ID: 1077327808

View in Genome Browser
Species Human (GRCh38)
Location 11:1971264-1971286
Sequence CTGTGTGGCTGGAAGGTGGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 673
Summary {0: 2, 1: 0, 2: 3, 3: 64, 4: 604}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1077327808_1077327816 0 Left 1077327808 11:1971264-1971286 CCCTCCACCTTCCAGCCACACAG 0: 2
1: 0
2: 3
3: 64
4: 604
Right 1077327816 11:1971287-1971309 AGGGCCCCCCAGTGCGCCCCTGG 0: 2
1: 0
2: 0
3: 21
4: 192

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1077327808 Original CRISPR CTGTGTGGCTGGAAGGTGGA GGG (reversed) Intronic
900123160 1:1058205-1058227 CTGTGTGCCTGGCAGGTGTCAGG + Intergenic
900599453 1:3496876-3496898 CTGAGGGGGTGGAAGATGGAGGG - Intronic
900618459 1:3576181-3576203 CTGTCTGCCCGGAGGGTGGAGGG - Intronic
900763768 1:4489706-4489728 CTGGGTGGCTGGAAGGCAGGGGG + Intergenic
900804635 1:4759407-4759429 CTCTGGGGCTGGAAGCTGGATGG + Intronic
900869345 1:5290828-5290850 ATGGGTGGATGGATGGTGGATGG + Intergenic
901700270 1:11041584-11041606 GTGGGTGGATGGATGGTGGATGG + Intronic
902370748 1:16005419-16005441 CTGTGTTCCTGGAAGGCAGATGG + Intronic
902607645 1:17577668-17577690 CTTTGGGGCTGGAATCTGGAAGG - Intronic
902646789 1:17805117-17805139 CCGTGTGGCTGGAAGGGAGCTGG - Intronic
902721448 1:18306942-18306964 CTGGGTTCCTGGAAGGTGGCAGG - Intronic
902738554 1:18418035-18418057 CCCTGTGGCTGGGAGGTGCATGG - Intergenic
902870937 1:19312991-19313013 CTGTGTGCCCGGACGCTGGAGGG + Intronic
902876639 1:19344495-19344517 CTGCAGGGCTGGCAGGTGGAGGG - Intronic
903692877 1:25186624-25186646 CTGTGTGGGCGGAAGGAGAAGGG - Intergenic
903827344 1:26155779-26155801 CTGTGTGGCTTGGAGATGCAGGG - Intergenic
904251010 1:29224288-29224310 CTGTCTGGCTGGAGGCTGGGAGG + Intronic
904438514 1:30514932-30514954 CTGAGTGGATGGAAGGTTGGGGG - Intergenic
904565929 1:31428492-31428514 GTGGGTGGCTGGCAGGTGCAGGG + Intronic
904790770 1:33018993-33019015 CTGGGGGGCAGGAAGGTAGAAGG - Intronic
904913526 1:33953214-33953236 ATGTGTGTCTCCAAGGTGGAAGG + Intronic
905222090 1:36455158-36455180 CTGTGTGGATGGTAGATGGGAGG - Intergenic
905876545 1:41435415-41435437 ATGTGTGGCTGGATGGAGGGTGG + Intergenic
906114860 1:43349604-43349626 CAGTTTGGCTGAAGGGTGGACGG - Intronic
906154781 1:43607552-43607574 CTTTCAGGCTGGAAGGTGCACGG - Intronic
906785350 1:48610851-48610873 GTGTGTGTGTGGAAGGAGGAGGG - Intronic
907313393 1:53552635-53552657 CTGGGAGGATGGATGGTGGAGGG - Intronic
907999755 1:59668530-59668552 CTGTGTGGCTTAGAGGGGGATGG - Intronic
908180212 1:61596496-61596518 CTGTGTGTAAGGGAGGTGGAGGG - Intergenic
909508145 1:76418367-76418389 CAGTGTAGCTTGAAGGTGGAGGG + Intronic
909964884 1:81896347-81896369 CTGTGAGGGTGGGAGGGGGACGG + Intronic
910439521 1:87238352-87238374 CTAGTTGGCTGGTAGGTGGACGG + Intergenic
910658593 1:89644661-89644683 CTCTGTGGTTGGAAAGTGAAGGG + Intronic
910934486 1:92476208-92476230 CTGTGGGGATGGGAGGGGGAGGG + Intronic
913220155 1:116653632-116653654 CTGGGTGGGTAGAGGGTGGAAGG - Intronic
913486663 1:119337826-119337848 CTGTGTTGGTTGAAGGTGGGTGG + Intergenic
914754610 1:150555544-150555566 CTGTGTGGCTGGACGCTGTCTGG + Exonic
915113303 1:153578575-153578597 CAGTGTGGCTGGAGCATGGATGG + Intergenic
915418429 1:155760332-155760354 CTGTGTGTCTGGAAGGAGCTGGG + Intronic
915560098 1:156682117-156682139 CTGTCTAGCTGGGAAGTGGAGGG - Intergenic
916751537 1:167727249-167727271 CAGTGTGGATGCAAAGTGGATGG - Intronic
917515327 1:175702424-175702446 CTGTGGGTCTGGAAGCTGGAAGG - Intronic
917701614 1:177587384-177587406 CTGTGTGGCTGGAAGGGAATTGG - Intergenic
918578752 1:186099317-186099339 CTGTGTGTCTGGGAGGTGCAGGG + Intronic
918585868 1:186187788-186187810 ATGTGTGACTAGAATGTGGAGGG - Intronic
918984662 1:191608615-191608637 CTGTCTGCCTGCAAGGTGGCTGG - Intergenic
919423891 1:197405829-197405851 CGGGGTGGCTGCCAGGTGGAGGG - Intronic
920433008 1:205930684-205930706 TGGTGTGGCTGGAGGGTAGAGGG - Intronic
920515454 1:206581776-206581798 CTGTGGGATTGGAAAGTGGAAGG + Intronic
920573571 1:207037444-207037466 CTGTGTGGATGGAAGAGAGAAGG - Intronic
920920390 1:210293159-210293181 AAGTTTGGCTGGAGGGTGGAGGG + Intergenic
922350637 1:224732283-224732305 CTGCGTGGCCGGGAGGTCGATGG + Intronic
922711165 1:227834081-227834103 TTCTGTGGCTGGCAGGTGCATGG - Intronic
922792850 1:228319704-228319726 ATGGGTGGATGGCAGGTGGATGG - Intronic
922934283 1:229411493-229411515 CTCTGGGGCTGGAAAGGGGAGGG - Intergenic
923737214 1:236621894-236621916 CTGTGTGCCAGGAAGGAGCATGG + Intergenic
924565882 1:245198055-245198077 ATGTGTGGGTGGTAGGAGGAAGG - Intronic
1062812591 10:477609-477631 ATGGGTGGGAGGAAGGTGGATGG + Intronic
1063092507 10:2879713-2879735 CTGTGAGCCTGGAGGGTGGCAGG + Intergenic
1063904354 10:10767018-10767040 GTGTGTGGCTGGAAGTTCTATGG + Intergenic
1064535224 10:16351235-16351257 CTGTCTCGGTGGCAGGTGGAGGG - Intergenic
1064959122 10:20944038-20944060 CTGTGTGTCTGAAAGTTAGATGG - Intronic
1065028064 10:21557755-21557777 CTCTGTGGCTGGAGTGGGGAGGG + Intronic
1065145528 10:22764206-22764228 CAGGGTGGCTGGGAGGTGAAGGG + Intergenic
1067051892 10:43026395-43026417 CTGTGTCACTGGAAGGAGGAAGG + Intergenic
1067726329 10:48773990-48774012 CTCTGTGGGGGGAAGGTGGCTGG - Intronic
1067786529 10:49253500-49253522 CTGGGTGGGAGGAAGGAGGAGGG + Intergenic
1067808236 10:49407907-49407929 GTGGGTGGATGGAAGGAGGAAGG + Intergenic
1067997420 10:51289699-51289721 GTGTGTGTCTGGGTGGTGGATGG + Intronic
1068606064 10:59006270-59006292 CTGTGAAGCTGGAGGGAGGAAGG + Intergenic
1068880872 10:62047645-62047667 CAGGGTGGCTGGAAGGAGGTGGG + Intronic
1069775433 10:70924468-70924490 CTGCCTGGGTTGAAGGTGGATGG - Intergenic
1070310083 10:75266582-75266604 CTGTATGTATGTAAGGTGGATGG + Intergenic
1070756409 10:78996163-78996185 CTGTGTAGCAGGAGGGGGGAGGG - Intergenic
1071663953 10:87535128-87535150 CTGTGTGGATGTAAGATGTAAGG + Intronic
1072075373 10:91967074-91967096 CTGTGTGGCTGACAGTTGGGTGG + Intronic
1073037344 10:100573277-100573299 CTGTGTGGCGGGCATGGGGAGGG + Intergenic
