ID: 1077324690

View in Genome Browser
Species Human (GRCh38)
Location 11:1958687-1958709
Sequence GAGGCCTGTGGGAGACATGG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 475
Summary {0: 2, 1: 0, 2: 6, 3: 45, 4: 422}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1077324690_1077324707 4 Left 1077324690 11:1958687-1958709 CCCCCATGTCTCCCACAGGCCTC 0: 2
1: 0
2: 6
3: 45
4: 422
Right 1077324707 11:1958714-1958736 CCAGGGAGGAGAAAGGGGCTGGG 0: 2
1: 1
2: 7
3: 98
4: 923
1077324690_1077324705 3 Left 1077324690 11:1958687-1958709 CCCCCATGTCTCCCACAGGCCTC 0: 2
1: 0
2: 6
3: 45
4: 422
Right 1077324705 11:1958713-1958735 GCCAGGGAGGAGAAAGGGGCTGG 0: 2
1: 2
2: 13
3: 158
4: 1245
1077324690_1077324703 -1 Left 1077324690 11:1958687-1958709 CCCCCATGTCTCCCACAGGCCTC 0: 2
1: 0
2: 6
3: 45
4: 422
Right 1077324703 11:1958709-1958731 CCCTGCCAGGGAGGAGAAAGGGG 0: 2
1: 1
2: 13
3: 69
4: 581
1077324690_1077324698 -10 Left 1077324690 11:1958687-1958709 CCCCCATGTCTCCCACAGGCCTC 0: 2
1: 0
2: 6
3: 45
4: 422
Right 1077324698 11:1958700-1958722 CACAGGCCTCCCTGCCAGGGAGG 0: 2
1: 0
2: 3
3: 58
4: 400
1077324690_1077324700 -3 Left 1077324690 11:1958687-1958709 CCCCCATGTCTCCCACAGGCCTC 0: 2
1: 0
2: 6
3: 45
4: 422
Right 1077324700 11:1958707-1958729 CTCCCTGCCAGGGAGGAGAAAGG 0: 2
1: 2
2: 5
3: 51
4: 477
1077324690_1077324701 -2 Left 1077324690 11:1958687-1958709 CCCCCATGTCTCCCACAGGCCTC 0: 2
1: 0
2: 6
3: 45
4: 422
Right 1077324701 11:1958708-1958730 TCCCTGCCAGGGAGGAGAAAGGG 0: 2
1: 1
2: 5
3: 65
4: 481
1077324690_1077324708 5 Left 1077324690 11:1958687-1958709 CCCCCATGTCTCCCACAGGCCTC 0: 2
1: 0
2: 6
3: 45
4: 422
Right 1077324708 11:1958715-1958737 CAGGGAGGAGAAAGGGGCTGGGG 0: 2
1: 0
2: 16
3: 168
4: 1336

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1077324690 Original CRISPR GAGGCCTGTGGGAGACATGG GGG (reversed) Intronic
900547330 1:3236230-3236252 AGGGGCTGTGGGAGACAAGGAGG - Intronic
900910654 1:5594795-5594817 GGGGCCTGGGGGAGTCATGTAGG - Intergenic
900955205 1:5882565-5882587 AGGGCATGTGGGCGACATGGAGG - Intronic
900993419 1:6108096-6108118 GAGGGATGGTGGAGACATGGAGG + Intronic
901004498 1:6165323-6165345 GAGACCTGTGGGAGCCCTGTGGG - Intronic
901302980 1:8212976-8212998 GGGGCCTGTGGAAGCCATGCTGG + Intergenic
901677158 1:10892230-10892252 GGTGCCAGTGGGAGCCATGGAGG - Intergenic
902176293 1:14653398-14653420 GGGGCCCGTGGGAGACAATGGGG + Intronic
902273820 1:15325363-15325385 GAACCCAGTGGGAGACATGGGGG - Intronic
902395325 1:16129355-16129377 GAGGGCTGGGGGGGGCATGGAGG + Intronic
902856949 1:19214342-19214364 GTGACCTCTGGGAAACATGGTGG + Intergenic
903573840 1:24325632-24325654 GAGGCATGTTGGAGCCATGAAGG + Intronic
904483723 1:30810249-30810271 GAACCCAGTGGGAGACAAGGGGG - Intergenic
904741035 1:32676020-32676042 GAGGCTGCTGTGAGACATGGTGG + Intronic
904767413 1:32861137-32861159 CAGGCCTGTGGGAGAAATGCTGG - Intergenic
906650558 1:47509447-47509469 GGGGCCTGAGGGAGAAAAGGAGG - Intergenic
907301590 1:53490247-53490269 GAGGAAGGTGGGAGACAGGGTGG - Intergenic
908094025 1:60718388-60718410 GAGGCACAAGGGAGACATGGGGG + Intergenic
908946017 1:69498145-69498167 GAGGGCTGTGGGAGAAAGGGAGG + Intergenic
908954670 1:69608314-69608336 GAGGGCTGTGGCAGAGGTGGTGG - Intronic
910698286 1:90045306-90045328 GAGGCATGAGGGAGACAATGGGG + Intergenic
912677699 1:111700513-111700535 GAGGCCTGTGGGAGGTATTTGGG - Intronic
914263933 1:146021671-146021693 GGGACCTGGGGGAGACACGGAGG - Exonic
914521943 1:148425582-148425604 GAAGCTGGTGGGAGTCATGGCGG - Intergenic
914764998 1:150629776-150629798 GAAGCCTGTGGGGGATATCGGGG + Intergenic
914810616 1:151024959-151024981 AAGGCCTGTGGGATACTTGTTGG + Intronic
915230432 1:154441795-154441817 GTGGCCTTTGGGAGACACAGAGG + Intronic
915317712 1:155038743-155038765 GAGCGCTGTGGGAGCCAAGGAGG - Intronic
915569008 1:156733883-156733905 GAGGAATGTGGGAGATAAGGTGG - Intronic
916180470 1:162078949-162078971 CAGGGCTGTGGAAGACACGGGGG - Intronic
916203499 1:162294060-162294082 AACGCCTGTGGGAGAAAAGGGGG + Intronic
917263729 1:173197254-173197276 GAGGACTGTGGAAGACAGTGTGG + Intronic
917451540 1:175151464-175151486 TTGGCCTGTGGCAGAAATGGTGG + Intergenic
917509106 1:175655566-175655588 GAGTGCTGTGGGAGTCCTGGTGG + Intronic
918740893 1:188128876-188128898 TAGGCCTGTGGGAGAGCAGGCGG - Intergenic
919097998 1:193059847-193059869 GATGCGGGTGAGAGACATGGAGG - Intronic
920092848 1:203466314-203466336 GAAGCTTGTGGGAGAAATGAGGG + Intergenic
