ID: 1077328129

View in Genome Browser
Species Human (GRCh38)
Location 11:1972415-1972437
Sequence GCGGTGCCCGGCACGAGGTG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 130
Summary {0: 2, 1: 0, 2: 0, 3: 13, 4: 115}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1077328129_1077328140 13 Left 1077328129 11:1972415-1972437 CCCCACCTCGTGCCGGGCACCGC 0: 2
1: 0
2: 0
3: 13
4: 115
Right 1077328140 11:1972451-1972473 TGCACACTGCGCCACAGTGCTGG 0: 2
1: 0
2: 0
3: 12
4: 117
1077328129_1077328141 17 Left 1077328129 11:1972415-1972437 CCCCACCTCGTGCCGGGCACCGC 0: 2
1: 0
2: 0
3: 13
4: 115
Right 1077328141 11:1972455-1972477 CACTGCGCCACAGTGCTGGCCGG 0: 2
1: 0
2: 0
3: 14
4: 134

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1077328129 Original CRISPR GCGGTGCCCGGCACGAGGTG GGG (reversed) Intronic
900948412 1:5844133-5844155 GGGCTGCCAGGCAGGAGGTGAGG - Intergenic
901166145 1:7222927-7222949 GAGGTGCCCGGCACCCTGTGTGG + Intronic
901880283 1:12189834-12189856 GCAGAGCCCTGCAGGAGGTGAGG + Intronic
902644867 1:17791086-17791108 GCTGTGCCTGGCAGGGGGTGGGG + Intronic
903176293 1:21583502-21583524 GCGATGCCCAGCACGTAGTGAGG + Intergenic
904813783 1:33180973-33180995 GCGGGGCCGGGCTGGAGGTGGGG - Intronic
906297639 1:44658922-44658944 CAGGTACCCGGCAAGAGGTGGGG - Intronic
906715073 1:47962579-47962601 GCAGTGCCTGGCACGTGGTAAGG - Intronic
912429034 1:109619587-109619609 ACAGTGCCTGGCACGAAGTGAGG - Intronic
914953333 1:152138785-152138807 CCGGGGCCCGTCATGAGGTGGGG - Intergenic
919776487 1:201197450-201197472 CCGGGGCCCAGCACAAGGTGGGG - Intronic
923506494 1:234609888-234609910 GCGGCGGCCGGCACGGAGTGCGG + Intergenic
1063458628 10:6202212-6202234 GCGGTGCTGGGTACGAGGAGGGG - Intronic
1069919175 10:71806004-71806026 GCGGGGCCCGGTGCGAGGGGCGG + Intronic
1070949320 10:80418459-80418481 GGGGTGCACTGCATGAGGTGGGG - Intronic
1073284502 10:102379539-102379561 GCGATGCCCGGCGCCAGGTACGG + Exonic
1074140372 10:110667157-110667179 ACAGTGCCTGGCAAGAGGTGAGG + Intronic
1074866407 10:117546630-117546652 GCGGAGCCCGGCACAAGGCGCGG + Intronic
1074974533 10:118569427-118569449 CCGGTGCCTGGCACGATGTCTGG - Intergenic
1076601940 10:131663020-131663042 GAGGTGCCCGGCACGGGGCCTGG + Intergenic
1076706119 10:132302505-132302527 GGGGTGCCCGGCAGGAGGCCAGG + Intronic
1077069245 11:660466-660488 CAGGTGCCCGGGACGGGGTGAGG - Intronic
1077146943 11:1050637-1050659 GCGGGGACAGGCCCGAGGTGCGG + Intergenic
1077191516 11:1257729-1257751 GAGGTGCCCGGCATAGGGTGAGG + Intronic
1077328129 11:1972415-1972437 GCGGTGCCCGGCACGAGGTGGGG - Intronic
1083186806 11:61022426-61022448 GCTGGGGCGGGCACGAGGTGGGG - Intergenic
1089215633 11:116833002-116833024 GGGGGGCCAGGCATGAGGTGGGG - Exonic
1089677365 11:120098819-120098841 CTGGTGCCCGGCATGGGGTGGGG - Intergenic
1202811108 11_KI270721v1_random:27595-27617 GCGGTGCCCGGCACGAGGTGGGG - Intergenic
1091591200 12:1843843-1843865 GCTGTGCCAGGCAGGTGGTGGGG - Intronic
1102220603 12:111191830-111191852 GAGGTGCCCCGAAGGAGGTGGGG - Intronic
1105472252 13:20704313-20704335 GCGGGGCCCGGCAGGTGGGGAGG + Intronic
1117805375 14:59484722-59484744 GCGGAGCCCGGCCCGAGGGCGGG - Exonic
1121118518 14:91360616-91360638 GCTCTGCCCAGCCCGAGGTGGGG + Intronic
1122231049 14:100306467-100306489 GGGGCGCGCGGCCCGAGGTGAGG - Exonic
