ID: 1077325048

View in Genome Browser
Species Human (GRCh38)
Location 11:1960066-1960088
Sequence GCTATGAGCACAGCCCGGTG CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 120
Summary {0: 2, 1: 0, 2: 2, 3: 11, 4: 105}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1077325048_1077325056 24 Left 1077325048 11:1960066-1960088 CCGCACCGGGCTGTGCTCATAGC 0: 2
1: 0
2: 2
3: 11
4: 105
Right 1077325056 11:1960113-1960135 GATGAGTTTATAGCCATGATGGG 0: 2
1: 0
2: 0
3: 9
4: 137
1077325048_1077325055 23 Left 1077325048 11:1960066-1960088 CCGCACCGGGCTGTGCTCATAGC 0: 2
1: 0
2: 2
3: 11
4: 105
Right 1077325055 11:1960112-1960134 TGATGAGTTTATAGCCATGATGG 0: 2
1: 0
2: 2
3: 18
4: 136

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1077325048 Original CRISPR GCTATGAGCACAGCCCGGTG CGG (reversed) Intronic
900151802 1:1182167-1182189 GCCAGCAGCACAGCCCGTTGGGG + Intronic
901286153 1:8080507-8080529 GCTGTAAGCACAGCCCCGAGGGG + Intergenic
902199822 1:14825013-14825035 GCTGTGAGCACACCTCGCTGTGG - Intronic
904161243 1:28523608-28523630 GCCATGAGCACAGCCCGGAATGG - Intronic
904771216 1:32882416-32882438 GCCAGGAGCACAGCCCGGGAGGG - Intergenic
912794810 1:112686475-112686497 GCTACTAGCACAACCCGGGGAGG - Intronic
915252800 1:154602564-154602586 GCTATGAGCACAGACAGCTCAGG - Exonic
917962756 1:180157434-180157456 GGGATGAGCACAGCCCTCTGCGG - Intronic
922588256 1:226752267-226752289 GCAATAAGCACAGCAGGGTGGGG - Intergenic
1070580793 10:77717653-77717675 GCTAGTAGCACAGCCAGGTTAGG + Intergenic
1070791502 10:79192214-79192236 GCTAGGATCCCAGCCCTGTGTGG + Intronic
1077325048 11:1960066-1960088 GCTATGAGCACAGCCCGGTGCGG - Intronic
1083488433 11:62997853-62997875 GCTATGTGCACAGCCCGTTTTGG - Intronic
1084091616 11:66882634-66882656 GCTAGGGGCACAGCCTGGTGCGG - Intronic
1084148046 11:67275411-67275433 GTTATGAGGCCAGCCCCGTGAGG - Intronic
1086415760 11:86587470-86587492 CATGTGAGCACAGCACGGTGGGG - Intronic
1089360295 11:117881354-117881376 GAAATGATCACAGCCCTGTGAGG - Intergenic
1202808030 11_KI270721v1_random:15245-15267 GCTATGAGCACAGCCCGGTGCGG - Intergenic
1094807854 12:34108621-34108643 GCTCTGTGCACAGCGAGGTGGGG + Intergenic
1101721366 12:107353239-107353261 GCTCTGAGCCCAGCATGGTGGGG + Intronic
1104785230 12:131444544-131444566 CCTCTGAGCAGAGCCCGGGGCGG - Intergenic
1104988517 12:132611171-132611193 GCCAGGAGCACGGCCCAGTGGGG + Intergenic
1106788476 13:33130352-33130374 GCTCTGAGGGCAGCCCTGTGTGG + Intronic
1107323330 13:39212301-39212323 GCAATGAGCACCGCCTGGAGGGG - Intergenic
1107481535 13:40789661-40789683 GCGGTGAGCGCAGCCCGGTCTGG + Exonic
1114683194 14:24504732-24504754 GCTATGAGGAGGGCCCTGTGTGG + Intronic
1119605489 14:76012626-76012648 GAAATGAGCACAGCCTGCTGGGG - Intronic
1120229741 14:81829585-81829607 GTTCTGAGCCCTGCCCGGTGGGG + Intergenic
1120850561 14:89165218-89165240 GATATGAGCACAGGCGTGTGTGG - Intronic
1122305690 14:100764934-100764956 GCTATGGTCACAGCACGGGGTGG + Intergenic
1129604463 15:77018081-77018103 ACACTGAGCACAGCCCTGTGGGG - Intronic
1132465030 16:73440-73462 GATATGAGCCCACCCCGGGGTGG - Intronic