920546445 1:206822350-206822372 GAGGCTGGTGGGTGATATGGAGG + Intronic
921588157 1:216973023-216973045 GACTCCAGTGGTAGACATGGAGG - Intronic
922874416 1:228928746-228928768 CAGGCCTGAGGGAGACGAGGAGG - Intergenic
924511326 1:244730917-244730939 GAGGCCTGCGCGGGCCATGGCGG - Intergenic
924832296 1:247609890-247609912 GGGGCCTGTCGGAGGCATGGAGG + Intergenic
924949028 1:248865855-248865877 GGGGCATATGGGAGACAGGGAGG + Intergenic
1063086923 10:2828261-2828283 TAAGCTTGTGGGAGAAATGGAGG + Intergenic
1063348434 10:5333384-5333406 GGGGCCTGTCGGAGGGATGGGGG + Intergenic
1063843766 10:10102398-10102420 TAGGCCTTTTGGAGACATGAAGG - Intergenic
1063881673 10:10538239-10538261 GAGGCAGGAAGGAGACATGGGGG - Intergenic
1064242762 10:13646045-13646067 GAGACCTGTGGGAGTCGTAGAGG - Exonic
1065845493 10:29739464-29739486 GAGGCCTCTGGGAGGCATCAGGG - Intergenic
1066208301 10:33211630-33211652 GTGGCCTGTCGGGGACACGGAGG + Intronic
1066488772 10:35874036-35874058 GAGGTCTGTGGGACACACAGAGG - Intergenic
1067241567 10:44499467-44499489 GAGGCCTTTGGGAGACGTTTAGG + Intergenic
1067325623 10:45263558-45263580 CAGGCCACTGGGAGCCATGGTGG - Intergenic
1067426706 10:46216315-46216337 GAGGCATGGGGTGGACATGGCGG + Intergenic
1069421512 10:68250830-68250852 CTAGCCTGAGGGAGACATGGAGG - Intergenic
1069909716 10:71751693-71751715 GGGGCCTGGAGGAGACAGGGGGG + Exonic
1070828584 10:79405260-79405282 GAGGCTTGTGGGAAACAAGATGG - Intronic
1071285409 10:84139736-84139758 CAGTCCTGTGGGTGACCTGGTGG + Intronic
1071789710 10:88941204-88941226 GAGGCCTGTGGGAGATAAGGGGG - Intronic
1072578553 10:96720817-96720839 CAGGCCTCTGGGAGACAGGGCGG + Intergenic
1072896126 10:99368319-99368341 GAGCCCTGTGGGAAGCATGTAGG - Intronic
1076547354 10:131254173-131254195 CAGGCCTGGGGGACAAATGGAGG + Intronic
1076695793 10:132246778-132246800 GAGGCCAGGGGGTGACATTGTGG - Intronic
1077324690 11:1958687-1958709 GAGGCCTGTGGGAGACATGGGGG - Intronic
1077877809 11:6322374-6322396 GGGGTGTGTGGGGGACATGGGGG - Intergenic
1078522985 11:12078174-12078196 AAGGCCTGTGGGAACCATTGAGG - Intergenic
1078528852 11:12120929-12120951 GAGGGCTGTGGGGAACAGGGTGG + Intronic
1078852780 11:15179555-15179577 GGGGCCTGTGGGAGGAGTGGGGG - Intronic
1079106362 11:17574800-17574822 GAGGCCTGTGGGGTTGATGGTGG + Exonic
1080504474 11:32898843-32898865 CAGGCCAGTGCGAGGCATGGTGG - Intronic
1080585294 11:33676276-33676298 GAGGCCTTTGGGAGACCTACAGG + Intergenic
1080856443 11:36115798-36115820 CAGGCCTGTGCTAGGCATGGAGG + Intronic
1080901799 11:36500638-36500660 GAGGCCTGTTAGAGAGCTGGTGG + Intronic
1081786536 11:45751543-45751565 GAGCCCTGTGGCAGAGGTGGAGG + Intergenic
1081809468 11:45906938-45906960 GAGACCTGTGGGAGATGTCGGGG + Exonic
1081847154 11:46248911-46248933 CAGGCCTCTGGAAGCCATGGAGG - Intergenic
1082975934 11:59071737-59071759 GAGGCCCTTGGGTGAAATGGTGG - Intergenic
1083779886 11:64912302-64912324 GAGGCCCCTGGGTGGCATGGGGG - Intronic
1084002268 11:66302811-66302833 GAGGCCTGTCGGAGTCATGGGGG - Intergenic
1084035437 11:66507089-66507111 CAGCCCTGTGCGAGCCATGGGGG + Intronic
1084400196 11:68938977-68938999 GAGACCTGTGGGACAGAAGGTGG + Intronic
1084471028 11:69358966-69358988 GAGGCCCCTGGGGGACATGGGGG - Intronic
1085084917 11:73660671-73660693 GAGGCCTGTGCCAGGCGTGGGGG + Intronic
1085379189 11:76097309-76097331 GTGGCCTGGTGGAGACAGGGAGG - Intronic
1086791072 11:91038703-91038725 GAGGCAGGAGGGAGAAATGGAGG + Intergenic
1088742010 11:112774905-112774927 GAGGCCTGTGGGAATCCTGGAGG - Intergenic
1089268659 11:117285828-117285850 GAAGCTTGTGGGGTACATGGAGG - Exonic
1089557376 11:119321708-119321730 GGGGCCTGTGGGAAACCTGGGGG + Intergenic
1090425532 11:126604623-126604645 GTGTCCTGTGGGCCACATGGGGG + Intronic
1202807669 11_KI270721v1_random:13864-13886 GAGGCCTGTGGGAGACATGGGGG - Intergenic
1092009599 12:5098418-5098440 GAGGACTGCGGCAGACTTGGAGG - Intergenic
1093184101 12:16000043-16000065 GATGCCTGTGGGACATATCGGGG + Intronic
1094637585 12:32241471-32241493 GTGCCCTCTGGGAAACATGGAGG + Intronic
1096594619 12:52686830-52686852 GAGGCCTGGGGGACAGATGGAGG - Intergenic
1097231153 12:57512066-57512088 CAGACCAGTGGGAGAGATGGTGG + Exonic
1097244172 12:57597284-57597306 AAGGCCTGGGGGAGCGATGGTGG + Intronic
1097293720 12:57941686-57941708 GAGGTCTGCGGGAGGCATGGCGG + Exonic
1099690670 12:85947563-85947585 GATACCTGGGGGATACATGGAGG + Intergenic
1101596403 12:106169429-106169451 GGGGCCTGTGGGGGAGTTGGGGG + Intergenic