1073094693 10:100972469-100972491 GTATGTGGGTGGAAGATGGATGG - Intronic
1073477112 10:103761638-103761660 CTGTGTGGGTGGCAGGTGGCTGG - Intronic
1074162656 10:110846893-110846915 ATGTGGAGCTGGAAGGAGGAAGG - Intergenic
1075762437 10:124866832-124866854 CTGTGTGGCTGGCACATGGGAGG - Intergenic
1075995361 10:126872407-126872429 CTGTGTGGCTGGATGCTGAGAGG - Intergenic
1076057465 10:127387216-127387238 CAGTGTGGCTGGAATGCAGAGGG - Intronic
1076371024 10:129953736-129953758 CTGGGTGGATGGAAGGTGCAAGG - Intronic
1076420218 10:130326138-130326160 CTGTGGGGTTGGAGGGAGGAAGG + Intergenic
1076931314 10:133533674-133533696 CTGTGGAGCTGGGAGGTGGCTGG + Intronic
1076980847 11:203943-203965 CTGTGTGGAAGGAAGGAGGAGGG + Exonic
1077009606 11:374339-374361 CTGTGGGGATGGACGGGGGAAGG + Intronic
1077136727 11:1003258-1003280 CTGTGCTGCTGGTGGGTGGATGG + Intronic
1077327808 11:1971264-1971286 CTGTGTGGCTGGAAGGTGGAGGG - Intronic
1077577718 11:3397376-3397398 CGGGGTGGCTGCCAGGTGGAGGG - Intergenic
1077602298 11:3582020-3582042 CTGTGGGGCTGGAGCATGGAGGG + Intergenic
1078408238 11:11089824-11089846 AGGGGTGGATGGAAGGTGGAAGG + Intergenic
1078457742 11:11488553-11488575 CTATGTGGCAGGAAGGATGATGG - Intronic
1078536118 11:12175850-12175872 CTATGTAGCTGGAAGGAGGCAGG + Intronic
1079115177 11:17635891-17635913 CTGTCAGGCTGGAGGGTGGGAGG + Intronic
1079148778 11:17878726-17878748 TTGTGTGGCTGGTAGGTGAAAGG - Intronic
1079304220 11:19308310-19308332 CTCGGAGGCTGGAGGGTGGAAGG - Intergenic
1079692980 11:23442880-23442902 TTGTTTTGCTGGAAGCTGGAGGG + Intergenic
1080383354 11:31796467-31796489 CTGGGGGGATGGAGGGTGGATGG + Intronic
1080613405 11:33925105-33925127 CTGTGGGGATGGAATGTGTAGGG + Intergenic
1080770569 11:35337248-35337270 CTGTTTGGCTGGATGTTGGTAGG - Intronic
1081642516 11:44766017-44766039 CTGGGTTGCTGGTAGGTGGTTGG + Intronic
1082166447 11:48955730-48955752 CTGGGTGGCTGCCGGGTGGAGGG + Intergenic
1082269781 11:50157397-50157419 TGGTGTGGCTGGAGGGGGGAGGG + Intergenic
1082759262 11:57110943-57110965 CTGTGTGGCTGGAGAAGGGAAGG - Intergenic
1082801929 11:57421243-57421265 CAGGGTGGCGGGAAGGTGGAGGG - Intronic
1082821176 11:57545791-57545813 CTGTGGGGCTGGAGGGTGGGTGG - Intronic
1083826434 11:65206601-65206623 TTGTTGGGCTCGAAGGTGGAGGG - Exonic
1084033019 11:66492199-66492221 CTCAGTGGCTGGAAGCAGGATGG + Intronic
1084258193 11:67956571-67956593 CTGTGGGGCTGGAGCGTGGTGGG + Intergenic
1084448036 11:69215453-69215475 CTTGGGGGCTGGGAGGTGGAAGG - Intergenic
1084544835 11:69810069-69810091 CTGTGTGGCAGGAAGCCGGCAGG - Intergenic
1084562803 11:69913878-69913900 CTGTGGGGCCGTAAGGAGGAGGG - Intergenic
1084609812 11:70194913-70194935 ATGTGTGGATGGATGGTAGATGG + Intergenic
1084705143 11:70811757-70811779 ATGGATGGCTGGATGGTGGATGG - Intronic
1084814553 11:71638643-71638665 CTGTGGGGCTGGAGCATGGAGGG - Intergenic
1084949144 11:72655056-72655078 GTGTGGGGCTGGCAGGTGAATGG + Intronic
1084981077 11:72829083-72829105 CTGGTCGGGTGGAAGGTGGAGGG - Intronic
1085278298 11:75314060-75314082 CAGTGTGGCTGGAGGGTGTGTGG - Intronic
1085397235 11:76212811-76212833 CTGAGTAGCTGGCAGGTGGCAGG - Intergenic
1085414265 11:76309930-76309952 CCCAGTGGCTGGGAGGTGGAGGG + Intergenic
1088619128 11:111664073-111664095 CTTACTGGCTGGAAGGTGGAAGG - Intronic
1089387765 11:118079316-118079338 CTGTGGGGATGGAAGGAGGTAGG - Intronic
1089869615 11:121660490-121660512 CTATGTGACTGGAAGGTAGTAGG + Intergenic
1090247092 11:125224263-125224285 CTCTGTGGCTGGCAGGTGCCAGG + Intronic
1202810788 11_KI270721v1_random:26444-26466 CTGTGTGGCTGGAAGGTGGAGGG - Intergenic
1091752277 12:3030436-3030458 CTGCGTGGCTCGGAGCTGGAGGG - Intronic
1091848642 12:3677707-3677729 AGGTGTAGCTGGCAGGTGGAAGG - Intronic
1092122827 12:6056675-6056697 CTGTCCTGCTGGGAGGTGGAAGG + Intronic
1092231613 12:6778728-6778750 CACTGTGGGTGGAAGGTGGGTGG - Intergenic
1095962644 12:47845069-47845091 CTGTGTGGGTGGGGGGTGGTGGG - Intronic
1096167591 12:49437112-49437134 CGGTGTGGCTGCCGGGTGGAGGG + Intronic
1096411862 12:51382798-51382820 CAGTGTGGATGGAAGAGGGAGGG + Intronic
1096467071 12:51852481-51852503 CTGTGTGACTGTAAGGTACATGG - Intergenic
1096491575 12:52015612-52015634 CTGTGTGTGTGGAGGGTGGGGGG - Exonic
1096874589 12:54617396-54617418 CTGCTTGGCTTGAGGGTGGAGGG + Intergenic
1097723783 12:63051520-63051542 CTGTGTGGCGTGACGGTGGCTGG + Intergenic
1098095051 12:66946001-66946023 CTGTGTAGCAGGAAGAAGGAAGG - Intergenic
1099725897 12:86427497-86427519 CTGTGTGTGTGTAAGGTGGATGG - Intronic
1099760179 12:86911438-86911460 CTGTCAGGGTGGAAGGTGAAGGG - Intergenic
1100980146 12:100157124-100157146 CTGTAGGGGTGGAGGGTGGAGGG - Intergenic
1101301709 12:103489672-103489694 CTGTGAGGCTGCAGTGTGGATGG - Intronic
1101623973 12:106420339-106420361 TTGAGTAGCTGGAAGGTGAAGGG - Intronic
1102585692 12:113921385-113921407 GGGTGTGGGTGGAAGGTGGGGGG - Intronic
1102867922 12:116388948-116388970 GTGTGTGGCGGGAGGGTGGAGGG - Intergenic
1102956976 12:117065181-117065203 CCGTGAGCCTGGATGGTGGATGG + Intronic
1103909774 12:124345824-124345846 CTGTGGGGCTGTGAGGCGGAAGG - Intronic
1104038271 12:125113529-125113551 CTGTGTGTCTGGCAGGGGCAGGG - Intronic
1104475272 12:129065967-129065989 CTGGATGGTTGGATGGTGGATGG - Intergenic
1104702517 12:130917955-130917977 CTGTGTGGTTGGAACATGGTGGG + Intergenic
1104896219 12:132166301-132166323 CTGGGTGGATGGATGATGGATGG - Intergenic
1104896270 12:132166519-132166541 CTGGGTGGATGGATGATGGATGG - Intergenic
1104913024 12:132249042-132249064 CTGGGTGTCTGGAAGGTGGCGGG + Intronic
1104984097 12:132587010-132587032 CAGTGCGGCTGGAGGGAGGACGG + Intergenic
1104984126 12:132587120-132587142 CAGTGCAGCTGGAGGGTGGACGG + Intergenic
1104984132 12:132587143-132587165 CAGTGCGGCTGGAGGGTGGACGG + Intergenic
1104984198 12:132587433-132587455 CAGTGCGGCTGGAGGGAGGACGG + Intergenic
1104984204 12:132587456-132587478 CAGTGCGGCTGGAGGGAGGACGG + Intergenic
1108800068 13:54084095-54084117 CTGTGTGACTGGCAGGTGGTCGG - Intergenic
1109000800 13:56802516-56802538 CTTAGTGGCTGGAAGGTTGTTGG - Intergenic
