCTGAGTGAGG + Intergenic
1021993104 7:26155150-26155172 AAGAAAAATAGGGCTGAGTGCGG + Intronic
1023025313 7:36044485-36044507 AGGTAGAAAAGGAATGTGTGGGG + Intergenic
1023288602 7:38645269-38645291 AGGAAGAAAAGGAGGGAGGGAGG - Intergenic
1023357765 7:39384738-39384760 AGAAAGAAAAGGACTAACTGCGG - Intronic
1024639883 7:51319726-51319748 TGAAAGCAAAGGGCTGAGTGGGG + Intergenic
1024805237 7:53131941-53131963 AGGAAGAAAAGGAGGGAGGGAGG - Intergenic
1025307744 7:57879335-57879357 AGGAAGAAAAGGAGGGAGGGTGG - Intergenic
1025829924 7:65039262-65039284 AGAAGGAAATGGTCTGAGTTTGG + Intergenic
1025917179 7:65874262-65874284 AGAAGGAAATGGTCTGAGTTTGG + Intronic
1026138300 7:67682893-67682915 TGGAAGAAATGGGCTGGGTGTGG + Intergenic
1026206680 7:68263818-68263840 AGGAAGAGAAGATGTGAATGGGG + Intergenic
1026484711 7:70808091-70808113 AGGAAGAAGAGGGCTGGGTGTGG + Intergenic
1028067011 7:86398544-86398566 AGGAAGTAAGGGACTGAGTCCGG - Intergenic
1028419734 7:90619703-90619725 AGGAAAAAAAGAACTGGGTGCGG + Intronic
1028879178 7:95860154-95860176 AGGAATAAAAGGTAAGAGAGGGG - Intronic
1029467647 7:100736458-100736480 AGGAAGAATGGGTCACAGTGAGG - Intronic
1029477678 7:100794680-100794702 AAGAAAAAAAGAGCTGAGTGTGG + Intronic
1029731780 7:102443253-102443275 AGGAGAAAAGGGGCTGAGTGAGG - Intronic
1029856764 7:103525199-103525221 AGGAAGAAAATTTCTCTGTGAGG - Intronic
1029897088 7:103994560-103994582 AGCAAGAAAAGGGAAGAGTGAGG + Intergenic
1030403405 7:109081046-109081068 AGGAAGAAGAGGTGTGAGGAGGG + Intergenic
1030552285 7:110977676-110977698 AGGAAGAAAAGGAGGGAGGGAGG - Intronic
1030739979 7:113097585-113097607 AAGAAGACAAGATCTGAGTCTGG + Intergenic
1030913523 7:115282708-115282730 AGGAAGGAAAGGGCTGGGTTTGG + Intergenic
1033246336 7:139719392-139719414 AGGAGGAAGAGGGCTGGGTGCGG - Intronic
1033443308 7:141399190-141399212 ATAAAGGCAAGGTCTGAGTGGGG - Intronic
1033519766 7:142148839-142148861 AGTAAGAAAAGGACTGAGACAGG - Intronic
1033623959 7:143089653-143089675 TGGAAGAAAGGGTATCAGTGAGG + Intergenic
1033767397 7:144508860-144508882 GGAAAGAACAGATCTGAGTGTGG - Intronic
1034565206 7:151908613-151908635 AGGAAAAAAAAGGCTGGGTGCGG - Intergenic
1035515723 8:230853-230875 AGGAAGCAGAGGTCGCAGTGAGG + Intergenic
1035537786 8:405866-405888 AGGAAGAAAAGAACGGAGAGAGG + Intergenic
1035638868 8:1167379-1167401 AGGAAGAAAAAGGCAGAGAGGGG + Intergenic
1036788305 8:11702270-11702292 AGGGCGAAAAGGGCTGAGTCTGG - Intronic
1037186601 8:16071714-16071736 AGGAAAAAAAGGGCTGGGCGGGG + Intergenic
1037265374 8:17053509-17053531 AGGTTGCAAAGGTCTGAGTTTGG + Intronic
1037903345 8:22701102-22701124 AACCAGAAAAGGTGTGAGTGTGG + Intergenic