1102473660 12:113174932-113174954 GAGGCCTGCAGGAGACATGGGGG + Exonic
1102959881 12:117085511-117085533 GGGGCCAGTGGGAGGCAGGGTGG - Intronic
1103702386 12:122854738-122854760 GAGACCTGTGGGAGACGCTGTGG - Intronic
1103911778 12:124355940-124355962 GAGGACAGTGGGAGCCATCGAGG - Intronic
1103946956 12:124532204-124532226 GGGGCATGGGGGAGACAAGGGGG - Intronic
1104788355 12:131466408-131466430 CAGGTCTGAGGGAGACATTGAGG - Intergenic
1104930655 12:132337724-132337746 GCGACCTGTGGGTGACGTGGCGG + Intergenic
1105209691 13:18250406-18250428 GAGGACTGTGGGGGCCATGTGGG - Intergenic
1107560782 13:41555072-41555094 GTGCACTGTGGGAGACAGGGAGG + Intergenic
1107668643 13:42719223-42719245 GGTGCCTGTGGGACACATGCAGG + Intergenic
1108508741 13:51136094-51136116 GAGGCCTGGGGGAGACCAGAGGG - Intergenic
1110309969 13:74037408-74037430 GATGCATGTGGTAGGCATGGGGG - Intronic
1110410136 13:75195859-75195881 GAGGCCTGTGGGTGTGGTGGTGG - Intergenic
1111300642 13:86345351-86345373 GAGGCCTGTAGGAGTCATTTAGG - Intergenic
1113631825 13:111893482-111893504 GAGGGCTGTGGGAGGGACGGTGG + Intergenic
1113702999 13:112401189-112401211 GAGCTCTGTGGGAGAGACGGAGG + Intronic
1115906438 14:38208272-38208294 TATTCCTGTGGGAGACACGGGGG + Intronic
1117397456 14:55325031-55325053 GGGGCCTGTGGGAGACAACTGGG - Intronic
1118720324 14:68589473-68589495 GGGGCTTGTGGCAGTCATGGGGG - Intronic
1118768305 14:68924908-68924930 GAGGACTGTGTGGGACATTGGGG + Intronic
1119406614 14:74403101-74403123 GAGGCCCCTGGGAGGCATAGGGG - Intergenic
1119426050 14:74535372-74535394 GAGGCCAGTGGGGAACAAGGTGG - Intronic
1121391133 14:93575886-93575908 GAGGCCTGTGGCATACAGTGGGG - Intronic
1122005569 14:98700709-98700731 GAGACCTGTGTGAGGCTTGGAGG + Intergenic
1122005572 14:98700720-98700742 GAGGCTTGGAGGAGACAAGGAGG + Intergenic
1122079380 14:99256542-99256564 GAGGCCTGGGGGAGAAAGGAGGG - Intronic
1122492824 14:102131275-102131297 GTGGCTTGTGGGAGAAATGAAGG - Intronic
1122631423 14:103109312-103109334 GAGGGAGGAGGGAGACATGGGGG - Intronic
1122631437 14:103109348-103109370 GAGGGAGGAGGGAGACATGGGGG - Intronic
1122631451 14:103109384-103109406 GAGGGAGGAGGGAGACATGGGGG - Intronic
1122631465 14:103109420-103109442 GAGGGAGGAGGGAGACATGGGGG - Intronic
1122631479 14:103109456-103109478 GAGGGAGGAGGGAGACATGGGGG - Intronic
1122631493 14:103109492-103109514 GAGGGAGGAGGGAGACATGGGGG - Intronic
1122631521 14:103109565-103109587 GAGGGAGGAGGGAGACATGGGGG - Intronic
1122631535 14:103109601-103109623 GAGGGAGGAGGGAGACATGGGGG - Intronic
1122631549 14:103109637-103109659 GAGGGAGGAGGGAGACATGGGGG - Intronic
1122847707 14:104509916-104509938 GAGCCCTCTGGGAGGCATGCGGG - Intronic
1124028713 15:25989934-25989956 GAGGCCTGGGGCAGGCAGGGTGG + Intergenic
1125084382 15:35713503-35713525 GAGGCCTTTGGGAGGCAAGTAGG + Intergenic
1125539883 15:40464177-40464199 GAGGGCTGTGGGTGACCTTGTGG + Intronic
1125728247 15:41879126-41879148 GAGGGCTGTGGCAAAGATGGGGG - Intronic
1126065707 15:44824796-44824818 GAGGCCTGTTGGGGAGTTGGTGG + Intergenic
1126094128 15:45075771-45075793 GAGGCCTGTTGGGGAGTTGGTGG - Exonic
1127273746 15:57424127-57424149 GAGCCCAGTGGGAGACGCGGAGG - Intronic
1127503845 15:59579434-59579456 GGGGCCTGTGGGAGGGGTGGGGG - Intergenic
1129252918 15:74318621-74318643 GAGGCCTGGGGCAGCCTTGGGGG - Intronic
1129296409 15:74602599-74602621 GGAGCCTGTGGGAGCCATGCAGG + Intronic
1129466817 15:75728718-75728740 CAGGCCAGTGTGAGGCATGGAGG + Intergenic
1129516332 15:76159835-76159857 GCGGCCTGTGGGGGAGAAGGAGG + Intronic
1130990584 15:88873487-88873509 GAGGCCTGGGGGACGCAAGGTGG - Intronic
1131380361 15:91958547-91958569 GAGGGCTGTTGGAGGAATGGAGG + Intronic
1131518010 15:93092112-93092134 GAGCCCAGTGCGTGACATGGAGG - Intergenic
1131959579 15:97774230-97774252 GAGGCCTGTGGGGGGAATGGGGG + Intergenic
1132150854 15:99457320-99457342 CACCCCTGTGGGAGACAGGGAGG - Intergenic
1133769065 16:8857181-8857203 TATGCTTGTGGGAGACAGGGTGG - Intronic
1134636328 16:15794730-15794752 GAGCCCTGTGGGAAGGATGGAGG + Intronic
1134690341 16:16187081-16187103 GAGGGGTGTGGGAGGGATGGGGG - Intronic
1134839877 16:17393185-17393207 GAGGCCTGTGGCAGACACTTTGG + Intronic
1135914622 16:26594658-26594680 GAGGACTGTGGTAGGCACGGGGG - Intergenic
1136337359 16:29618981-29619003 AAGGCCTGAGGGACACCTGGGGG - Intergenic
1136423302 16:30151183-30151205 GAGAGCTGTGCCAGACATGGTGG - Intergenic
1137553377 16:49455376-49455398 GGGGCCTGTGAGAGACAACGAGG + Intergenic