1111073408 13:83200055-83200077 ATGGGGAGCTGGAAGGTGGATGG - Intergenic
1112816061 13:103274878-103274900 CTTTGGAGCTGGAAGGTTGAGGG + Intergenic
1113400742 13:109990530-109990552 CCGTGTGGGTGGACGATGGATGG - Intergenic
1113461892 13:110487992-110488014 CTTTGTGGGAGGAAGGGGGAGGG - Intronic
1113709218 13:112452975-112452997 CAGTGTGGCTCCAAGGTGGCCGG - Intergenic
1113729023 13:112626404-112626426 CTGTGTGACTAGCAGGAGGAGGG - Intergenic
1113767656 13:112891042-112891064 CTGGGTGGCTGGAGGGAGCAGGG - Intergenic
1113780280 13:112972814-112972836 ATGGATGGATGGAAGGTGGATGG + Intronic
1114575909 14:23713314-23713336 CCATCTGTCTGGAAGGTGGAAGG + Intergenic
1115413566 14:33103904-33103926 ATGTGTGGCAGAAAGGAGGAAGG + Intronic
1116258603 14:42590309-42590331 TTGTGTGGGAGAAAGGTGGAAGG - Intergenic
1119554891 14:75545755-75545777 GTGTGTGGGTGGGAGGTGGCGGG - Intronic
1119601490 14:75979915-75979937 CTGTGTGTGTGGAAGGAAGAGGG - Intronic
1120948964 14:90023340-90023362 CTGTGTGCTTGGAATGGGGATGG + Intronic
1121096377 14:91220610-91220632 CCGTGTGGCTGGGAGGCAGATGG + Intronic
1121936717 14:98026383-98026405 ATGAGTGGATGGTAGGTGGATGG + Intergenic
1122418901 14:101563329-101563351 TTGTGGGGCTGGGAGGTGGAGGG + Exonic
1122600892 14:102921282-102921304 CTGAATGGATGGATGGTGGATGG - Intergenic
1122631051 14:103107923-103107945 CTGTGGGGCTGGGGGGTGGAGGG + Intronic
1122958524 14:105083822-105083844 ATGGGTGGATGGAGGGTGGAGGG - Intergenic
1123899438 15:24861939-24861961 CTGTGTGGCAGGAAGACTGATGG + Intronic
1124201594 15:27682944-27682966 CTCACAGGCTGGAAGGTGGAGGG - Intergenic
1124787850 15:32698674-32698696 CAGAGTGGCTGGAAGGAGAAGGG + Intergenic
1126340390 15:47634897-47634919 ATGTCTGACTGGAATGTGGAAGG + Intronic
1127214776 15:56812803-56812825 CTTTGTGGCTGAGAGCTGGAGGG + Intronic
1127330139 15:57931120-57931142 ATGTGTGGCTGAAAAATGGAGGG - Intergenic
1128058777 15:64720145-64720167 CTGTGCCACTGGAAGGTAGAAGG - Intergenic
1128066895 15:64770788-64770810 TTGTGTGGATGGAACGGGGAGGG - Intronic
1128225923 15:66001303-66001325 CTGTCTGGCTGGTATGAGGAAGG + Intronic
1128878638 15:71223077-71223099 CAGTGTGTCTGGCAGGTGGAAGG - Intronic
1129154355 15:73708698-73708720 GAGTGTGACTGGAAGGTGGTGGG + Intronic
1130531584 15:84750808-84750830 CTGTGGGGCTGGAGGGGGAAAGG + Intronic
1131037447 15:89232614-89232636 CTGTGTCCTTGCAAGGTGGAAGG - Intergenic
1131070598 15:89463311-89463333 CTGCCTGCCTGGAAGGGGGAAGG + Intergenic
1131413598 15:92232192-92232214 GTCTGTGGCTGGAGGGAGGAGGG + Intergenic
1132653782 16:1033169-1033191 ATGGGTGGATGGATGGTGGATGG - Intergenic
1132889032 16:2195359-2195381 CTGTGGGGGTGGAGGGAGGAGGG + Intronic
1133335825 16:5006123-5006145 GAGTGGGGCTGGGAGGTGGAGGG + Intronic
1134112643 16:11524745-11524767 CTGGGTGGCTGGAGGGAGGGAGG - Intergenic
1135548105 16:23379100-23379122 GTGTGTGGGTGGATGATGGAGGG - Intronic
1137299458 16:47133720-47133742 CAGTGTGGTTGGCAAGTGGAAGG + Intronic
1137441692 16:48503803-48503825 CTGAGAGGCTGGCAGGGGGATGG + Intergenic
1137492335 16:48943651-48943673 CTCTGGGGCTGGAAGGAGGGTGG + Intergenic
1138151176 16:54658553-54658575 CAGTGTGGCTGGAAGGTTAGAGG + Intergenic
1138467279 16:57201161-57201183 CGGTGTGGCTGCCAGGTGGAGGG + Intronic
1138467298 16:57201241-57201263 CGGTGTGGCTGCCAGGTGGAGGG + Intronic
1138633642 16:58319431-58319453 ATGTCTGGCAGCAAGGTGGAGGG - Intronic
1139229542 16:65270325-65270347 CTGTATGGGTGGAAAATGGAAGG - Intergenic
1139423836 16:66866554-66866576 CTCTGGGGGTGGAAGGTGGGGGG + Intronic
1139430637 16:66909356-66909378 GTGTGTCGCTGCAACGTGGAGGG - Exonic
1139487073 16:67263954-67263976 CTGTGTAGCTAGAAGGGGGCAGG + Intronic
1139593920 16:67947489-67947511 CTATGTGGATGCGAGGTGGAGGG + Intronic
1140022048 16:71247957-71247979 CTGTGTGCGTGGCAGGGGGAGGG + Intergenic
1140067682 16:71625367-71625389 GTGGGTGGATGGATGGTGGATGG + Intergenic
1140067784 16:71625713-71625735 ATGGGTGGATGGATGGTGGATGG + Intergenic
1140853252 16:78954301-78954323 CTGAGTGGATAGAAGGTGGATGG + Intronic
1140893529 16:79305513-79305535 CTGAGGGTCTGCAAGGTGGATGG + Intergenic
1141379414 16:83562637-83562659 CTATGTGGCATGAAGGTTGAAGG - Intronic
1141421535 16:83921001-83921023 ATGGGTGGATGGATGGTGGAGGG + Exonic
1141421595 16:83921268-83921290 ATGTTTGGATGGATGGTGGAGGG + Exonic
1141442315 16:84037322-84037344 CTGTGTGGCATGAAGCAGGATGG + Intronic
1141647158 16:85373701-85373723 GTGTGTGGCGGGTGGGTGGAGGG + Intergenic
1142005127 16:87686057-87686079 CTCCGTGGCTGGAGGGTGGCTGG + Intronic
1142032340 16:87844783-87844805 CAGAGTGGTTGGAAGGCGGAAGG - Intronic
1142124138 16:88401821-88401843 TTGGGTGGATGGATGGTGGATGG + Intergenic
1142255623 16:89012411-89012433 ATGGGTGGATGGATGGTGGATGG - Intergenic
1142899524 17:3003615-3003637 CTGCATGGCTGGAAGGAGGAAGG - Intronic
1143060426 17:4196033-4196055 CTGTGTGGGTGGGGGGTGGTGGG - Intronic
1143116974 17:4586675-4586697 CGGGGTGGATGGAAGGTGGAGGG + Intronic
1143861894 17:9897268-9897290 CGGGGTGGCTGGAGGGTAGAAGG - Exonic
1143952969 17:10648159-10648181 CTGTGTGGTTGTAGGGAGGAGGG - Intronic
1144256723 17:13475740-13475762 CTGTGAGGCTGGAAGCAAGATGG - Intergenic
1144461341 17:15460894-15460916 CACTGTGGCTGGAGGGTGGTTGG - Intronic
1144573538 17:16415504-16415526 CTTAGTGGCTAGAAGGGGGAGGG + Intergenic
1144733684 17:17542933-17542955 CTCTGAGGCTGGAAGGGGCATGG + Intronic
1145780528 17:27560060-27560082 CCACGTGGCTGGAGGGTGGAAGG + Intronic
1145818774 17:27815000-27815022 GTGTGTGGCTGGGAGGGGAAGGG + Intronic
1146596416 17:34173000-34173022 CTGTGAGGCTAGAAGGAAGATGG + Intronic
1146631476 17:34473320-34473342 CTGTGTGGCTGGATGGCCCAGGG + Intergenic
1146820913 17:35983033-35983055 ATGTGTGGATGGAAGGATGAAGG - Intergenic
1146986030 17:37219076-37219098 CTGTGTGATTAGAAGGTTGAGGG + Intronic
1147129714 17:38399943-38399965 CTGTGGGCCTGGAAGATGGGAGG + Exonic
1147150684 17:38511816-38511838 CTGTGTGCCTGGGCTGTGGAAGG - Exonic
1147554389 17:41467147-41467169 CTGGCTGGCCGGAAGGTGGTGGG + Exonic
1147657489 17:42098944-42098966 CTGTGTGGCAGGGAGGGAGATGG - Intergenic