1137519818 16:49182993-49183015 TCTGTGAGCACAGGCAGGTGAGG - Intergenic
1137718715 16:50614526-50614548 CCTATGAGCACAGCCCTGTCAGG + Intronic
1137734712 16:50715376-50715398 TTTATGTGCACAGCCTGGTGAGG + Intronic
1140043768 16:71426155-71426177 ACTCTGAGCACGGCCAGGTGGGG - Intergenic
1141521122 16:84580314-84580336 GCTATGATCACACCACTGTGAGG - Intronic
1141634391 16:85306222-85306244 GCTAGGAGCACAGCCAGGGCTGG - Intergenic
1142186531 16:88697462-88697484 CCTGTGAGCTCAGTCCGGTGAGG + Exonic
1144738403 17:17567659-17567681 GCTGTGAGCACAGCCCAGACAGG + Intronic
1145812414 17:27772438-27772460 GCAAAGAGCACAGCTCTGTGGGG + Exonic
1145899178 17:28478899-28478921 GCTATGACCACAGCCTGGGGAGG + Intronic
1145904261 17:28507734-28507756 GTTCTGAGCCAAGCCCGGTGGGG - Intronic
1161582998 19:5090906-5090928 GTCCTGTGCACAGCCCGGTGGGG + Intronic
1162003950 19:7765317-7765339 GCTATGAACAGAGCCTGGAGTGG + Intronic
1162600478 19:11664756-11664778 GCTACCAGCCCAGCCTGGTGAGG + Intergenic
1165448174 19:35868325-35868347 GCTATGGGCTCCGCCCGTTGTGG - Intronic
1166140857 19:40804412-40804434 GCGATGAGCTCAGCCTGTTGAGG + Intronic
1167721481 19:51182990-51183012 CCTGTGAGCACAGCCCGGTGTGG - Intergenic
1167763496 19:51463780-51463802 CCTGTGAGCACAGCCCGGTGTGG + Intergenic
1168142561 19:54398892-54398914 GATCTGAGCACAGCCCGGCTGGG + Intergenic
1168243753 19:55099653-55099675 GCTCTGAGCGCAGCCGGGTGTGG - Intronic
926116560 2:10217398-10217420 GCAGAGAGCAGAGCCCGGTGCGG + Intergenic
933274425 2:80268156-80268178 GCTATGAGCACAGCCATGTCTGG - Intronic
933768818 2:85730010-85730032 GCTGTGGGCCCAGCCCGGAGTGG - Intergenic
936055418 2:109258606-109258628 GTTAGGAGCACAGCCAGCTGTGG - Intronic
936977092 2:118231406-118231428 GCACTGAGCACAGCCCGCTAAGG + Intergenic
937269013 2:120635571-120635593 GTTATCTGCACAGCCTGGTGTGG + Intergenic
937452151 2:122010591-122010613 ACAGTGAGCACAGCCCTGTGGGG + Intergenic
940798655 2:158107820-158107842 GCAAGGAGCACAGCCTGGAGAGG - Intronic
941494828 2:166186901-166186923 GCTAGGATCACGGCCCGGCGTGG + Intergenic
945657695 2:212644862-212644884 GCTGTGAACACAGCAGGGTGTGG - Intergenic
948753622 2:240146243-240146265 GCTTTGAGCACAGGCTGGCGGGG + Intergenic
1170022478 20:11851681-11851703 GCTCTGGGCATAGCCCTGTGTGG - Intergenic
1172739640 20:37155837-37155859 ACTCTGAGGACAGCCAGGTGTGG + Intronic
1175265180 20:57698644-57698666 GACATCAGCTCAGCCCGGTGAGG + Intronic
1175366954 20:58462049-58462071 GCTGTGAGCCAAGCCCTGTGCGG - Intronic
1177032558 21:15999860-15999882 GATAAGAGCACAGCCAGGTGTGG + Intergenic
1177218005 21:18154097-18154119 GCTATGTGCCCAGCCTGGAGAGG + Intronic
1179543505 21:42099739-42099761 GGTATGATCACAGCTCGCTGCGG + Intronic
1179997069 21:44978862-44978884 GCACAGAGCACAGCGCGGTGGGG + Intergenic
1181882454 22:25991873-25991895 GCTGTGAGGACAGCAAGGTGGGG + Intronic
1182002915 22:26935892-26935914 GCTCTGAGCACAGAGAGGTGTGG + Intergenic
1184325166 22:43777413-43777435 GGAATGAGCACAGCCCTGAGGGG + Intronic
1184341951 22:43891056-43891078 GCGATGAGCTCATCCAGGTGTGG - Exonic
1184767431 22:46578895-46578917 CCTGTGAGCCCAGCACGGTGAGG - Intronic