1137775236 16:51048669-51048691 GCATCTTGTGGGAGACATGGAGG + Intergenic
1138389926 16:56662884-56662906 GGGGCAGGTGGGAGGCATGGTGG + Intronic
1138590126 16:57995248-57995270 GAAGCCTGTGGGGGACCTGGTGG - Exonic
1138760131 16:59533522-59533544 GAAGCCTCTGGGAAACATGCAGG - Intergenic
1139265415 16:65634197-65634219 GTGTCCTGTGGGGGACCTGGCGG - Intergenic
1139631662 16:68235317-68235339 GACGCCTTTGGGAGACCTGCTGG - Intronic
1142352813 16:89587653-89587675 GGGGTCTGCGGGTGACATGGGGG - Intronic
1142436242 16:90059664-90059686 GAGGTCAGTGTGAGACCTGGGGG - Intronic
1142436249 16:90059701-90059723 GAGGTCAGTGTGAGACCTGGGGG - Intronic
1142899587 17:3003884-3003906 GAGCCCTGTGGGCCACACGGAGG - Intronic
1143071993 17:4303689-4303711 CAGTCCTGTGTGAGACATAGAGG - Intronic
1143474293 17:7193996-7194018 CAACCCTGTGGGATACATGGAGG + Exonic
1143724742 17:8837287-8837309 CAGGCCTGTGGGATGCAAGGAGG - Intronic
1144179165 17:12735800-12735822 GAGGCCAGAGGAAAACATGGTGG - Intronic
1144628510 17:16857768-16857790 GAGGCCTGGAGGGGACTTGGGGG + Intergenic
1144654780 17:17028614-17028636 GAGGCCTGGAGGGGACTTGGGGG - Intergenic
1145160098 17:20568339-20568361 GAGGCCTGGAGGGGACTTGGGGG + Intergenic
1145241468 17:21243037-21243059 GAGGCCTGTGGGTCACACGTAGG - Exonic
1145688450 17:26703644-26703666 GAGGCCTATGGTAGAAAAGGAGG + Intergenic
1146028352 17:29342697-29342719 GAGGTGTGTGGGAGACTTAGGGG + Intergenic
1147056074 17:37836260-37836282 GAGTGATGTGGGAGCCATGGGGG - Intergenic
1148076183 17:44936354-44936376 GACACCTGGGTGAGACATGGTGG + Exonic
1148693378 17:49545501-49545523 GAGGCCCGGGGGAGACAGGATGG + Intergenic
1149993330 17:61394713-61394735 GAGGCCGGTGGGAGCCAGCGTGG + Intergenic
1151355577 17:73556020-73556042 AGGGGCTTTGGGAGACATGGGGG + Intronic
1151379978 17:73719232-73719254 GAGGGGTGTGGGAGACAGAGAGG + Intergenic
1151484025 17:74387420-74387442 GAGGCCAGTCCGGGACATGGTGG - Intergenic
1151541558 17:74767387-74767409 GAGGCCCGGGGAAGAGATGGTGG + Intronic
1151746099 17:76012648-76012670 GGGGCCTGTGGGAGGCAGGCAGG + Intronic
1152091452 17:78249856-78249878 CAGGCCTGAGGGAGGCATAGAGG + Intergenic
1153151870 18:2105148-2105170 GTGGCATGTGGGAGCCATGAGGG - Intergenic
1153468520 18:5416301-5416323 GAGCTCTGTGGGAGATGTGGGGG + Exonic
1153985892 18:10350697-10350719 GAGGCCTGGGGGAGGCTTTGTGG + Intergenic
1154190385 18:12226198-12226220 GAGGGCAGTGGGAGACAGTGGGG - Intergenic
1154396850 18:13998618-13998640 GAGGCCTTTGAGAGGCACGGGGG + Intergenic
1156465682 18:37346793-37346815 GAAGCCTGGGGCAGCCATGGGGG + Intronic
1156736859 18:40270473-40270495 GAGCACTGTGGTAGACATTGTGG - Intergenic
1157441537 18:47715594-47715616 GTGGCTTGTGGGGGAAATGGGGG - Intergenic
1157506388 18:48229745-48229767 GAGGCCCGAGGAAGACGTGGGGG + Intronic
1158183169 18:54741251-54741273 CAGGGCTGTGGGTGACATGGTGG - Intronic
1158742068 18:60154301-60154323 GGGGCCTGTTGGAGAGTTGGGGG - Intergenic
1159110011 18:64044512-64044534 AAGGCCTGTAGGAGATATGAGGG + Intergenic
1159803439 18:72927297-72927319 GTGTGCTGTGGGAGCCATGGAGG - Intergenic
1160680395 19:409328-409350 GGGGCCGGTGGGAGACAAGCAGG + Intergenic
1160988452 19:1850975-1850997 GAGGGCAGTGGGAGCCATGGAGG + Intergenic
1161008880 19:1950583-1950605 GAGGCCTCTGGGAGACAGGAGGG + Intronic
1161042478 19:2117363-2117385 GACGCCTGTGGGGGACACAGGGG + Exonic
1161195424 19:2983693-2983715 GAGGGAGGTGGGAGCCATGGAGG + Intronic
1161257329 19:3316595-3316617 GAGGAAGGTGGGAGCCATGGAGG + Intergenic
1161289430 19:3485109-3485131 GAGGAATGTGGGAGCCATGGAGG + Intergenic
1161327547 19:3670922-3670944 GTGGCCTGTCAGAGACCTGGGGG - Intronic
1161431254 19:4233592-4233614 AAGGCAGGTGGGAGCCATGGAGG - Intronic
1161477711 19:4495654-4495676 GAGGGAGGTGGGAGCCATGGAGG + Intronic
1161492110 19:4567786-4567808 GAGGCAGGTGGGAGCCATGGAGG - Intergenic
1161513879 19:4685767-4685789 GCAGCCTGCGGGAGACAGGGCGG + Exonic
1161596679 19:5154259-5154281 GAGGGAGGTGGGAGCCATGGAGG + Intergenic
1161599192 19:5170523-5170545 GAGGAAGGTGGGAGCCATGGAGG + Intronic
1161619180 19:5289482-5289504 GAGGCAGGTGGGAGCCATGGAGG - Intronic
1161620950 19:5296802-5296824 GAGGAAGGTGGGAGCCATGGAGG + Intronic
1161621396 19:5299174-5299196 GAGGGAGGTGGGAGCCATGGAGG - Intronic
1161663843 19:5563195-5563217 GAGGGAGGTGGGAGCCATGGAGG + Intergenic
1161756450 19:6137544-6137566 GAGGGAGGTGGGAGCCATGGAGG + Intronic
1161760555 19:6168065-6168087 GAGGGAAGTGGGAGCCATGGAGG - Intronic
