ID: 1077323542

View in Genome Browser
Species Human (GRCh38)
Location 11:1953407-1953429
Sequence TACGTATCCTGGGGGGCTCT GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 69
Summary {0: 2, 1: 0, 2: 0, 3: 2, 4: 65}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1077323532_1077323542 27 Left 1077323532 11:1953357-1953379 CCCACGTACTTGTTAGGGCTCAG 0: 2
1: 0
2: 0
3: 2
4: 58
Right 1077323542 11:1953407-1953429 TACGTATCCTGGGGGGCTCTGGG 0: 2
1: 0
2: 0
3: 2
4: 65
1077323533_1077323542 26 Left 1077323533 11:1953358-1953380 CCACGTACTTGTTAGGGCTCAGC 0: 2
1: 0
2: 0
3: 2
4: 71
Right 1077323542 11:1953407-1953429 TACGTATCCTGGGGGGCTCTGGG 0: 2
1: 0
2: 0
3: 2
4: 65

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1077323542 Original CRISPR TACGTATCCTGGGGGGCTCT GGG Intronic
905768099 1:40619986-40620008 GAGGTAACCTGGAGGGCTCTTGG + Intergenic
912516992 1:110222775-110222797 TCCATATGCTTGGGGGCTCTCGG - Intronic
917099513 1:171431245-171431267 CACGTACCCTCTGGGGCTCTAGG - Intergenic
918148545 1:181779175-181779197 TAGGTATAATGGGGTGCTCTTGG + Intronic
924283011 1:242457040-242457062 CACTTATCCAGGGGGTCTCTGGG + Intronic
1066203009 10:33159997-33160019 TATGTGTGTTGGGGGGCTCTTGG + Intergenic
1068252634 10:54463712-54463734 TAGGTGTCATGGGAGGCTCTGGG - Intronic
1076831770 10:132998993-132999015 TGGGCATCCTGGTGGGCTCTAGG - Intergenic
1077323542 11:1953407-1953429 TACGTATCCTGGGGGGCTCTGGG + Intronic
1079976607 11:27099599-27099621 TACAGATGCTGGGGGGCACTGGG - Intronic
1083281945 11:61632364-61632386 TACCTCTCCTGCCGGGCTCTGGG - Intergenic
1083935584 11:65868238-65868260 TACGTCTCCCAGGGGGCTTTGGG - Intronic
1084892509 11:72243640-72243662 CTCGTATTCTGGGGGTCTCTCGG + Intronic
1089009030 11:115118078-115118100 GACCTTTCCTGGGAGGCTCTGGG - Intergenic
1090482605 11:127081376-127081398 CAAGCTTCCTGGGGGGCTCTGGG + Intergenic
1202806529 11_KI270721v1_random:8602-8624 TACGTATCCTGGGGGGCTCTGGG + Intergenic
1097987384 12:65798276-65798298 TAAGTCTCCTGTGTGGCTCTAGG + Intergenic
1101112470 12:101499576-101499598 GATGTGTTCTGGGGGGCTCTAGG - Intergenic
1118771341 14:68944649-68944671 AACTGATCCTGGGGGGCTGTAGG + Intronic
1121256235 14:92532353-92532375 TACTCATCCTGGGCAGCTCTGGG - Intronic
1122111811 14:99508581-99508603 TACGCTTCCTGGGAGGCCCTAGG + Exonic
1131753747 15:95538227-95538249 CAGGTATCCTGGGGGGCTGGGGG - Intergenic
1132331834 15:101017443-101017465 TTCGCTTCCTGGGGGGCGCTGGG - Intronic
1132544544 16:527343-527365 TCCGTGTCCCGCGGGGCTCTGGG - Intergenic
1132826143 16:1906649-1906671 TTCGTGTCCTCAGGGGCTCTCGG - Intergenic
1140953178 16:79838503-79838525 TACGTGTTTTGCGGGGCTCTTGG - Intergenic
1145036534 17:19544660-19544682 TCCGTACCCTGGGGGGCACTGGG - Intronic
1146768477 17:35546284-35546306 TACCTTTCCTTGGGGGCTTTAGG - Intergenic
