ID: 1077332921

View in Genome Browser
Species Human (GRCh38)
Location 11:1991219-1991241
Sequence GGAAGGGGCTGCTCTCGCAG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 259
Summary {0: 2, 1: 0, 2: 2, 3: 17, 4: 238}

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1077332921_1077332937 24 Left 1077332921 11:1991219-1991241 CCTCTGCGAGAGCAGCCCCTTCC 0: 2
1: 0
2: 2
3: 17
4: 238
Right 1077332937 11:1991266-1991288 TTCCAGGAAGGGGCCCCCGCTGG No data
1077332921_1077332936 14 Left 1077332921 11:1991219-1991241 CCTCTGCGAGAGCAGCCCCTTCC 0: 2
1: 0
2: 2
3: 17
4: 238
Right 1077332936 11:1991256-1991278 GCAGGTGGGCTTCCAGGAAGGGG 0: 2
1: 1
2: 9
3: 75
4: 528
1077332921_1077332932 8 Left 1077332921 11:1991219-1991241 CCTCTGCGAGAGCAGCCCCTTCC 0: 2
1: 0
2: 2
3: 17
4: 238
Right 1077332932 11:1991250-1991272 CGGCCTGCAGGTGGGCTTCCAGG 0: 2
1: 0
2: 0
3: 24
4: 256
1077332921_1077332934 12 Left 1077332921 11:1991219-1991241 CCTCTGCGAGAGCAGCCCCTTCC 0: 2
1: 0
2: 2
3: 17
4: 238
Right 1077332934 11:1991254-1991276 CTGCAGGTGGGCTTCCAGGAAGG 0: 2
1: 1
2: 0
3: 39
4: 330
1077332921_1077332929 -1 Left 1077332921 11:1991219-1991241 CCTCTGCGAGAGCAGCCCCTTCC 0: 2
1: 0
2: 2
3: 17
4: 238
Right 1077332929 11:1991241-1991263 CCAGCAAGCCGGCCTGCAGGTGG 0: 2
1: 0
2: 0
3: 32
4: 226
1077332921_1077332930 0 Left 1077332921 11:1991219-1991241 CCTCTGCGAGAGCAGCCCCTTCC 0: 2
1: 0
2: 2
3: 17
4: 238
Right 1077332930 11:1991242-1991264 CAGCAAGCCGGCCTGCAGGTGGG 0: 2
1: 0
2: 0
3: 19
4: 168
1077332921_1077332935 13 Left 1077332921 11:1991219-1991241 CCTCTGCGAGAGCAGCCCCTTCC 0: 2
1: 0
2: 2
3: 17
4: 238
Right 1077332935 11:1991255-1991277 TGCAGGTGGGCTTCCAGGAAGGG 0: 2
1: 1
2: 3
3: 26
4: 284
1077332921_1077332926 -4 Left 1077332921 11:1991219-1991241 CCTCTGCGAGAGCAGCCCCTTCC 0: 2
1: 0
2: 2
3: 17
4: 238
Right 1077332926 11:1991238-1991260 TTCCCAGCAAGCCGGCCTGCAGG 0: 2
1: 0
2: 1
3: 16
4: 149