1162156954 19:8684671-8684693 GAGGGCTGTGGGAGAAGTCGAGG + Intergenic
1162304463 19:9863326-9863348 GAGGAAGGTGGGAGCCATGGAGG + Intronic
1162534088 19:11253057-11253079 GAGGGCGGTGGGAGCCATGGAGG + Intronic
1162871682 19:13591199-13591221 GAGTCAGGTGGGAGCCATGGAGG + Intronic
1162894663 19:13758000-13758022 GAGGAAGGTGGGAGCCATGGAGG - Intronic
1163188518 19:15658473-15658495 AATGCCTGTGGGAGAGAAGGGGG - Exonic
1163192259 19:15685865-15685887 GAGTCCTAAGGGAGACCTGGGGG + Intronic
1163200194 19:15761145-15761167 AATGCCTGTGGGAGAGAAGGTGG + Intergenic
1163291413 19:16381671-16381693 CAGGCCTGTCCGAGACATGAGGG + Intronic
1163456036 19:17406129-17406151 GGGGACTATGGGAGACATGGAGG + Intronic
1163626675 19:18394126-18394148 GAGGCCTGAGGGGAACAGGGAGG - Intronic
1164558190 19:29269487-29269509 GAGGCATGGGGGAGAGGTGGGGG + Intergenic
1165079037 19:33297402-33297424 AAGGCCTGTGGGTGCCTTGGAGG + Intergenic
1165443151 19:35842306-35842328 GAGCTATGTGGGAGACATGAGGG + Intronic
1165461826 19:35948460-35948482 GAGGCCTGGCGGAGACCTGAAGG + Intergenic
1166095750 19:40537971-40537993 TAGGGCTGTGGGACTCATGGAGG + Intronic
1166133921 19:40763839-40763861 ACGGCCTGTGGGGGACATGGGGG + Intronic
1166557441 19:43710291-43710313 GAGAGGTGTGGGAGCCATGGGGG - Intergenic
1167148695 19:47696783-47696805 CAGCCGTGTGGGAGACATGGAGG - Intronic
1167153677 19:47725119-47725141 GAGGCATGTGGCAGGCTTGGGGG + Intronic
1167599800 19:50448005-50448027 GAGGCCTGAGGGAGGCAGGGAGG - Intronic
1167623300 19:50570326-50570348 CTGGCCTGTGGGAGACCAGGAGG - Intergenic
1167786643 19:51643294-51643316 TAGCCCTGTGGGACACATGCAGG - Exonic
1168455931 19:56508149-56508171 GTGAGCTGTGGGAGAGATGGGGG + Intronic
925357387 2:3251601-3251623 GTGACTTGTGGGAGAGATGGTGG - Intronic
925378444 2:3406010-3406032 GAGGCCTGAGGGATTCATGCTGG - Intronic
925912846 2:8584340-8584362 GAGGCCTGTGGAAGTCACCGAGG - Intergenic
926335332 2:11858561-11858583 CAGGCCTGAGGTAGCCATGGAGG - Intergenic
927482359 2:23464439-23464461 GGGACCTGTGGGAGACAGGGAGG - Intronic
927517745 2:23682004-23682026 GGGGCCTGTGGGACACCTGGGGG - Intronic
927573665 2:24182458-24182480 GAGTGCTGTGGGGGAAATGGAGG + Intronic
929438030 2:41943443-41943465 GTGGCCAGTGGGAGAGTTGGGGG - Intronic
929452141 2:42045133-42045155 AAGCCCTGGGGGAGACAGGGAGG + Intergenic
929932009 2:46264661-46264683 GAGGCCTGTGGGAGCCGTGGAGG + Intergenic
933609971 2:84423465-84423487 GAGGAGAGTGGGAGAAATGGAGG - Intergenic
934721435 2:96579751-96579773 AAGGCCTGTGGGAGCCCAGGGGG + Intergenic
935216298 2:100977692-100977714 GGGGCCTGTGGGAGAGAAAGGGG - Exonic
936595424 2:113842618-113842640 GTGGTCTGGGTGAGACATGGTGG + Intergenic
936978701 2:118244049-118244071 GATTCCTGTGGGAGACTTGGAGG + Intergenic
936991550 2:118372246-118372268 GAGGCCTAAGGGAAACATAGGGG - Intergenic
937229953 2:120392324-120392346 GAGGCTTGTGAGAGGGATGGCGG + Intergenic
940200165 2:151141521-151141543 TAAGCCTGAGGGAGACAGGGTGG - Intergenic
941431656 2:165421433-165421455 GAGACCTGTGGAAGCCATGAGGG - Intergenic
942783427 2:179672600-179672622 GAGGCCTTTGGGAGACATCTGGG + Intronic
942951666 2:181728810-181728832 GAGGCTGATGGGAGCCATGGAGG - Intergenic
945155720 2:206835260-206835282 GAGGCATTTGAGAAACATGGAGG - Intergenic
946246454 2:218390562-218390584 GAGCCCTGTGGGAGAAGGGGTGG + Intronic
946401966 2:219472959-219472981 CAGGCCTGCGGGAGCCAGGGTGG + Exonic
948315848 2:237027626-237027648 GTGGCCGGTGGGTGACATGAAGG + Intergenic
948795262 2:240399286-240399308 GAGGCCTGTTGGGGACACGTTGG - Intergenic
949022310 2:241748573-241748595 GAGGACAGTGGCAGCCATGGTGG - Intronic
1170139936 20:13115632-13115654 GAGGCATGTGGGTGTCATGCTGG - Intronic
1170657155 20:18298571-18298593 ATGGCTTGTGGGAGACATGGTGG + Intronic
1172062482 20:32196102-32196124 GAGGCCTCTTGGAGACACAGAGG - Exonic
1172765487 20:37348522-37348544 GGGAGCTGTGGGAGTCATGGAGG + Intronic
1172878480 20:38181112-38181134 GGGGCCTTTGGGAGAATTGGAGG - Intergenic
1173946130 20:46952288-46952310 GAGGCCAGTGTGAGAGATGGAGG + Intronic
1174066790 20:47871609-47871631 GAGGCCCTTGGGGGACTTGGTGG + Intergenic
1175294209 20:57897318-57897340 GGGGACTGTGGGAGACGAGGAGG + Intergenic
1175712902 20:61235267-61235289 GGGGCCTGCGGGACACAGGGAGG + Intergenic
1176258988 20:64169120-64169142 GGTCCCTGAGGGAGACATGGAGG - Intronic
1179098434 21:38335965-38335987 GAGGTCTCTGGGAGAGATGGAGG + Intergenic
1179801522 21:43813520-43813542 GTGCCCTGAGGGTGACATGGGGG - Intergenic