1147761054 17:42797734-42797756 CTGCGTCCCTGGAAGGTGAAGGG + Exonic
1148345973 17:46903965-46903987 GTGTGTGGGTGGATGGTGGCTGG + Intergenic
1148747504 17:49926942-49926964 GTGGGTGGCTGGACTGTGGATGG + Intergenic
1148806897 17:50268503-50268525 CTGTGGGCCGGGAGGGTGGAGGG - Intergenic
1148874906 17:50681298-50681320 CTGAGAGGCAGGAAGGTTGAGGG - Intronic
1149324832 17:55519359-55519381 GTGTGTGGGTGGAATGTGGCGGG + Intergenic
1149596748 17:57868702-57868724 CTGTGTGGCGGGGAGGTGAGGGG + Intronic
1149931099 17:60756413-60756435 ATGTGTGGATGGAAGGGGGGTGG - Intronic
1150444368 17:65217175-65217197 CAGGGTGGCTGGGAAGTGGAAGG - Intronic
1150453255 17:65287134-65287156 GTGGGTGGCTGGAAGCTGCAGGG - Intergenic
1150806174 17:68320759-68320781 CTGGGTGGCTGGAAGGGCGGGGG + Intronic
1150934648 17:69622604-69622626 GTGTGTGGCAGGGTGGTGGAGGG + Intergenic
1150955921 17:69860252-69860274 CTGTTTGGGTGGAAGGTTAAAGG - Intergenic
1151334243 17:73430659-73430681 CTGTGTGGCTGGACTCTGGGTGG + Intronic
1152271596 17:79328177-79328199 CTGTGTGTCTGGAACGGAGATGG + Intronic
1152337343 17:79706338-79706360 CTGCTTGGACGGAAGGTGGATGG - Intergenic
1152504768 17:80741536-80741558 CCATGAGGCTGGAGGGTGGATGG + Intronic
1152848562 17:82617653-82617675 CTGTGTGTCTGGGAGAGGGAAGG + Intronic
1154057994 18:11030122-11030144 CTTTGTGGCTGGAATGAGGATGG - Intronic
1154307832 18:13243605-13243627 GTGGGTGGCTGGATGGTGGATGG - Intronic
1154314308 18:13292132-13292154 CTGTCTGGCTGTGGGGTGGATGG + Intronic
1155762775 18:29588371-29588393 CTGTGTGGCTCTCAGGTGGCAGG - Intergenic
1155929313 18:31689320-31689342 CTATGGGGGTGGAAGGTGGGAGG + Intergenic
1156477818 18:37417316-37417338 ATCTGTGGCTGGAAGAAGGAAGG - Intronic
1156550907 18:38015654-38015676 CTGTCTGGGGGTAAGGTGGAGGG - Intergenic
1156795875 18:41045582-41045604 CTGTGTGTCTGGAAGCAGAATGG - Intergenic
1156808111 18:41211848-41211870 AAGTGTGGCTGGAAGGAAGAAGG + Intergenic
1157407832 18:47438391-47438413 CTGTGTGGGTGAGTGGTGGAAGG - Intergenic
1157616471 18:48990492-48990514 CTGTGGGGCTGGATGGAGCAGGG - Intergenic
1157674123 18:49555853-49555875 CAGTGTGGCAGGAAGGCAGAGGG + Intergenic
1157914750 18:51654421-51654443 CAGTGCGGCAGGAAGGCGGAAGG - Intergenic
1157959310 18:52134541-52134563 CTGTGAGGCTAGAAGCAGGATGG + Intergenic
1158418693 18:57273425-57273447 CGGAGTTGCTGGAAGCTGGAGGG + Intergenic
1158959177 18:62574467-62574489 CTGTGTGGAAGGAAGGTTGATGG - Exonic
1160182234 18:76645801-76645823 CTGGGTGGCTGCCGGGTGGAGGG - Intergenic
1160246878 18:77166246-77166268 CTCTGTGGGAGGAAGGTGGGAGG - Intergenic
1160687608 19:443950-443972 GTGGGTGGATGGAGGGTGGATGG + Intronic
1160692340 19:465817-465839 GTGGGTGGGTGGATGGTGGATGG + Intronic
1161090544 19:2357883-2357905 GTGGGTGGGTGGAAGGTGGGTGG - Intergenic
1161347732 19:3776551-3776573 GTGAGTGGATGGTAGGTGGATGG + Intergenic
1161356657 19:3822955-3822977 CCGTCTGTCTGGAAGGTGGAAGG - Intronic
1161807977 19:6456093-6456115 CTGTGTGGGTGGAAGGTGGGAGG + Intronic
1161966681 19:7552852-7552874 CCGTGTGGCTGAAAGAGGGAGGG + Intronic
1162712924 19:12609666-12609688 CCGTGTTGCTGTAAAGTGGAAGG - Intronic
1162791622 19:13065975-13065997 CTGTGTGGCTGGAAGGCTTCTGG + Intronic
1163102747 19:15107808-15107830 CTGAGGGCCTGGAGGGTGGAGGG + Intronic
1163597790 19:18230552-18230574 CAGTGTGGCTTGAGGATGGAAGG - Intronic
1163598818 19:18235774-18235796 CAGTGTGGCTGGAGGGTGGGAGG - Intronic
1163608055 19:18286595-18286617 CTCTCTGGCTGGGAGGAGGAAGG - Intergenic
1163720133 19:18894870-18894892 CCGTCTGGCTGGAGGGTGCAGGG - Intronic
1163983370 19:20922614-20922636 CTGGGTGCCTGGAATGTGGCTGG + Intergenic
1163993242 19:21018969-21018991 CTGAGTGACTGGAATGTGGCTGG + Intergenic
1164100539 19:22051017-22051039 CTGAGTGCCTGGAATGTGGCTGG + Intergenic
1164123040 19:22285434-22285456 CTGAGTGCCTGGAATGTGGCTGG + Intergenic
1164177140 19:22785097-22785119 CTGAGTGCCTGGAATGTGGCTGG - Intergenic
1164272779 19:23687853-23687875 CTGGGTGCCTGGAATGTGGCTGG - Intergenic
1164518777 19:28960752-28960774 CTGTGAGGCTGGAAGCAAGATGG - Intergenic
1165144421 19:33722231-33722253 ATGGGTGGATGGAAGGTGGGAGG + Intronic
1165422894 19:35731270-35731292 CAGTGTGGCTGTAAGGGGGCCGG - Intronic
1165741354 19:38207027-38207049 CTGGTTAGCTGGAAGGTGGAGGG - Exonic
1166050106 19:40254059-40254081 CTGGGGGGCAGGGAGGTGGATGG + Intronic
1166091114 19:40509771-40509793 CTGTCTGGCTTGCAGGTTGATGG + Intronic
1166197724 19:41218020-41218042 CTGTGTGTTTGGCACGTGGAGGG - Intergenic
1166351962 19:42203470-42203492 CGGCGTGGCAGGAACGTGGAGGG + Intronic
1166367984 19:42286877-42286899 CTGGGTGGCTGGCAGGTTGCTGG - Exonic
1166658139 19:44627229-44627251 CCATGTGGTAGGAAGGTGGATGG + Intronic
1167902647 19:52633515-52633537 CAGTGAGGCTGGAAGGAGGGTGG + Intronic
1167925009 19:52814151-52814173 CAGGGAGGCTGGAAGGAGGATGG + Intronic
1167925231 19:52816082-52816104 CAGTGAGGCTGGAAGGAGGGTGG + Intronic
1167929565 19:52853248-52853270 CAGTGAGGCTGGAAGGAGGGTGG + Intronic
1167992647 19:53373531-53373553 CAGTGAGGCTGGAAGGAGGGTGG - Intronic
1168001318 19:53448439-53448461 CAGTGAGGCTGGAAGGAGGGTGG - Intronic
1168005704 19:53485002-53485024 CAGTGAGGCTGGAAGGAGGGTGG - Intronic
1168472330 19:56649734-56649756 CAGTGTGGCTGGAGGGTGGGAGG + Intronic
925929958 2:8698971-8698993 CTGTGCGGCTAGAATTTGGATGG - Intergenic
926204721 2:10828014-10828036 CTGTGTGTGTGGCAGGGGGAGGG - Intronic
926850871 2:17195363-17195385 CTATGAGGCTGAAAGGTGGCAGG - Intergenic
927152491 2:20203976-20203998 CTGTGGGGGTGGGAGGTGGCGGG + Exonic
927520827 2:23696994-23697016 GTGTGTGGCTGGAGGGAGGAAGG - Intronic
927930093 2:27038367-27038389 CTCTGTGGGTGGTAGGTGGAGGG + Intronic
928243390 2:29606016-29606038 CAGTGGGGGTGGGAGGTGGAAGG - Intronic
928337862 2:30413511-30413533 TTGTCTGTCTGGCAGGTGGATGG + Intergenic
928419824 2:31129706-31129728 CTCTATGGCTGGGAGGTGGGGGG + Intronic
929861850 2:45684865-45684887 CTGTGTGGCTGGCAGGGGGCTGG + Intronic
929949087 2:46392801-46392823 CTGAGTGGCTGCAAGGAGCAGGG + Intergenic
929956123 2:46460060-46460082 CTGTGGGCCTGGAAGGTGGAAGG - Intronic