1038675668 8:29620688-29620710 AAAAAAAAAAAGTCTGAGTGGGG + Intergenic
1038846782 8:31237423-31237445 AGAGAGAAAAGGTCTGTGGGGGG - Intergenic
1039189536 8:34957102-34957124 ACGAAGAAATGGTTTAAGTGGGG + Intergenic
1040592622 8:48807957-48807979 AGGAAGACAAGAGCAGAGTGAGG + Intergenic
1041169802 8:55129887-55129909 TGGAAGAAATGGTCTGTGTTGGG + Intronic
1041232418 8:55767388-55767410 AGGAAGAACAGGTTTGAGGGTGG + Intronic
1041938020 8:63356265-63356287 AGATAGAAAAGATCTGAGTTTGG - Intergenic
1042212971 8:66400140-66400162 TGTAAGAAAAGGTCAGAGAGTGG + Intergenic
1042927728 8:73983633-73983655 AGGAAGAAAGAGGCTGGGTGTGG + Intergenic
1043387991 8:79767379-79767401 TGGCAAAAAAAGTCTGAGTGCGG - Intronic
1043793352 8:84503134-84503156 AGAAAGAAAAGTAATGAGTGAGG - Intronic
1044335902 8:90984980-90985002 AGGAAGAGAAGCTCTGAGGTGGG - Intronic
1045349080 8:101322046-101322068 AGGAGGAAATGGTCTGAGATAGG + Intergenic
1046177758 8:110601050-110601072 AAGAAGGAAAGGTCTGAAGGGGG + Intergenic
1046377743 8:113409047-113409069 AAGAAGAAAAAGTCTTATTGTGG - Intronic
1046767635 8:118087213-118087235 AGGAAAAAAAATTCAGAGTGTGG - Intronic
1047733822 8:127748611-127748633 AGGCAGCATAGGACTGAGTGGGG - Intergenic
1047761983 8:127961257-127961279 AGGAAGACAAGATCAGAGGGAGG + Intergenic
1048279415 8:133094115-133094137 AGGAACAAATGAGCTGAGTGGGG - Intronic
1048408064 8:134143064-134143086 AGGAAGGAAAGGAGGGAGTGAGG - Intergenic
1049542310 8:143214204-143214226 AGGCAGAGAAGGGCTCAGTGGGG + Intergenic
1050181644 9:2929157-2929179 AGGAAGAAAACTTCTTAATGGGG - Intergenic
1050506507 9:6354264-6354286 TTGAAGAAGAGGTGTGAGTGTGG - Intergenic
1050532642 9:6604016-6604038 AAGAAAAAAAGGGCTGGGTGCGG - Intronic
1051048322 9:12901779-12901801 ATGAAGAAAAGGTCTACGAGTGG - Intergenic
1051150568 9:14074653-14074675 AGAAAGAAATAGGCTGAGTGTGG + Intergenic
1051895228 9:21979585-21979607 AGGGAGAAAAGGTCAGAACGGGG + Intronic
1052211472 9:25909275-25909297 ATGATGAGAAGGTTTGAGTGGGG - Intergenic
1053321533 9:37103133-37103155 AGGAAGGAAAGGGCTGGGTGTGG + Intergenic
1054846469 9:69803759-69803781 AATAAAAAAAGGTCTGAATGGGG - Intergenic
1055280737 9:74671185-74671207 AGGGAGAGAGGGTCTGAGGGAGG + Intronic
1055611880 9:78031918-78031940 AAGAAGAAAATGTGTGTGTGTGG - Intergenic
1055845809 9:80561962-80561984 AGGAAGAGAAGGACAGAGTTGGG + Intergenic
1055983662 9:82033012-82033034 AGGAAGAAAAAGTCAGAATTGGG - Intergenic
1056236588 9:84600677-84600699 AGGAAGGAAAGGACGGAGGGAGG - Intergenic
1056271397 9:84951349-84951371 AGGAAGAAAAAAGCTGAATGTGG + Intronic