1180766576 22:18348993-18349015 GAGGACTGTGGGGGCCATGTGGG + Intergenic
1180779738 22:18513385-18513407 GAGGACTGTGGGGGCCATGTGGG - Intergenic
1180812453 22:18770706-18770728 GAGGACTGTGGGGGCCATGTGGG - Intergenic
1181039269 22:20184281-20184303 AGGGCCTGTGGGATGCATGGGGG - Intergenic
1181039313 22:20184414-20184436 GGGGCCTGTGGGGTTCATGGGGG - Intergenic
1181039328 22:20184452-20184474 GGGGCCTGTGGGGTACATAGGGG - Intergenic
1181039334 22:20184471-20184493 GGGGACTGTGGGGTACATGGGGG - Intergenic
1181198611 22:21204953-21204975 GAGGACTGTGGGGGCCATGTGGG - Intergenic
1181401127 22:22650847-22650869 GAGGACTGTGGGGGCCATGTGGG + Intergenic
1181412012 22:22730767-22730789 GGGCACTGTGGGAGGCATGGAGG - Intergenic
1181419164 22:22785926-22785948 GGGCACAGTGGGAGACATGGAGG - Intronic
1182328895 22:29536324-29536346 GAGGCCGGTGGGGGCCATGCAGG + Intronic
1183012194 22:34955915-34955937 GAGGCCTGTTGGGGGGATGGGGG + Intergenic
1183037806 22:35153310-35153332 TAGGCCTTAGGGAGACAAGGTGG + Intergenic
1183039356 22:35164956-35164978 GGGGCCTGTCAGAGACGTGGAGG - Intergenic
1183362331 22:37389253-37389275 GGGGCCAGTGGGAGCCATTGTGG - Intronic
1183671300 22:39274411-39274433 AGGGACTGTGGGAGACCTGGGGG - Intergenic
1184108887 22:42383840-42383862 GAGAACTCAGGGAGACATGGGGG + Exonic
1184195616 22:42925803-42925825 GAGGCCGGTGGTAGACAGGCAGG - Intronic
1184245124 22:43231871-43231893 GATGTCTGTGGGAGCCAAGGGGG + Exonic
1184358304 22:43997142-43997164 GAGGCAAGAGGGAGAGATGGGGG - Intronic
1184688063 22:46105254-46105276 GAGCCCTGTGGGAGCCCTGTGGG + Intronic
1184835408 22:47018104-47018126 GAGGCCTGTGCCAGGCGTGGGGG + Intronic
1184925040 22:47630787-47630809 GAGGGCCTTGGGACACATGGAGG + Intergenic
1185011455 22:48316857-48316879 GGAGCCTGTGGGAGAGAGGGTGG + Intergenic
1203228194 22_KI270731v1_random:89884-89906 GAGGACTGTGGGGGCCATGTGGG + Intergenic
949964108 3:9340734-9340756 GAGCCCTGTGGAAGAGATGTTGG + Intronic
950212692 3:11135719-11135741 GGGGCCTGAAGCAGACATGGAGG + Intergenic
950563398 3:13749091-13749113 GAGGAAGGTGGGAGCCATGGAGG - Intergenic
950847833 3:16031883-16031905 GAGCACTGTGGCAGTCATGGAGG + Intergenic
950921635 3:16700681-16700703 GAGGCCTGGGGCACACTTGGAGG + Intergenic
952926876 3:38326683-38326705 GAGCCCTGTGGGCCCCATGGAGG - Intergenic
953136037 3:40182633-40182655 GAGACCTGTGGGACAGATTGGGG + Intronic
953783734 3:45894929-45894951 GAAGTCTGTGGGTGTCATGGTGG - Exonic
953800175 3:46016777-46016799 AAGGCCTGTGTGAGTCAGGGTGG - Intergenic
953851080 3:46465879-46465901 GGTGCCTGTGGGACACATTGGGG + Intronic
954032706 3:47831205-47831227 GAGGCCTCAGGAAGTCATGGTGG + Intronic
954082592 3:48221377-48221399 TTGGCCTGTGGGACACTTGGGGG - Intergenic
954136897 3:48586043-48586065 GAGGCCTCTGGGGGACTGGGTGG - Intronic
955885799 3:63596678-63596700 GAGGAATGTGGGAGGCATGCTGG + Intronic
956094708 3:65703742-65703764 GATGCCTGCGGGAGAGAAGGAGG + Intronic
956115161 3:65910831-65910853 GAGGCCTCTTTCAGACATGGTGG + Intronic
956188050 3:66581135-66581157 GAGGCCTGTGGGATAATTGATGG + Intergenic
957021592 3:75134370-75134392 GAGGGTTGTGGAAGCCATGGTGG + Intergenic
960710020 3:120518754-120518776 GAGGACTGTGGCAGCCATGGAGG - Intergenic
961009331 3:123425388-123425410 GAGGCCTGTTGCAGAGAAGGTGG - Intronic
961017920 3:123481776-123481798 GAGGGCTGAGGGAGGCAGGGAGG + Intergenic
961458978 3:127038328-127038350 GAGGCTGGTGGGAGACAGGTGGG - Intergenic
961522492 3:127475135-127475157 GGTGCCTGTGGGAGGCATGTTGG + Intergenic
962383435 3:134914576-134914598 GAGGGTTGTTGGAGACATGGGGG + Intronic
965526040 3:169719439-169719461 GGAGCCTGTGGGAGGCAGGGCGG - Intergenic
966933285 3:184689678-184689700 AAGGCCTGTGGGAGACATGCGGG + Intergenic
968271523 3:197407074-197407096 GAGGCGTGAGGGAGCAATGGGGG - Intergenic
968370265 3:198219539-198219561 GAGGCCCCTGGGAGGCAAGGCGG - Intergenic
968830552 4:2931271-2931293 GCGGCTGGTGGGAGACATCGAGG + Exonic
969301366 4:6299260-6299282 GAGGGCTGAGGGAGGCATGCTGG - Intronic
970414178 4:15840081-15840103 GAGGCCTGGGTGATACATGGTGG + Exonic
970601862 4:17647164-17647186 CAGGCCTGTGGGATACTTGGTGG - Intronic
971274536 4:25183249-25183271 GATGCCTGTGAGAGACCTGGGGG - Intronic
972855376 4:43099290-43099312 GAGGCCTCTGGAAGACGGGGAGG - Intergenic
976030161 4:80742053-80742075 GACTACTGTGGGAGAGATGGGGG + Intronic
977316539 4:95456033-95456055 GAGGCCTGTGAGTGACATCTAGG + Intronic
977322816 4:95540435-95540457 GATGGCTGTGGGAGGCAGGGCGG + Intronic
