ID: 1077331034

View in Genome Browser
Species Human (GRCh38)
Location 11:1983903-1983925
Sequence GGGATAGTGTCCTGGGGCCT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 246
Summary {0: 2, 1: 0, 2: 1, 3: 11, 4: 232}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1077331034_1077331051 -1 Left 1077331034 11:1983903-1983925 CCCAGGCCCCAGGACACTATCCC 0: 2
1: 0
2: 1
3: 11
4: 232
Right 1077331051 11:1983925-1983947 CCGGGGGTCCAAGGCGGGTGGGG 0: 2
1: 0
2: 1
3: 12
4: 172
1077331034_1077331049 -2 Left 1077331034 11:1983903-1983925 CCCAGGCCCCAGGACACTATCCC 0: 2
1: 0
2: 1
3: 11
4: 232
Right 1077331049 11:1983924-1983946 CCCGGGGGTCCAAGGCGGGTGGG 0: 2
1: 0
2: 0
3: 16
4: 137
1077331034_1077331045 -6 Left 1077331034 11:1983903-1983925 CCCAGGCCCCAGGACACTATCCC 0: 2
1: 0
2: 1
3: 11
4: 232
Right 1077331045 11:1983920-1983942 TATCCCCGGGGGTCCAAGGCGGG 0: 2
1: 0
2: 0
3: 8
4: 111
1077331034_1077331043 -10 Left 1077331034 11:1983903-1983925 CCCAGGCCCCAGGACACTATCCC 0: 2
1: 0
2: 1
3: 11
4: 232
Right 1077331043 11:1983916-1983938 ACACTATCCCCGGGGGTCCAAGG 0: 2
1: 0
2: 0
3: 5
4: 219
1077331034_1077331044 -7 Left 1077331034 11:1983903-1983925 CCCAGGCCCCAGGACACTATCCC 0: 2
1: 0
2: 1
3: 11
4: 232
Right 1077331044 11:1983919-1983941 CTATCCCCGGGGGTCCAAGGCGG 0: 2
1: 0
2: 1
3: 2
4: 70
1077331034_1077331047 -3 Left 1077331034 11:1983903-1983925 CCCAGGCCCCAGGACACTATCCC 0: 2
1: 0
2: 1
3: 11
4: 232
Right 1077331047 11:1983923-1983945 CCCCGGGGGTCCAAGGCGGGTGG 0: 2
1: 0
2: 0
3: 83
4: 2105

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1077331034 Original CRISPR GGGATAGTGTCCTGGGGCCT GGG (reversed) Intronic