930001173 2:46862466-46862488 CTGTCTGGCTTGGAGGTGGGGGG + Intergenic
930226333 2:48797942-48797964 CAGTGTGGCTGGAACTTCGAAGG + Intergenic
931226860 2:60339321-60339343 CAGTGTGGCTGGAATGGTGAGGG - Intergenic
931945617 2:67303374-67303396 CTGTGTGGCAGGCAGGTTAATGG + Intergenic
932006263 2:67930182-67930204 ATGTGTGGGTGAAGGGTGGATGG + Intergenic
932697372 2:73968234-73968256 CTGGGTGGCTGGAAGGATGATGG - Intergenic
935009362 2:99117821-99117843 CTGTGTGACTGGAATCAGGAAGG + Intronic
935782400 2:106519662-106519684 CTGTGTTACACGAAGGTGGACGG - Intergenic
937712875 2:124997807-124997829 CTGTGAGGGTGGAAGCAGGATGG + Intergenic
938967782 2:136403988-136404010 CAGTTTGGATGGAGGGTGGATGG - Intergenic
940165335 2:150764515-150764537 CAGTGTGGCTGGAAGAGGGGAGG - Intergenic
940284424 2:152019531-152019553 ATGAGTGGGTGGATGGTGGATGG + Intronic
941047328 2:160691194-160691216 CAGTGGGGGTGGGAGGTGGAGGG + Intergenic
941924878 2:170884765-170884787 GTGTGAGGCTGTAAGGGGGAAGG - Intergenic
941925679 2:170892051-170892073 CTGGGTGGAGGGAAGGAGGAGGG + Intergenic
942371869 2:175294144-175294166 CTGTGTGCCTGGAGGGGGCATGG - Intergenic
944942127 2:204640171-204640193 CTCTGTGTCTGGGAGGTTGAGGG + Intronic
945746314 2:213723239-213723261 CTGTGTGGATGGCATGTGGCTGG + Intronic
946182042 2:217954747-217954769 CTGGGAGGCTGGATGGTGGAAGG - Intronic
946187614 2:217989956-217989978 GTGTGTGGCTGGTGTGTGGATGG - Intronic
946187695 2:217990480-217990502 GTATGTGGCTGGCATGTGGATGG - Intronic
946320649 2:218952307-218952329 CTGTGATGGTGGAAGGTGGAGGG + Intergenic
946378225 2:219327170-219327192 CAGTGTGGCTGGGATGTGGCTGG + Intergenic
947543117 2:230991912-230991934 CTGTGTGACGTGAAGGTGAAGGG + Intergenic
947812719 2:233014688-233014710 ATGGGTGGATGGATGGTGGATGG - Intronic
948166670 2:235867866-235867888 CTGGGTGGGTGGTGGGTGGATGG - Intronic
948174466 2:235932212-235932234 CTGCCTGGCTGGCAGGTGGCGGG - Intronic
948301168 2:236908613-236908635 CTGTGTGGCTGGAGGGAAGGCGG - Intergenic
948964101 2:241362933-241362955 CTGTGGTTCTGGGAGGTGGAGGG + Intronic
949047677 2:241879540-241879562 CGGGCTGGCTGGTAGGTGGAGGG + Intergenic
949050627 2:241895659-241895681 CTGTGTGGGTGGATGGAGGGGGG + Intronic
949065812 2:241989834-241989856 GTGGGTGGATGGATGGTGGATGG - Intergenic
949065961 2:241990448-241990470 ATGGGTGGATGGATGGTGGATGG - Intergenic
1168862185 20:1053570-1053592 CTGTCTGGCTGGAGGGAGGAGGG - Intergenic
1168862523 20:1056062-1056084 CTGTGTGGCTGGAGGGTGACAGG - Intergenic
1168928279 20:1600414-1600436 ATATGTGGCTGGAAGGTTGGAGG + Intronic
1168949155 20:1784692-1784714 TTGTGGGGCTGGAAGGCTGAAGG + Intergenic
1168988117 20:2068322-2068344 CAGTGTGGCAGAAAGGTGTAGGG - Intergenic
1170371065 20:15648704-15648726 ATGGGTGGATGGATGGTGGATGG + Intronic
1170693742 20:18638583-18638605 CAGTGTGGCTGGAGCTTGGAGGG + Intronic
1172231689 20:33340963-33340985 CAGGGTGATTGGAAGGTGGAGGG - Intergenic
1172271779 20:33659256-33659278 CAGTGTGGACGGAAGCTGGAGGG - Intronic
1172534648 20:35664177-35664199 CTTCGTGGCCTGAAGGTGGAGGG - Intronic
1172806750 20:37617511-37617533 CTGAATGGCTGGAAGGATGAAGG + Intergenic
1172940428 20:38650170-38650192 CTGGAGGGCTGGAGGGTGGAGGG - Exonic
1173059518 20:39648121-39648143 ATGGGAAGCTGGAAGGTGGAGGG + Intergenic
1174087473 20:48019366-48019388 ATGTGTGGCTGGAGGGTGAAGGG + Intergenic
1174128814 20:48327604-48327626 ATGTGTGGCTGGAGGGTGAAGGG - Intergenic
1175472817 20:59244592-59244614 CAGTGTGGCTGGAAGTTGTCAGG - Intronic
1175667273 20:60871142-60871164 CTGGGTGGTTGCAGGGTGGAGGG - Intergenic
1175779238 20:61671835-61671857 ATGCATGGGTGGAAGGTGGATGG + Intronic
1176184219 20:63769318-63769340 CTCTGAGGGTGGAGGGTGGAGGG + Intronic
1178213738 21:30569208-30569230 ATGGGGAGCTGGAAGGTGGAGGG - Intergenic
1179032723 21:37734685-37734707 CTATTTTGCTGGAAGGTGGTGGG + Intronic
1179411543 21:41167383-41167405 CTGGGAGGGTGGAGGGTGGAAGG - Intergenic
1180002081 21:44999738-44999760 CTGTGTTGGTGGCAGGTGGCCGG + Intergenic
1180013978 21:45071137-45071159 CTGTGTGGCTGGAAAGGGAAAGG + Intergenic
1180182487 21:46124210-46124232 CTGGGTGGATGGATGATGGATGG + Intronic
1181010062 22:20035045-20035067 CTGTGGGGCTGGAAGTGGGTTGG - Intronic
1181462803 22:23095313-23095335 CTGAGTGGCTGGAGGGTTGGAGG - Exonic
1181618532 22:24071665-24071687 CTCTGTGGCTGGAAAGCGGCTGG - Intronic
1183029756 22:35094723-35094745 CTGAGCGGCTGGCTGGTGGAAGG - Intergenic
1183100012 22:35578237-35578259 CTGGCTGGATGGATGGTGGATGG + Intergenic
1183100052 22:35578396-35578418 CTGGATGGATGGATGGTGGATGG + Intergenic
1183471169 22:38007485-38007507 CTGGGAGCCTGGGAGGTGGAAGG + Intronic
1183524295 22:38314625-38314647 GGAGGTGGCTGGAAGGTGGATGG - Intronic
1183645629 22:39124372-39124394 CAGTGAAGCTGGGAGGTGGACGG + Intronic
1183744539 22:39685311-39685333 CTCTGGGGCTGGGAGGTGGGGGG + Intronic
1183866408 22:40707751-40707773 CTGTGAGGCTGGAGGCTAGATGG + Intergenic
1184123708 22:42471705-42471727 ATGGGTGGGTGGATGGTGGATGG - Intergenic
1184156580 22:42671464-42671486 CCGTGAGGCTGGAAGCAGGATGG + Intergenic
1184852832 22:47130480-47130502 CTCTCTGGATGGAGGGTGGAGGG + Intronic
1185053533 22:48566168-48566190 ATGGGTGGATGGATGGTGGATGG + Intronic
1185056358 22:48580657-48580679 CGGTGTGTGTGGAAGGAGGAGGG + Intronic
1185193399 22:49452920-49452942 ATGTGTGGATGGGTGGTGGATGG + Intronic
1185193489 22:49453397-49453419 ATGTGTGGATGGGTGGTGGATGG + Intronic
1185196831 22:49476927-49476949 GTGGGTGGATGGATGGTGGATGG + Intronic
1185376400 22:50484453-50484475 CTGAGAGGCTGCAGGGTGGAGGG + Exonic
950110356 3:10414724-10414746 CGATGTGGCTGGAAGGGTGAGGG + Intronic
950224699 3:11224214-11224236 CTGTTTGGCTGGAAGATCCATGG - Intronic
950554430 3:13686580-13686602 TTGTGTGTCTGGTAGGGGGAGGG + Intergenic
950583668 3:13878916-13878938 CGCTCTGGCTGGAAGGTGGGAGG - Intronic
950891108 3:16405170-16405192 CTGTGTGGCTGGCAGGTCCGTGG - Intronic
951219640 3:20055610-20055632 CTGTGTGGCTAGATGGAGGTGGG + Intronic
951954412 3:28239257-28239279 CTGTGTGGCAGGCATGTGGTGGG - Intergenic