978340638 4:107718654-107718676 GAGACTTGTGCTAGACATGGTGG - Intronic
978683714 4:111414681-111414703 GGGACCTGTGGGAGACAGGCTGG + Intergenic
981029056 4:140105702-140105724 GTTGCCTGTGGGGGACATGGAGG + Intronic
981545740 4:145891689-145891711 TAGCCCTGTGGGAGGCTTGGGGG - Intronic
982540041 4:156657272-156657294 GAAGCCTGTGGGAGATGGGGAGG + Intergenic
982606085 4:157517801-157517823 GATGCCTGTGGGAGCCGAGGTGG + Intergenic
983767266 4:171499795-171499817 GAGGCTTGTGCCAGACATGTTGG - Intergenic
984658020 4:182340722-182340744 GAGAACTCTGGAAGACATGGTGG + Intronic
985542778 5:494488-494510 GAGGCCTTTGGGAGTCCTGCTGG + Intronic
986127236 5:4894413-4894435 GAAGCGGGTGGGAGTCATGGGGG + Intergenic
986300843 5:6477176-6477198 GAGGCCTGGGGGGCACGTGGAGG - Intronic
986928979 5:12795005-12795027 GAGGCCTGCGGCAGCCCTGGAGG - Intergenic
987300938 5:16597707-16597729 GGGGCATGTGGGAGACATGTTGG - Intronic
987391033 5:17375623-17375645 GAGCCCTGCGGGAGGCATGCAGG - Intergenic
988218868 5:28315479-28315501 GAGGCCTTTGGGAGACAATTAGG - Intergenic
988832718 5:35003253-35003275 GACGCCTGTCGGAGAGATGGAGG - Intronic
990398638 5:55412648-55412670 GAGGCCTATAGGAGAGATGAGGG + Intronic
996535905 5:124577572-124577594 AAGGCTTCTGGGAGACATTGGGG - Intergenic
996759438 5:126972523-126972545 GAGGCCTGGGTGAGACAAGCAGG - Intronic
997197014 5:131987140-131987162 GAGGCTCCTGGGAGACAGGGAGG + Intronic
997303830 5:132824622-132824644 GGGGCCCCTGGGAGGCATGGGGG + Exonic
997667437 5:135642981-135643003 CAGGCCAGTGGGAGCCAGGGCGG + Intergenic
998896645 5:146807048-146807070 GGAGCCTTTGGGAGACCTGGGGG + Intronic
999195278 5:149777583-149777605 GAGGCCTCTGGGACCCATGAGGG - Intronic
1000407068 5:160899380-160899402 AAGGCTTTTGGGAGACAGGGTGG + Intergenic
1000595441 5:163210212-163210234 GAGGCCTGTCGGAGGGTTGGGGG - Intergenic
1001313577 5:170627731-170627753 GAGGCTTGTAGGAGCCAAGGTGG + Intronic
1001436803 5:171705512-171705534 CAGGGCAGTGGGAGGCATGGAGG + Intergenic
1001868142 5:175123646-175123668 GAGGCATGTGGGAGAGAGGTGGG + Intergenic
1002047934 5:176552516-176552538 GCAGCCAGTGGGAGCCATGGAGG + Intronic
1002878524 6:1232514-1232536 GAGGCGGGTGGGTGACATGTGGG - Intergenic
1003128296 6:3373551-3373573 AAGGCCTGGGGGAGAGGTGGAGG + Intronic
1004335850 6:14763804-14763826 CCAGCCTGTGGGAGACAGGGTGG - Intergenic
1004429347 6:15529872-15529894 GAGGCCTGTGGGGCATGTGGTGG + Intronic
1005936532 6:30526803-30526825 GAGGCCTGTGGGGGGGTTGGGGG + Intergenic
1006839814 6:37021574-37021596 GGGGCCTGAGGGAGACATCCAGG + Exonic
1006893092 6:37446612-37446634 GAAGGCTGGGGGAGATATGGTGG + Intronic
1007061817 6:38947593-38947615 GAGGCCTGTGGGGGACACTGTGG + Intronic
1007128426 6:39447250-39447272 GAGTCCACTGGAAGACATGGTGG - Intronic
1007625515 6:43244052-43244074 AAGGCAGGTGGGAGGCATGGAGG - Intronic
1007762040 6:44138942-44138964 GAGGCCTGGGGGAGTGGTGGCGG - Intronic
1007971412 6:46055650-46055672 GATGCTTATGGGAGACATGAGGG - Intronic
1008937182 6:57004527-57004549 GGGGCATGTGGTAGTCATGGCGG - Intronic
1010816244 6:80361085-80361107 GAGGCCCCTGGAAGACATGAAGG - Intergenic
1011534437 6:88360802-88360824 GAGGCAGGTGGGAGACAGGGAGG - Intergenic
1011544244 6:88466788-88466810 GAGGCCTGTGCAAGACATGGTGG + Intergenic
1012725125 6:102801274-102801296 GAGGCCTGTGAGACACATGCTGG - Intergenic
1013643080 6:112107210-112107232 GAAGCCTGAGGGAGAGAGGGAGG - Intergenic
1014403661 6:121022426-121022448 TGGGCCTGTGTTAGACATGGCGG + Intergenic
1016804749 6:148201688-148201710 GGGGCCTGTCGAAGACCTGGAGG + Intergenic
1018606964 6:165607983-165608005 GAGTCCTGGGAGAGACATTGTGG - Intronic
1022063883 7:26830220-26830242 TAGGCCTTTGAGAGAGATGGAGG + Intronic
1023014786 7:35956062-35956084 GCAGCCTGTGGGGGGCATGGCGG + Intergenic
1023966645 7:44966310-44966332 CAGGCCTGGGGGAGAGATGATGG + Intronic
1024066218 7:45738958-45738980 GCAGCCTGTGGGGGGCATGGCGG - Intergenic
1024393347 7:48839716-48839738 GCAGCCTGTGGTAGACATTGTGG - Intergenic
1024587534 7:50854747-50854769 GAGGAGTGTGTGTGACATGGAGG - Intergenic
1024909974 7:54436268-54436290 GAGGACTGAGGAAGACATCGCGG - Intergenic
1026091220 7:67302439-67302461 GGCGCCTGTGGGAGTCGTGGAGG - Intergenic
1027031317 7:74890761-74890783 GGCGCCTGTGGGAGCCGTGGAGG + Intergenic
1027348214 7:77283977-77283999 GAGGCCTGTGGGAGTTTAGGGGG - Intronic
1028583457 7:92430203-92430225 CAGGACTGTGGGAGACGGGGGGG + Intergenic
1029399642 7:100335901-100335923 GGCGCCTGTGGGAGCCGTGGAGG - Intergenic