949162713 3:900415-900437 GCTATGAGCCAATCCCAGTGAGG - Intergenic
949408466 3:3739193-3739215 GATAGGAGCACAGCCTCGTGTGG - Intronic
953390790 3:42532513-42532535 GCTCTGAGTGCAGCCTGGTGAGG - Intronic
963056488 3:141190379-141190401 CCTTGCAGCACAGCCCGGTGGGG - Intergenic
963612848 3:147493922-147493944 GCTATGTGCCCAGCCTGGAGAGG + Intronic
968178227 3:196569199-196569221 GCGATGAGAACAGCGAGGTGTGG + Exonic
968648191 4:1750133-1750155 CCTGTGAGCTCAGCCAGGTGGGG - Intergenic
969337503 4:6520274-6520296 GCTGTGAGCCCAGCCCGGGCCGG - Intronic
979848639 4:125548796-125548818 AATATGAACACAGCCTGGTGGGG + Intergenic
985531127 5:434380-434402 GCTGTGTGCCCAGCCAGGTGTGG + Exonic
985619963 5:948998-949020 GCTTTGAGGAAAGCCCAGTGAGG + Intergenic
985634778 5:1030667-1030689 CCCATGAGCCCAGCCCGGCGAGG - Intronic
985891600 5:2720075-2720097 CCTATGAGCACAGGACGGAGAGG + Intergenic
986231273 5:5866769-5866791 GCCATGTGCAGAGCCCGGTCTGG + Intergenic
987536797 5:19200074-19200096 GCTAGGAGCACAGAAGGGTGGGG + Intergenic
993504308 5:88692336-88692358 ACTGTGAGCACAGCCCGCTTGGG + Intergenic
994169500 5:96643052-96643074 GTTAAGAGCACAGCCCAGAGAGG - Intronic
998594627 5:143515981-143516003 GCCATGAGCACATCCCAGCGAGG - Intergenic
1002183006 5:177441205-177441227 GCCATGAGCCCAGCCAGGGGTGG - Intronic
1003370402 6:5520033-5520055 GCTAAGAGCACAGCATTGTGGGG - Intronic
1004334730 6:14754416-14754438 GCTATGATCACAGCTCACTGTGG + Intergenic
1006945826 6:37783939-37783961 GCCATTAGCACAGCCCGGCCCGG - Intergenic
1011226004 6:85108004-85108026 GCTGTTAGCACAGCCCAGAGGGG + Intergenic
1018064419 6:160115569-160115591 GCCCTGAGCACAGCCCCATGGGG + Intergenic
1019513632 7:1430265-1430287 GTGATGAGCACAGCCCGGCCGGG - Intronic
1020222369 7:6249554-6249576 AGTCTGAGCACAGCCCCGTGAGG + Intronic
1024274083 7:47663719-47663741 GCTATGAGGACAGCGAGGTCGGG + Intergenic
1034283440 7:149869053-149869075 ACCATGAGCACAGCCACGTGGGG - Intergenic
1034438229 7:151073860-151073882 GCTGTGAGCACAGGGCAGTGTGG - Intronic
1038351458 8:26779795-26779817 GCTTGGAGCACAGCACGGTTTGG + Intronic
1039504932 8:38044898-38044920 GCTGTGAGCACAGACCGGAGGGG + Intronic
1042213374 8:66404064-66404086 ACAATGAGGACAGCCAGGTGAGG + Intergenic
1048548689 8:135413278-135413300 GTTATGGGCACAGCCTGGTAAGG + Intergenic
1049548512 8:143246021-143246043 GCTGGGAGCACATCCCGGAGGGG + Intergenic
1051425024 9:16924365-16924387 GCTCTGCCCACAGCCCGGTGCGG - Intergenic
1053365118 9:37517459-37517481 GCTCAGAGCTCAGTCCGGTGGGG + Intronic
1056261784 9:84856011-84856033 GCTATTAGCCCAGCAGGGTGGGG + Intronic
1061935661 9:133856361-133856383 GCCAGGAGCCCAGCCCAGTGAGG + Intronic
1062544015 9:137053757-137053779 GCCAGGAGCAGAGCACGGTGGGG + Intronic
1189309949 X:40012197-40012219 GCTCTGAGCACAGAGCGATGCGG - Intergenic
1189356032 X:40310535-40310557 GCTCTGAGCACAGCTCTGTCAGG + Intergenic
1189717497 X:43881543-43881565 GGTATGTACACAGCCCCGTGTGG + Intronic
1195702179 X:107713957-107713979 GCTTTGTGCACAGCCCAGTGTGG - Exonic
1195727863 X:107936038-107936060 GCTGTGAGCTCAGCGCGCTGGGG + Intergenic