952132950 3:30385298-30385320 CAGTGTGGAGGGAAGGGGGAAGG + Intergenic
952387971 3:32856544-32856566 CTCTGTTGGTGGAAGGTGAAAGG + Intronic
952436047 3:33273551-33273573 CTTTGTTGCTGGAGGCTGGAGGG - Intergenic
953203356 3:40797843-40797865 CTGAGTAGCAGGAGGGTGGATGG + Intergenic
953234803 3:41096799-41096821 CTGTGGAGCAGTAAGGTGGAGGG - Intergenic
955047470 3:55373622-55373644 GTTTGTGGGTGGAAGGTGGGAGG + Intergenic
955333734 3:58068409-58068431 CTGTGTGGATGGAAGGGATATGG + Intronic
957073142 3:75581087-75581109 CTGTGGGGCTGGAGCGTGGTGGG + Intergenic
957148257 3:76452318-76452340 TTGTGTGGGGGGAAGGGGGAGGG - Intronic
959068448 3:101680605-101680627 CTGGGAGTGTGGAAGGTGGAAGG - Intergenic
959467237 3:106702880-106702902 CTGTGTTGCTGACAGGTTGAAGG + Intergenic
959726468 3:109548369-109548391 CTGTATGGTTGGCAGGTGCAGGG + Intergenic
959821781 3:110743724-110743746 CTGACTGGCTGGAAGAAGGATGG - Intergenic
960394800 3:117123424-117123446 ATGTGTGGCTGAAATGGGGAAGG - Intronic
961381783 3:126500240-126500262 CAGTGGGGCTGGAAGTTGGTGGG - Intronic
961873454 3:130003892-130003914 CTGTGGGGCTGGAGCGTGGTGGG + Intergenic
962101944 3:132351885-132351907 CAGAGTGGCTGGAAGGTATAGGG - Intronic
962814748 3:138987929-138987951 CTGTGAGGCTGGCAGGTGCCAGG - Intergenic
963081670 3:141400926-141400948 CCCTGTGACTGGAAGGTGGGAGG - Intronic
965367045 3:167813883-167813905 CTGTGTGGCTGCAGTGGGGAGGG - Intronic
966355517 3:179074465-179074487 GTGTGTGGCTGGTGGGTGGGTGG - Intergenic
967042408 3:185705753-185705775 CTGTGTCTCTGGATGGAGGAAGG + Intronic
967465943 3:189806251-189806273 CTGTGTAGCTAGAAGCAGGAGGG + Intronic
967949747 3:194831701-194831723 CAGTGTGTCTAGAGGGTGGAAGG + Intergenic
968384287 4:122670-122692 CTGGGTACCTGGAATGTGGATGG + Intergenic
968619997 4:1599754-1599776 GCGTGTGGCTGGCAGGTGGCGGG - Intergenic
968763726 4:2457436-2457458 CTCTGTGGCAGGAAGGAGGAGGG + Intronic
968978517 4:3834427-3834449 CTGTGTGGGTGGATGGAGGGTGG - Intergenic
969016749 4:4108381-4108403 CTGTGGGGCTGGAGCGTGGAGGG + Intergenic
969059990 4:4426710-4426732 CGGTGAGGGTGGAATGTGGACGG - Intronic
969131598 4:4994672-4994694 CTGTGTGGCTGCATTGTGGTGGG + Intergenic
969501625 4:7556873-7556895 GTGGGTGGGTGGATGGTGGATGG - Intronic
969737218 4:8999934-8999956 CTGTGGGGCTGGAGCATGGAGGG - Intergenic
972361474 4:38329436-38329458 GTCTGAGGCTGGAAGGTGTACGG - Intergenic
973716120 4:53678194-53678216 CTTTCTGACTGGAATGTGGATGG + Intronic
973955520 4:56059502-56059524 CTGGCTGGGTGGAATGTGGATGG - Intergenic
975581630 4:75912004-75912026 CTGTGAGGCTAGAAGGAAGATGG + Intergenic
975842219 4:78487134-78487156 CTGTGCTGCTAAAAGGTGGATGG - Intronic
976470568 4:85423978-85424000 CTGTGTGTGTGGAAGGGGGGCGG + Intergenic
977308416 4:95354359-95354381 CTGTGTTTTTGGAATGTGGAGGG - Intronic
977491383 4:97716693-97716715 CTGTGGGGGTGGGGGGTGGAAGG + Intronic
977647679 4:99432310-99432332 ATTTGAGGGTGGAAGGTGGAGGG + Intronic
977685073 4:99838087-99838109 CTACGTGGCTGGCAGGGGGATGG + Intronic
979537608 4:121841311-121841333 TTGGGAGGCTGGAAGGTGGAAGG + Intronic
979669102 4:123343574-123343596 CTGTGTGCTTGGAAGGAGGTGGG - Intergenic
980895143 4:138854182-138854204 CTGGGTGGCTGCCGGGTGGAGGG - Intergenic
982022905 4:151222170-151222192 CTCTGTGGGTGGAACTTGGAGGG - Intronic
982545816 4:156731770-156731792 CACTGTGGCTGGAAGGGAGAAGG - Intergenic
983957038 4:173710080-173710102 CTGTGTGCCTGGAATGAGCAAGG + Intergenic
985293181 4:188407019-188407041 ATGGGGAGCTGGAAGGTGGATGG - Intergenic
985668805 5:1195966-1195988 CTGCGTGCCTGGGAGGTGGGAGG - Intergenic
985668848 5:1196146-1196168 CTGCGTGCCTGGGAGGTGGGAGG - Intergenic
985705596 5:1399877-1399899 CTGCGTGCCTGGGAGGTGGGTGG - Intronic
985771142 5:1812150-1812172 TGGTGAGGGTGGAAGGTGGAAGG + Intronic
986190406 5:5491652-5491674 CGATGTGGCTGGAAGCTGCAAGG + Intergenic
986230964 5:5864561-5864583 ATGGGGAGCTGGAAGGTGGAGGG + Intergenic
986443527 5:7801277-7801299 CTGTGTGTCTGGCAGGGCGAGGG - Intronic
986602069 5:9482460-9482482 CTGGGTGAGTGGAAGGTGGGAGG + Intronic
986672467 5:10154902-10154924 CATTGTGGGTGGGAGGTGGAGGG - Intergenic
988627082 5:32888782-32888804 CTGTGTGTCTGGAAGGAGAAAGG + Intergenic
989667654 5:43874683-43874705 GTTTGTGGCTGGAAGATGCAGGG + Intergenic
990468960 5:56095734-56095756 CTGTGAGATTGGAAGGTGGGAGG - Intergenic
990498597 5:56372727-56372749 CTGGGTGGCTGCCGGGTGGAGGG - Intergenic
990672721 5:58150668-58150690 GTGTGTGGCTAGAAGCTGAATGG - Intergenic
992080188 5:73229395-73229417 CTGTTTGGCTGGAATTTGAAGGG + Intergenic
992441485 5:76801274-76801296 CTGTGTGGCTGGAGAGAGCATGG + Intergenic
993505915 5:88708347-88708369 CTGTGAGGTTGGGAGGTGCAGGG + Intergenic
994010303 5:94894614-94894636 ATGTGTCTCTGGAAGGAGGAGGG + Intronic
994106229 5:95952300-95952322 CTTTGAGGGTGGAGGGTGGAAGG + Intronic
995060109 5:107804380-107804402 CTGTGGGGCTGTGAGTTGGAAGG - Intergenic
995246899 5:109945095-109945117 CGGTGTTGCTGGAAGGCTGAGGG + Intergenic
995833293 5:116376897-116376919 CTGTGTGGGTGGGGTGTGGATGG + Intronic
996519387 5:124410004-124410026 CTGTGGGGCTGGAATATGGGAGG - Intergenic
996811214 5:127517866-127517888 CGGTGTCCCTGGAAGGTGGGCGG + Intronic
997196026 5:131980638-131980660 CTGTGGGGCTGGGAGGCTGAGGG - Intronic
997329780 5:133051833-133051855 CTGGGTGGCTGAAAGATGGCTGG - Intergenic
997358702 5:133280769-133280791 CAGCGTGGCTGGAATGTGGAGGG - Intronic
998163718 5:139828423-139828445 CATTGGGGCTGGATGGTGGAGGG + Intronic
998387785 5:141767915-141767937 CCGGGTGGCTCGAGGGTGGACGG + Intergenic
999822037 5:155237976-155237998 CTGTGTGGGAGGAAGTTGAAGGG + Intergenic
999849598 5:155523915-155523937 CTGTGTGCTTGGGAGGGGGATGG - Intergenic
999869352 5:155732860-155732882 CTATTTGGCTGGAAGCAGGAGGG - Intergenic
1000332852 5:160219526-160219548 ATGGGTGGATGGAAGGTGGAGGG + Intronic
1000926663 5:167202646-167202668 CTGTGTGACTGGGAGGATGATGG - Intergenic
1002105702 5:176878577-176878599 CTGTGGGTGTGGCAGGTGGAGGG + Exonic
1002955851 6:1863152-1863174 CTGTGTGGCTGTAAGGGGCTAGG + Intronic