1151375550 17:73686375-73686397 TCAGTATCCTGGGGGCCTGTGGG - Intergenic
1152824969 17:82458865-82458887 TGCTTGTCCTGTGGGGCTCTGGG + Intronic
1165367625 19:35378420-35378442 TAAGTCTGCTGGGGGCCTCTGGG + Intergenic
1167120266 19:47512564-47512586 TAGTTTTCCTGGGTGGCTCTGGG - Intronic
1167253407 19:48413785-48413807 ACCTTATCCTGGGGGGCACTGGG + Intronic
928065571 2:28161293-28161315 TAGGGTTCCTGGGGGGCTCCAGG + Intronic
932421746 2:71605453-71605475 TCTGTATCCTAGGGGGCCCTGGG - Intronic
939258624 2:139778087-139778109 GCCGTATTCTGGAGGGCTCTGGG + Intergenic
944167196 2:196735363-196735385 TAATTATTCTGGGGGGCTCCTGG - Intronic
945080674 2:206084941-206084963 TCCCCAACCTGGGGGGCTCTAGG + Intronic
945360648 2:208892327-208892349 TATGTAGCCTGGGGAGCTTTGGG + Intergenic
945739224 2:213640939-213640961 TACTTATCCTGGTGGCCTCAGGG - Intronic
947484869 2:230538763-230538785 TTCTTTTCCTGGAGGGCTCTGGG - Intronic
1172098716 20:32473334-32473356 CACGTGCTCTGGGGGGCTCTGGG - Intronic
1174836772 20:53863453-53863475 TACAGATCCTGGGGGAGTCTTGG - Intergenic
1176299884 21:5094629-5094651 TCCCAAGCCTGGGGGGCTCTGGG + Intergenic
1179857138 21:44167282-44167304 TCCCAAGCCTGGGGGGCTCTGGG - Intergenic
1184763939 22:46561946-46561968 TAAGGAACCTGGGGGGCCCTGGG + Intergenic
954318339 3:49813455-49813477 TAAGTGTCCTGGGGGGCTATGGG - Intronic
961358074 3:126351467-126351489 TACTTACCCTGTGGGGCTGTGGG + Intronic
961675210 3:128560841-128560863 TCTCTGTCCTGGGGGGCTCTGGG - Intergenic
964813021 3:160685952-160685974 TTGGTATCCTGGGGAGGTCTTGG - Intergenic
968958042 4:3728914-3728936 TCTGTCTCCTGGGGGGTTCTTGG + Intergenic
969790251 4:9489452-9489474 TCTGTGTCCTGGGGGGCTCAAGG - Intergenic
973787827 4:54350156-54350178 TACTTATTTTGGGGGGGTCTTGG + Intergenic
975769774 4:77708544-77708566 TACGTATCCCTGGGGGATGTGGG - Intergenic
977248987 4:94667579-94667601 TTAGTATCCTAGGGGGTTCTTGG + Exonic
986683426 5:10253710-10253732 TGGGTATCCTCGGGGGCTCCTGG + Intronic
999104906 5:149062641-149062663 TTCCTGTCCTGGGGGGATCTCGG + Intronic
1001560972 5:172668769-172668791 GGCGGTTCCTGGGGGGCTCTGGG - Intronic
1006806401 6:36792327-36792349 TACCCTTCCTGGTGGGCTCTCGG - Intronic
1011300261 6:85865962-85865984 TCTGTTTCCTGGGGGGCTGTTGG + Intergenic
1014962201 6:127700956-127700978 TACTTATCCTGGGGTACCCTGGG - Intergenic
1018056520 6:160056797-160056819 GTGGTATCCTGGTGGGCTCTGGG + Intronic
1019535877 7:1529795-1529817 TGGGTGTCCTGGGGGGCCCTCGG + Intergenic
1026484692 7:70807886-70807908 TAAGTTCCCTGGGGGGCCCTGGG + Intergenic
1034498125 7:151433936-151433958 CCCGTGTCCTGGTGGGCTCTCGG - Intronic
1035536649 8:396119-396141 TACTAGTCCTGAGGGGCTCTGGG - Intergenic
1041605880 8:59781830-59781852 TAAGTTTAATGGGGGGCTCTGGG - Intergenic
1189007402 X:37009907-37009929 CGCGTGTCTTGGGGGGCTCTGGG - Exonic
1197248910 X:124194242-124194264 TACCTAGGCTTGGGGGCTCTGGG + Intronic