1122406124 14:101502120-101502142 GAGGTGCCCGAGACGAGGTGAGG + Intergenic
1128612161 15:69083033-69083055 GAGGTGCAAGGCAGGAGGTGGGG - Intergenic
1129705255 15:77790673-77790695 GGGGGGCCCAGCACGTGGTGGGG - Intronic
1129854163 15:78811923-78811945 GCGGTTGCCCGCGCGAGGTGGGG + Intronic
1131336095 15:91550612-91550634 GCGGTGCCTGGCCCCAGGGGAGG + Intergenic
1131371267 15:91883829-91883851 ACGGTGCCTGGCACGGGGTGTGG - Intronic
1133212687 16:4272173-4272195 GCGGCTCCCGGCGCGGGGTGGGG - Intronic
1133784467 16:8963682-8963704 GCCGCGCCCGGCCCGAGGCGGGG - Intronic
1135436078 16:22427615-22427637 GCTGTGCCCCGCAGCAGGTGAGG - Intronic
1136685836 16:31994532-31994554 GTGCTGCCAGGCACGAGGTGGGG + Intergenic
1136786449 16:32938065-32938087 GTGCTGCCAGGCACGAGGTGGGG + Intergenic
1136883323 16:33915730-33915752 GTGCTGCCAGGCACGAGGTGGGG - Intergenic
1138319695 16:56101612-56101634 CTGGTGCCCAGCAGGAGGTGTGG - Intergenic
1139671034 16:68492670-68492692 GCTGTGCCTGGCACAGGGTGGGG + Intergenic
1139893395 16:70269032-70269054 ACCGTGCCCGGCCAGAGGTGGGG - Intronic
1141570217 16:84929579-84929601 GTGGTGCCTGGCACGGGGAGGGG + Intergenic
1142045286 16:87921427-87921449 GCTGTGCCCCGCAGCAGGTGAGG - Intronic
1203088683 16_KI270728v1_random:1199731-1199753 GTGCTGCCAGGCACGAGGTGGGG + Intergenic
1142607909 17:1092064-1092086 GCTGTGCCAGGCCCGAGGGGTGG + Intronic
1143584044 17:7842634-7842656 GGGCTGCCCGGCACGGGGAGGGG + Intronic
1147389302 17:40099498-40099520 GTGGTGCCCGGCCCGAGGGAGGG - Intronic
1147754895 17:42761517-42761539 GCTGCGCCCGCCCCGAGGTGGGG - Intronic
1149387031 17:56152693-56152715 ACTGTGCCAGGCACTAGGTGAGG + Intronic
1149610400 17:57954969-57954991 CCGGGGCCCGGGATGAGGTGGGG + Intronic
1150212672 17:63450006-63450028 TCTGTGCCAGGCACTAGGTGAGG + Intergenic
1150633914 17:66899268-66899290 GCAGTGCCAGGCACCAGGTCAGG + Intergenic
1151704297 17:75758544-75758566 GGCGGGCCCGGCACGTGGTGGGG - Exonic
1151814206 17:76463135-76463157 TCGGTGCCCGGGATGGGGTGGGG + Intronic
1151983820 17:77529278-77529300 GCGTGGCCCGGCAGGAGGCGAGG + Intergenic
1157529354 18:48408856-48408878 GCGGTGCCAGCCAGGAGGCGCGG + Intronic
1161304122 19:3557497-3557519 GGGGTGCCCGGCGCGTGGTGGGG - Exonic
1162070336 19:8149058-8149080 GGCGCGCCCGGCACGGGGTGTGG + Intronic
1164672267 19:30078823-30078845 GCAGTGCCTGGCATCAGGTGAGG - Intergenic
1164674235 19:30091134-30091156 GCGGGGACCGGCAGGAGCTGGGG + Intergenic
1166567111 19:43772031-43772053 GTGGTGCCGGGCACCATGTGGGG - Exonic
1168307041 19:55441423-55441445 GCGGTGGGCAGCAGGAGGTGAGG - Intronic
925032668 2:662882-662904 GAGATGCCCGGCCCGACGTGGGG - Intergenic
927606565 2:24491500-24491522 GCGGCGCCGGGCCCGAGGAGCGG + Intergenic
935450975 2:103208937-103208959 ACAGTGCCTGGCACGTGGTGAGG + Intergenic
948723768 2:239919584-239919606 GCAGTGCCCGCCACTGGGTGTGG + Intronic
949035707 2:241814893-241814915 GGGGTGCCCTGCACGTGCTGGGG + Exonic
1173822558 20:46028894-46028916 GCGGGGCCCGGCACGTGGGCAGG - Intronic
1175268425 20:57716722-57716744 GCAGCACCTGGCACGAGGTGTGG - Intergenic
1175822238 20:61916459-61916481 ACAGTGCCCGGCACAAGGTAAGG + Intronic
1175899309 20:62353778-62353800 GGGGTGCCCGGTGTGAGGTGGGG - Intronic
1181044920 22:20209937-20209959 ACGGTGCCAGGCACCAGCTGAGG + Intergenic
1181059230 22:20273940-20273962 GCGGTGCCCAGCGTGAGGAGGGG + Intronic
1181571242 22:23768621-23768643 GCGGGGCCAGGGACTAGGTGGGG - Intronic