1003273687 6:4629706-4629728 CTGGGTGGCTTGTAGGAGGAAGG + Intergenic
1003672743 6:8174563-8174585 CTGTGTGGCTGGACAGAGGACGG + Intergenic
1003972588 6:11313354-11313376 CTGAGTAGATGGATGGTGGATGG + Intronic
1004879612 6:19994898-19994920 CTGTGTGGTTGCAGGGTGGGAGG - Intergenic
1006379916 6:33691480-33691502 CACTGTGGCTGGACAGTGGAGGG + Intronic
1006398307 6:33801399-33801421 GTGTGTGGCAGGGAGCTGGATGG - Intronic
1006599457 6:35215830-35215852 GTGTGGGGCTGGAAGGTGTGGGG - Intronic
1006946147 6:37785607-37785629 CTGTGTGGGAGGAAGATGGATGG - Intergenic
1007162868 6:39806421-39806443 CTATGTGCCTTGAAGGTGAAGGG + Intronic
1007369401 6:41416519-41416541 GTGTGTGTCTGGTGGGTGGAGGG - Intergenic
1007769258 6:44180090-44180112 CTGTGTGGCTCAAAGGTGGAGGG - Exonic
1008258150 6:49330260-49330282 GAGTGTGTTTGGAAGGTGGACGG - Intergenic
1011335474 6:86254865-86254887 CTGTGTGGCTGGAGAGGAGATGG + Intergenic
1011371428 6:86640986-86641008 ATGTGTGCTGGGAAGGTGGAGGG + Intergenic
1012247043 6:96937717-96937739 CTGTGAGGATGGAGGGTAGAGGG - Intronic
1012603668 6:101130889-101130911 CTGGGTGGCAAGAAGGGGGAAGG + Intergenic
1013317603 6:108957261-108957283 CTGTGTAAGGGGAAGGTGGAGGG - Intronic
1013680709 6:112522411-112522433 CTGTGAGGCTAGAAGGAAGATGG - Intergenic
1016967139 6:149729414-149729436 GTGGGTGACTGGAAGGCGGAAGG + Intronic
1017967269 6:159277209-159277231 CTGTGTGGCTGGGAGAAGGGAGG + Intergenic
1017997594 6:159546339-159546361 CTACATGGCTGGAAGGTGGAAGG - Intergenic
1018043105 6:159942401-159942423 CTGTGTGGCAGGAAGGTCACTGG + Intergenic
1018743497 6:166747583-166747605 CTGTGTGGTGGAAAGGGGGAAGG - Intronic
1018744209 6:166749876-166749898 CTGTGTGGTGGAAAGGGGGAAGG - Intronic
1018833253 6:167462561-167462583 CTGTGTGCTGGGAAGGTGGGAGG + Intergenic
1019486035 7:1289576-1289598 CTGTGGGTTTGGAGGGTGGAAGG - Intergenic
1019683538 7:2366837-2366859 CTGGGTGGCGGGTGGGTGGATGG + Intronic
1019704687 7:2491876-2491898 ATGTGTGGGTGGATGATGGATGG - Intergenic
1019704694 7:2491915-2491937 ATGTGTGGGTGGATGATGGATGG - Intergenic
1019921894 7:4168460-4168482 CTCTGGGGCTGGAAGATGGAGGG - Intronic
1021303110 7:18996831-18996853 GTGTGTGGCTGGGAGGTGGGGGG - Intronic
1021535691 7:21701907-21701929 CTGTGTGGGTTGTAGCTGGACGG + Intronic
1021962512 7:25887011-25887033 GTGGGTGGCAGGCAGGTGGAGGG + Intergenic
1022959232 7:35410426-35410448 CTGTGTCGCAGGAGGATGGATGG - Intergenic
1023045673 7:36208191-36208213 CTGTGTGACTGGATGGGGGTGGG + Intronic
1023861455 7:44219793-44219815 CTGGGTGGGTTGCAGGTGGATGG - Intronic
1024089657 7:45924730-45924752 CTGTGTGCCTGGAGGGACGAGGG + Intergenic
1024272862 7:47655597-47655619 CTGCCAGGCTGGAAGGAGGAGGG + Intronic
1024356524 7:48418980-48419002 TTCTGGGGATGGAAGGTGGAAGG + Intronic
1026128639 7:67602067-67602089 CTGTGTGGCTAGATTATGGAGGG - Intergenic
1026157783 7:67842270-67842292 ATGTGAGGGTGGAAGGTAGAGGG + Intergenic
1026203538 7:68235740-68235762 ATGAATGGATGGAAGGTGGATGG + Intergenic
1026743604 7:72994360-72994382 CTGAGTGGCTGGAAGGCGAAGGG + Intergenic
1026783686 7:73285827-73285849 CTGAGTGGCTGGAAGGCCAAGGG + Intergenic
1026803516 7:73415025-73415047 CTGAGTGGCTGGAAGGCCAAGGG + Intergenic
1026856324 7:73757572-73757594 CTTGGTGGCTGGGATGTGGAAGG + Intergenic
1027029711 7:74879059-74879081 CTGAGTGGCTGGAAGGCCAAGGG + Intergenic
1027100132 7:75370717-75370739 CTGAGTGGCTGGAAGGCCAAGGG - Intergenic
1027233438 7:76284662-76284684 CTGAGTGGGTGCCAGGTGGAAGG - Intronic
1028187335 7:87802284-87802306 CTGGGAGGCTGAGAGGTGGAAGG + Intronic
1028399625 7:90410703-90410725 TTGTGGGGGTGGAAGGAGGAGGG + Intronic
1029604820 7:101592212-101592234 ATGAGTGGATGGATGGTGGATGG - Intergenic
1030064433 7:105648600-105648622 CTGTGTGTATGGGAGGTGGGGGG - Intronic
1030288312 7:107848305-107848327 CGGGGTGGCTGCCAGGTGGAGGG - Intergenic
1030725706 7:112922748-112922770 CAGGGTGGCTGCCAGGTGGAGGG - Intronic
1032068821 7:128791605-128791627 CTGGGGGTCTGGAAGGAGGAGGG - Intronic
1032343574 7:131098866-131098888 CTGTGGGGCTGGAATCTGGTAGG - Intergenic
1032517941 7:132520799-132520821 CTGTGGGGCCAGAAGGTGGGTGG - Intronic
1032991159 7:137396233-137396255 CTGTGTGAGTGGCAGGTGGAAGG + Intronic
1033125894 7:138706770-138706792 GTTAGAGGCTGGAAGGTGGAGGG + Intronic
1033299360 7:140173390-140173412 CTGTCAGGCTGCAGGGTGGATGG - Intronic
1033410459 7:141113150-141113172 CTGTGTGGCTGATTGGTGGTGGG + Intronic
1033595926 7:142857552-142857574 CTGTGTGGCTCACAGGTGTAAGG + Intronic
1034067766 7:148153124-148153146 CTGTGAGGCTAGAAGCAGGACGG + Intronic
1034094458 7:148394196-148394218 TTATTTGGGTGGAAGGTGGAAGG + Intronic
1034313631 7:150110892-150110914 CTGCGAGGCTGGCAGGTGGCAGG + Intergenic
1034333368 7:150303255-150303277 CTGTGTTCCAGGAAGGAGGAGGG - Intronic
1034543984 7:151777665-151777687 CTGTGAGGCTGGATGCAGGATGG - Intronic
1034664675 7:152806632-152806654 CTGTGTTCCAGGAAGGAGGAGGG + Intronic
1034793267 7:153989904-153989926 CTGCGAGGCTGGCAGGTGGCAGG - Intronic
1035626145 8:1072113-1072135 CTGTGTGCCTTGACGGTGGTTGG - Intergenic
1035636047 8:1145180-1145202 CTGTGTTTCTGGATGGTGGCTGG - Intergenic
1035683397 8:1506062-1506084 CTATGTGCCTGCCAGGTGGAAGG - Intronic
1035727821 8:1835393-1835415 CTGTGTGGCTGGGAAGTGCTGGG + Intronic
1035836906 8:2764567-2764589 CTCTGTGGCAGCAAGGTGGAAGG + Intergenic
1036229003 8:6983730-6983752 CTGAGGAGCTGGGAGGTGGAGGG - Intergenic
1036231456 8:7002835-7002857 CTGAGGAGCTGGGAGGTGGAGGG - Intronic
1036233913 8:7021929-7021951 CTGAGGAGCTGGGAGGTGGAGGG - Intergenic
1036242306 8:7091197-7091219 CTGTGGGGCTGGAGCGTGGTGGG - Intergenic
1036259543 8:7228959-7228981 CTGTGGGGCTGGAGCGTGGTGGG + Intergenic
1036307080 8:7610565-7610587 CTGTGGGGCTGGAGCGTGGTGGG - Intergenic
1036311587 8:7687529-7687551 CTGTGGGGCTGGAGCGTGGTGGG + Intergenic
1036357926 8:8058552-8058574 CTGTGGGGCTGGAGCGTGGTGGG - Intergenic
1036663968 8:10726767-10726789 CTCTGTGGCTGGGAGGGGGAAGG - Intronic
1036830433 8:12015933-12015955 CTGTGGGGCTGGAGCGTGGTGGG + Intergenic
1036891965 8:12602258-12602280 CTGTGGGGCTGGAGCGTGGTGGG + Intergenic