1056738904 9:89235810-89235832 TGGAAGAAAAAGTCTGATGGAGG - Intergenic
1057097097 9:92320948-92320970 AGGAAGAAAAGGTATTGTTGGGG - Intronic
1057972087 9:99568055-99568077 AGGAGGAAGAGGTTTCAGTGAGG + Intergenic
1058047473 9:100372101-100372123 AGAAAGAAGCAGTCTGAGTGAGG - Intergenic
1058229745 9:102411023-102411045 AGGGTAAAATGGTCTGAGTGTGG - Intergenic
1058763153 9:108155996-108156018 AGGTAGAAAAGGTCAGAGAAGGG + Intergenic
1058794955 9:108488952-108488974 TGGATGGAAAGGTCTGAGTAGGG - Intergenic
1059020767 9:110574195-110574217 AGGAATAAGATGTCTGACTGAGG + Intronic
1059653991 9:116340581-116340603 AGGAAGAAAAGGGATAAGGGAGG - Intronic
1059929899 9:119250095-119250117 AGGAAGAAAAGGAAGGAGGGAGG + Intronic
1060508816 9:124217528-124217550 AGTCAGAAAATGGCTGAGTGGGG + Intergenic
1062150309 9:135014861-135014883 AGGAGGAAAAGATTTTAGTGTGG - Intergenic
1062670276 9:137704804-137704826 AGGAAGAAAAGGAGGGAGGGAGG - Intronic
1203581748 Un_KI270746v1:13153-13175 AGGAAGAAAAGGAGGGAGGGAGG + Intergenic
1185690847 X:2154126-2154148 AGGAAGGAAGGGTGTGAGGGAGG - Intergenic
1185803941 X:3039907-3039929 AGAAAGGAAATGTCTGGGTGAGG - Intergenic
1189505097 X:41605444-41605466 AAAAAAAAAAGGGCTGAGTGTGG + Intronic
1190066677 X:47246106-47246128 AGGAAGAAAAGAGCAGAGAGGGG - Intronic
1190547950 X:51549374-51549396 AGGAAGAAAGGGAGGGAGTGAGG - Intergenic
1191092055 X:56634332-56634354 GGGAAGAAAGGGTATCAGTGAGG - Intergenic
1191818333 X:65274084-65274106 AGGAAGATCCAGTCTGAGTGGGG - Intergenic
1191967362 X:66774527-66774549 AGGAAGAAAAGGAAGGAGGGAGG - Intergenic
1192357489 X:70417930-70417952 AGGAAGCAAAAGTCAGACTGTGG + Exonic
1192587472 X:72330508-72330530 AGGAAGAAAAGTTGGGGGTGGGG - Intronic
1192955484 X:76065436-76065458 AACAAAAAAAGGCCTGAGTGTGG + Intergenic
1193664126 X:84295309-84295331 AGGAAGGAGAGGGTTGAGTGGGG - Intergenic
1193787699 X:85780141-85780163 ATGAAGCAAAGATCTGACTGTGG - Intergenic
1196331653 X:114477609-114477631 AGGAAGAACTGGACGGAGTGGGG + Intergenic
1196551289 X:117028864-117028886 AGGAAGAAAAGGTGAGACGGTGG - Intergenic
1196679721 X:118458387-118458409 AGCATGAAAAGGATTGAGTGGGG + Intergenic
1197298080 X:124743990-124744012 AGGAAGAAATGGGCTGGGGGAGG - Intronic
1197692424 X:129516277-129516299 AGGAAGAAAAGGTAGGAGAAAGG + Intronic
1198928629 X:141827105-141827127 AGGAAGAGTAGATCTGTGTGTGG - Intergenic
1199900754 X:152169674-152169696 TGGAAGAAAAGGCCAGAGTGAGG - Intronic
1201387265 Y:13455117-13455139 AGGCAAACAAGGGCTGAGTGTGG + Intronic
1201741040 Y:17325158-17325180 AGAAAGAAAGGGTGTGAGGGCGG + Intergenic
1202602897 Y:26612679-26612701 TGGAAGAAAAGTTCTGGGAGTGG - Intergenic