1029652347 7:101902135-101902157 GAGGCATGGGGAAGAGATGGTGG + Intronic
1030100466 7:105941005-105941027 AGGGTCTGTGGGAGACCTGGGGG - Intronic
1030647614 7:112081032-112081054 GTGGCCTGTGGGCTACTTGGCGG - Intronic
1031424974 7:121594496-121594518 CAGGCCCATGGGAAACATGGGGG - Intergenic
1031455335 7:121972064-121972086 GAAGCCTGGGTGATACATGGAGG + Intronic
1033243325 7:139699168-139699190 CAGGCTGGTGGGAGAGATGGCGG - Intronic
1034984044 7:155496587-155496609 GTGGCCTGTGGTAGCCATGAGGG - Intronic
1035061557 7:156073255-156073277 GAGACCAGTGGGAGAATTGGAGG + Intergenic
1035479170 7:159168388-159168410 TAGTCCTGTGGTAAACATGGGGG - Intergenic
1036515571 8:9440373-9440395 ATGGCCTGTGGGTCACATGGAGG - Intergenic
1037390245 8:18385797-18385819 GAAACCTGTGGCAGCCATGGAGG - Intergenic
1039558632 8:38495413-38495435 GAGCCCTGTGAGAGAATTGGGGG + Intergenic
1039634936 8:39154191-39154213 GGGGCCTGTCGGGGAGATGGGGG - Intronic
1040863268 8:52022773-52022795 GGGGCCTGTGAGAGGAATGGAGG - Intergenic
1043064036 8:75543481-75543503 GATGCCCATGGGAGACATCGGGG + Intronic
1043944156 8:86230959-86230981 CAGGACTTTGGGAGACAAGGTGG - Intronic
1044202845 8:89456929-89456951 CAGGGCTGTGAGAGACATGAGGG - Intergenic
1045064224 8:98431302-98431324 GAGGCTTGTGGGAGGCTGGGAGG + Exonic
1046181021 8:110647780-110647802 GAGGCAGGAGGGAGGCATGGAGG + Intergenic
1048267850 8:133003658-133003680 CGGGCCTCTGGGTGACATGGAGG - Intronic
1048278137 8:133083012-133083034 GTGGCGTGGGGCAGACATGGAGG + Intronic
1048444623 8:134484125-134484147 GAGCCCTGTGGGAGCAATGCAGG - Intronic
1049264686 8:141661110-141661132 GGGGGCTGTGGGGGACCTGGGGG + Intergenic
1049406802 8:142455236-142455258 GAGGCGAGTGGGAGTGATGGGGG - Intronic
1049993195 9:1009508-1009530 GTGGCATGTGGGTGACATGCTGG + Intergenic
1051057938 9:13009699-13009721 GAGGCCAGTGGGAGAAATGTAGG + Intergenic
1055544062 9:77348453-77348475 GGGGCCTGTTGGGGGCATGGTGG + Intronic
1055938752 9:81628390-81628412 GAGGCCTATGGGAACCATGGCGG - Intronic
1056387975 9:86115204-86115226 GAGGCGTGAGGGGGAAATGGAGG + Intergenic
1056655086 9:88502626-88502648 GTGGCCTGGGGGACACAAGGAGG - Intergenic
1057829127 9:98393546-98393568 GATGCATGTTGGAGACTTGGTGG - Intronic
1059406354 9:114100099-114100121 GAGGCCTGTAGGAGCCAGTGGGG + Intergenic
1059570643 9:115430824-115430846 GTGGCAGGTGGGAGACATTGGGG - Intergenic
1060660036 9:125399890-125399912 AAGGCCAGTGGGAGACACTGGGG + Intergenic
1061013524 9:127968991-127969013 CAGGCCTGTGCTAGACACGGGGG + Intronic
1061084065 9:128389243-128389265 GCCGCCTGTGGGAAAGATGGTGG - Exonic
1061301698 9:129709360-129709382 GAGGTTTGTGGGGGACATGAGGG + Intronic
1061490059 9:130939569-130939591 GCGGCCCGTGGGCGAAATGGGGG + Intergenic
1061674569 9:132208468-132208490 GAGGCCTGCAGGAGACTGGGCGG + Intronic
1062207613 9:135345980-135346002 GAGGGCTGTGGGCGACAGTGTGG + Exonic
1062276914 9:135735647-135735669 GAGGCCTGTGGGAGGCAGGTGGG - Intronic
1062379572 9:136280773-136280795 GAGGCCTGAGGAAGGCCTGGGGG - Intergenic
1062507450 9:136885450-136885472 GAGTCCTGTGGGCTGCATGGGGG - Intronic
1185693489 X:2175864-2175886 GAGGGCTGTGGCACACATCGAGG - Intergenic
1185827015 X:3261203-3261225 GGGGCCTGTGGGAGGTATGTAGG + Intergenic
1187500310 X:19833473-19833495 GAGGACTGTGGGAAAGAGGGAGG - Intronic
1188704270 X:33306570-33306592 GATGGGTGTGGGGGACATGGAGG + Intronic
1188753142 X:33927905-33927927 GAGGGCTGTGGGAGAAAGTGGGG + Intergenic
1189581153 X:42407856-42407878 GAGGCCTGTTGGAGGGTTGGGGG - Intergenic
1190333180 X:49248106-49248128 GAGGCCTGTGGGGGCCACAGGGG + Intronic
1191669433 X:63735392-63735414 CATGCATGTGGGAGTCATGGAGG - Intronic
1194250003 X:91562870-91562892 GAGGCCTGTGGGGGAGAGGAGGG + Intergenic
1196107265 X:111910392-111910414 CAGGGCTGTGGGAGAGAGGGAGG + Intronic
1197719478 X:129735402-129735424 GAGGGCAGTGGGAGCCATGGAGG + Intergenic
1197720053 X:129739013-129739035 GAGGGCTCTGGGAGCCAGGGTGG - Exonic
1197720899 X:129743986-129744008 GAGGGCTGTGAGTGACATTGTGG - Exonic
1199950982 X:152706141-152706163 GGGGCCTGAGGGAGAGAAGGGGG + Intergenic
1199958700 X:152762320-152762342 GGGGCCTGAGGGAGAGAAGGGGG - Intergenic
1200247155 X:154532305-154532327 GAGGCCGGTGGCACACAGGGAGG + Intronic
1200568964 Y:4804119-4804141 GAGGCCTGTGGGGGAGAGGAGGG + Intergenic
1201096515 Y:10624340-10624362 GAGACCTTTGGGGCACATGGTGG - Intergenic
1201251889 Y:12067144-12067166 GGGGCCTGTGGGAGCTATGCAGG - Intergenic