1036893021 8:12608394-12608416 CTGTGGGGCTGGAGCGTGGTGGG + Intergenic
1037701167 8:21274950-21274972 TTTTGTGGCAGGGAGGTGGATGG - Intergenic
1037973509 8:23192152-23192174 CTCTGTGGATGGGAGGTGGGTGG - Intronic
1038005605 8:23427362-23427384 CTGTGTGACTGGAAGGGGAAAGG - Intronic
1038700042 8:29841367-29841389 CTGTGTGGCTGGCAGGAGAGAGG - Intergenic
1042404399 8:68387121-68387143 ATGTGTGGGAGGAAGGTGAAAGG + Intronic
1042948095 8:74174875-74174897 CTGTGAGGCTAGAAGCAGGATGG + Intergenic
1044573326 8:93743320-93743342 CTGTGTGAATAGAAGGAGGATGG - Intergenic
1045192952 8:99901144-99901166 CTGTGTGTCTGAAAGGAGAATGG - Intergenic
1045724839 8:105160077-105160099 CTCTGTGTCTGGAAGGTGGTAGG + Intronic
1046194868 8:110848772-110848794 CGGTGTGGCTGGAAGCTACATGG + Intergenic
1047372170 8:124265179-124265201 GTAAGTGCCTGGAAGGTGGAAGG - Intergenic
1047734760 8:127755454-127755476 CTCTGTGGCTAGAAGAGGGAAGG - Intergenic
1048233189 8:132663869-132663891 CTGTTTGTCAGGGAGGTGGATGG + Intronic
1048440903 8:134458380-134458402 CTGGGAGGCTGGAGGGAGGAGGG + Intergenic
1048512416 8:135074861-135074883 CAGTGTGCTTGGAAGGTGGGAGG + Intergenic
1048853199 8:138663857-138663879 CAGTGTGGCTTCAAGGTGGGAGG - Intronic
1048992291 8:139767541-139767563 ATGTGGGGGTGGAAGGGGGAGGG + Intronic
1049204117 8:141355447-141355469 CTGTGTGGCTGGGAGCAGGAGGG - Intergenic
1049372011 8:142272445-142272467 ATGGGTGGATGGAAGGAGGAAGG - Intronic
1049372043 8:142272581-142272603 GTGGGTGGATGGAAGGAGGAAGG - Intronic
1049405153 8:142449102-142449124 GTGGGTGGATGGACGGTGGACGG - Intergenic
1049405174 8:142449197-142449219 CTGGCTGGCTGGATGATGGATGG - Intergenic
1049532641 8:143162137-143162159 CTGTGTGGGTGCCAAGTGGAGGG - Intergenic
1049588336 8:143442047-143442069 CTGTGTGGCTGGGAGGATGTGGG - Intronic
1049680514 8:143915924-143915946 CTGTGTGAGTGGCAGGTAGAAGG + Exonic
1049707132 8:144048184-144048206 CTGGCTGGCAGGGAGGTGGAGGG - Intergenic
1051331889 9:16032137-16032159 CTGTGAGGGAGGAAGGTGGCAGG + Intronic
1051405018 9:16727630-16727652 CTGTGTTACTGGAATGTGCAGGG - Intronic
1051580621 9:18669913-18669935 CTGAGAGGCTGGGAGTTGGAAGG - Intronic
1052376135 9:27719551-27719573 CTGTGTGGAAGGAAGGTGATTGG + Intergenic
1052492653 9:29188838-29188860 CTGTCTGGGAGGAAGGTGGCGGG - Intergenic
1053391363 9:37738925-37738947 ATGGGTGGCTGGAACGTGGCAGG + Intronic
1053477001 9:38389634-38389656 CTGTGTGGATTGAAGGGGAAAGG - Intergenic
1054454364 9:65421975-65421997 ATGAGTGGATGGAAGATGGATGG + Intergenic
1055360144 9:75480994-75481016 CTGTCTGGCTGCAATATGGAGGG + Intergenic
1055506643 9:76955527-76955549 CGGTGTGGCTGCCAGGCGGAGGG - Intergenic
1056316282 9:85393677-85393699 ATTTGTGGCTGTAAGGTGGGTGG - Intergenic
1056561500 9:87733866-87733888 CTGTGTGACTGAGAGGTGCATGG - Intergenic
1057279273 9:93698514-93698536 CTGTGTGGCTGCATGGAGGCGGG - Intergenic
1057400823 9:94721458-94721480 CTGTGAGGCTGGAAGCAAGATGG + Intergenic
1057526526 9:95808007-95808029 CTGTTGGGCTGGGAGCTGGAGGG - Intergenic
1058811509 9:108644110-108644132 TTGTATGGCTGGTAGGTGGTAGG - Intergenic
1060110393 9:120902582-120902604 CTGTGTGGCAGGATGGGGGAGGG - Exonic
1060571274 9:124642698-124642720 CTGTGGGGCAGGGTGGTGGAGGG + Intronic
1060668513 9:125447957-125447979 ATGTGTGGCAGGCAGGTGGGAGG + Intronic
1061783075 9:133007193-133007215 TTGGGTGGATGGATGGTGGATGG + Intergenic
1061905536 9:133694783-133694805 CTTTGTGGATGGAGGATGGATGG + Intronic
1061980952 9:134103380-134103402 CTGGATGGATGGATGGTGGATGG - Intergenic
1062036606 9:134385321-134385343 TTGTGTGGCTGGAGGGAGGCTGG + Intronic
1062081357 9:134625465-134625487 CTGTGAGGCTGGAAGCTTGCGGG - Intergenic
1062092448 9:134685526-134685548 CTGGATGGATGGATGGTGGATGG - Intronic
1062196362 9:135276398-135276420 CTGTGTGGCAGGAGGTTGGAGGG - Intergenic
1062247722 9:135578049-135578071 GTGGGTGGATGGATGGTGGATGG - Intergenic
1062247791 9:135578395-135578417 GTGGGTGGATGGATGGTGGATGG - Intergenic
1062247860 9:135578741-135578763 GTGGGTGGATGGATGGTGGATGG - Intergenic
1062637384 9:137498681-137498703 CTGGGTGGGTGGAGGGTGGCTGG + Intronic
1062699544 9:137891738-137891760 CTGTGGGGCTGTAGAGTGGAGGG + Intronic
1186230617 X:7449829-7449851 GGGTATGCCTGGAAGGTGGAGGG - Intergenic
1187223396 X:17352783-17352805 TTGTGCGGGTGGAGGGTGGAGGG - Intergenic
1187413273 X:19069757-19069779 ATGGGTGGCTGGAAAGGGGATGG - Intronic
1188148936 X:26648945-26648967 CTGTGTGGCAGAAAAGTGGTTGG + Intergenic
1188996044 X:36887375-36887397 CTGTGTGACTGGAAAAGGGAGGG + Intergenic
1189235093 X:39480852-39480874 GGGTGCGGCTGGGAGGTGGAGGG + Intergenic
1189260488 X:39675229-39675251 GTGTGTGGCTACATGGTGGATGG - Intergenic
1189853100 X:45196282-45196304 ATGGGTGGATGGATGGTGGATGG + Intronic
1190119754 X:47650395-47650417 CTCTGGGCCTGGAGGGTGGAGGG - Intronic
1192220602 X:69195145-69195167 ATGTGGGACTGGAAGGTGGAGGG + Intergenic
1192233460 X:69281434-69281456 GTGTGTGGTGGGAAGGTGAAAGG - Intergenic
1192352871 X:70371767-70371789 CGGGGTGGCTGCCAGGTGGAGGG + Intronic
1193300987 X:79887905-79887927 GAGTGAGGCTGGGAGGTGGATGG + Intergenic
1193308699 X:79979743-79979765 ATGGGAGGGTGGAAGGTGGAAGG - Intergenic
1194119463 X:89942998-89943020 ATGGGGAGCTGGAAGGTGGAGGG - Intergenic
1195438668 X:104875733-104875755 CTGTATGTGTGTAAGGTGGATGG - Intronic
1196683613 X:118493313-118493335 CAGTGTGGCTGGAGCGTAGAAGG - Intergenic
1197225175 X:123949786-123949808 CTGTGTGGCTGGCTGGCAGAAGG + Intergenic
1197960375 X:131998670-131998692 CAGTGTGGTTGCAAGGTGCAGGG - Intergenic
1198580131 X:138054650-138054672 ACTTGTGGGTGGAAGGTGGAAGG + Intergenic
1199860750 X:151798734-151798756 CTGTGTGTCTGGAATTAGGAGGG + Intergenic
1200212984 X:154355135-154355157 CTGTGTGGGCGGCAGGCGGACGG - Intronic
1200472336 Y:3600555-3600577 ATGGGGAGCTGGAAGGTGGAGGG - Intergenic
1200774802 Y:7160643-7160665 TTGGGAGGCTGGAAGGTGGGAGG - Intergenic
1201310963 Y:12597877-12597899 CAGGGTGGCTGGAAAGAGGAGGG + Intergenic
1201370658 Y:13259523-13259545 CAATGTGGCTGGAAAGTAGATGG - Intronic