1182796791 22:32996853-32996875 GGGCTGCCTGGCTCGAGGTGGGG + Intronic
1183149735 22:36028373-36028395 GCGGCGCCGGGCCCGAGCTGAGG + Exonic
1184215456 22:43064068-43064090 GCGGTGCCTGGCACGGGGCAGGG - Intronic
1185374351 22:50475179-50475201 CAGGTGCCCGGCCCGAGGGGCGG - Intergenic
953200786 3:40776924-40776946 GCGGTGCCCAGCAGGAGGGAAGG - Intergenic
954401352 3:50321360-50321382 GTGGCGCCCCGCGCGAGGTGAGG - Exonic
954800369 3:53183670-53183692 GAGGTGCCCGTCTCCAGGTGAGG - Intronic
955345209 3:58156010-58156032 GCGATGACCGGCACCAGGTAGGG - Exonic
956468711 3:69542834-69542856 GCGGTGCCTGCCAGGAGGAGGGG + Intergenic
961449758 3:126997372-126997394 GCAGTGCCCGGCAGCATGTGGGG + Intronic
966868530 3:184275963-184275985 GCGGAGCCCCGCCCGGGGTGGGG - Intronic
967096448 3:186181245-186181267 ATGGTGCCTGGCACGTGGTGGGG + Intronic
968225274 3:196968983-196969005 GCGTTGCCCGGCCCGAGGGACGG - Intronic
973936743 4:55853899-55853921 GCGGTGCCCGACCCCAGGCGTGG - Exonic
986647567 5:9932930-9932952 GTTGTGCCTGGCAGGAGGTGGGG - Intergenic
989625662 5:43427266-43427288 GCTGTGCTCAGCACAAGGTGGGG - Intergenic
997264969 5:132490217-132490239 TCGGTCCCCGGCACGGCGTGTGG + Intronic
1002049598 5:176562593-176562615 GAGGTGCCCAGGACCAGGTGAGG + Intronic
1002466482 5:179411343-179411365 GCGGTGCCAGGCAATAGCTGTGG - Intergenic
1005826053 6:29632533-29632555 GCGGAGCCCCGCGCGGGGTGGGG + Intronic
1010000136 6:70940636-70940658 ACGGTGCCTGGCCCTAGGTGTGG - Intronic
1016079158 6:139834650-139834672 GCTGTGCCCGGCACAATGTAAGG - Intergenic
1017778151 6:157695598-157695620 GCCGTGCCAGGCCCGAGGTTTGG - Intergenic
1018620610 6:165726588-165726610 GCGGTGCCTGTCAGGAGGTGTGG - Intronic
1020261068 7:6531097-6531119 GCGGTCCCCGGCTCCAGATGGGG - Intronic
1020418022 7:7968761-7968783 GCGGTGCCGGGGGCGGGGTGCGG + Intronic
1021714221 7:23446911-23446933 ACCGTGCCTGGCACCAGGTGAGG - Intronic
1023880876 7:44320825-44320847 CCAGTGCCTGGCCCGAGGTGGGG - Intronic
1024534176 7:50416495-50416517 ACAGTGCCTGGCACAAGGTGAGG + Intergenic
1026952025 7:74353988-74354010 GCGGTGGCGGGCACCAGGTATGG + Exonic
1034978426 7:155461037-155461059 GCTGTGCCCAGCAAGAGGTGGGG - Intronic
1036149278 8:6283126-6283148 ATGGTGACCAGCACGAGGTGAGG - Intergenic
1037432344 8:18827099-18827121 ATGGTGCCCGGCAGGAGGTGTGG - Intronic
1038419370 8:27422504-27422526 GTGGTGACCGGCAGCAGGTGAGG + Intronic
1043041814 8:75273326-75273348 CCGGTGCCTGTCAGGAGGTGAGG + Intergenic
1046521000 8:115325791-115325813 GCGGGACCTGGCAGGAGGTGAGG - Intergenic
1049557492 8:143290440-143290462 GCGGTTCCAGGCACGAGATGTGG + Intronic
1057192780 9:93096568-93096590 GCGGTGCCGGGCATGATGGGTGG + Intronic
1060969416 9:127729830-127729852 GGGCTGCCCAGGACGAGGTGAGG + Intronic
1061012041 9:127961494-127961516 GCAGTGCCTGGCACCTGGTGGGG - Intronic
1061682687 9:132250768-132250790 GCTGTGGCCAGCACGTGGTGGGG + Intergenic
1061976035 9:134068321-134068343 GCTGTCCCCGACACGGGGTGAGG - Intronic
1062609869 9:137368981-137369003 GCAGTGCCCGGGGCGGGGTGGGG + Intronic
1203700975 Un_GL000214v1:133327-133349 GTGGGGCCCGGCACGTGGGGAGG - Intergenic
1190266844 X:48831849-48831871 GAGGTGCCCGGCAGGGGGTGGGG - Exonic
1196245228 X:113391944-113391966 GCGCTGTTCGGCACGAGGAGGGG + Intergenic
1199976632 X:152898210-152898232 CCGGTGCCCGGCTCGTGGGGCGG - Intergenic