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1077332921 Original CRISPR GGAAGGGGCTGCTCTCGCAG AGG (reversed) Intergenic
900309673 1:2027680-2027702 GGTAGGGGCTTCTCCAGCAGTGG + Intronic
900340101 1:2184300-2184322 GGAAGGGGGTGGCCTCGCATGGG + Intronic
900566671 1:3335737-3335759 GGAAGGTGCTGGCCTGGCAGGGG + Intronic
900606045 1:3523997-3524019 GGCAGAGGCCGCTCTGGCAGTGG - Intronic
900836766 1:5010858-5010880 GGGAGGGGCTGTGCTCCCAGGGG - Intergenic
901325055 1:8360751-8360773 GGCAGGGGCTGCTCCCGTGGAGG + Exonic
901666342 1:10828310-10828332 GGAGGGGACAGCTCTTGCAGAGG - Intergenic
903574371 1:24329254-24329276 GGAGGCGGCAGCTCTCCCAGCGG - Intronic
905797756 1:40825083-40825105 GAAAGTGGCTGCTCTTGTAGAGG + Intronic
906786416 1:48619854-48619876 GGGCGGGGCTTCTCTCACAGAGG - Intronic
907392721 1:54168710-54168732 GGTAGGTGCTGCTTTCACAGGGG - Intronic
908572177 1:65421005-65421027 GGAGGGCGCCGCTCTCGCCGAGG - Intronic
915234265 1:154468963-154468985 GGCAGGGGCTGCACACGGAGGGG + Exonic
916836693 1:168553275-168553297 AGAAGGGGCATCTCTCCCAGTGG - Intergenic
918215653 1:182390882-182390904 GGAAGGGGCTGCTCTCAAAGTGG - Intronic
922565369 1:226598023-226598045 GGCAGGGGCTGCCCTGTCAGAGG + Intronic
924741100 1:246794568-246794590 GGGAGGGGCTGCCCAGGCAGGGG - Intergenic
924843667 1:247743225-247743247 GGTAGGGGGTGCTCTGGTAGGGG - Intergenic
1065579341 10:27155370-27155392 GGGAGTGGCTGCTCGCGGAGGGG + Exonic
1066598004 10:37073948-37073970 GGAAGGCACTGATCTCTCAGAGG + Intergenic
1067687005 10:48471750-48471772 AGAAGGGGGTGCTCTCCCTGTGG - Intronic
1071394727 10:85211580-85211602 GGAAGGGGCCTGTCTCCCAGTGG + Intergenic
1071604974 10:86979671-86979693 GGCAGGGGCTCCTCTGTCAGAGG + Intronic
1071748760 10:88451364-88451386 GGTGGGGGCTTCTCTCACAGGGG - Intronic
1073121996 10:101127615-101127637 GGAAGCGGCTGTGATCGCAGGGG + Intronic
1074291218 10:112139278-112139300 GGAGTGGGCTGCCCTGGCAGAGG - Intergenic
1075045482 10:119143120-119143142 GGAAGGGGCAGAACTCCCAGAGG - Intronic
1075253904 10:120908756-120908778 GGAGGGGGCTGGTCTGGCTGTGG + Exonic
1076098437 10:127753556-127753578 GGAAGGGGCTGAGCTGGAAGAGG + Intergenic
1076372866 10:129966264-129966286 GGAAGGGGCACCTCTAGCACAGG - Intergenic
1077142577 11:1030985-1031007 GGAAGGTGCAGATCTCGCCGGGG + Exonic
1077227501 11:1444796-1444818 GGAGGGGGCTGCGTTCCCAGAGG - Intronic
1077240691 11:1508886-1508908 GGCAGGGGCTGCTCCTGCAGGGG + Intergenic
1077332921 11:1991219-1991241 GGAAGGGGCTGCTCTCGCAGAGG - Intergenic
1077356769 11:2122372-2122394 GGAAGGGGCTGCTGAGGCCGGGG - Intergenic
1078136518 11:8656711-8656733 GGAAGGGGATGCTCTCTCTAAGG - Intronic
1078413954 11:11150054-11150076 GGAAGAAGCTGTTCTCACAGAGG + Intergenic
1079029649 11:16977038-16977060 GGATGGGGATGCTCTGGCTGAGG - Intronic
1079131122 11:17747514-17747536 TAAAGGGGCTGCTCTGGCACAGG + Intronic
1082985999 11:59172040-59172062 GGCAGGGGGAGCTCTCCCAGCGG + Intronic
1083265187 11:61543395-61543417 GCAAGGGGATGCTCTCCCAAAGG + Intronic
1083644700 11:64165605-64165627 GGAAGGGGCTGCTCGCTCGTTGG + Intronic
1083714316 11:64567102-64567124 AGAAGGGGCAGCACTCCCAGGGG + Intronic
1083730567 11:64650374-64650396 GGAATGGGGTGATCTCGCTGGGG + Intronic
1083784322 11:64935080-64935102 GGAAGGCGCTGGACTCACAGTGG + Exonic
1085891860 11:80589116-80589138 GGAAGGCACTGATCTCTCAGAGG - Intergenic
1088504841 11:110517562-110517584 GGAAGGCGCTGCTCTCACACAGG - Intergenic
1089053266 11:115564470-115564492 GGGAGGTGCTGCCCTCCCAGGGG + Intergenic
1089082336 11:115787337-115787359 GGAGGGGGCTGATGTCGTAGGGG + Intergenic
1089141131 11:116285237-116285259 GGAAGGGGGTCTTCTCACAGAGG - Intergenic
1090014428 11:123073485-123073507 GGAAGGCTCTGCTCTGGCTGGGG + Exonic
1090261293 11:125322539-125322561 GGATGGCGCTGCTCTCGTGGGGG + Intronic
1090392778 11:126400206-126400228 TCAAGGGGCTGCTCTGGCAAGGG + Intronic
1090396847 11:126424750-126424772 GGAAGGAGCTGCTGTCGCTGAGG + Exonic
1090440235 11:126719323-126719345 GTAAGAGACTGCTCTCCCAGAGG - Intronic
1091042067 11:132290783-132290805 GGATGGGGGTGCTATCCCAGGGG + Intronic
1091225396 11:133954019-133954041 AGCAGGGGCTGCTCTGGCAGAGG - Intronic
1202815904 11_KI270721v1_random:46395-46417 GGAAGGGGCTGCTCTCGCAGAGG - Intergenic
1091549002 12:1523748-1523770 AGAAGGGGCTGCTCTCGCTCTGG + Intergenic
1092897509 12:13027212-13027234 GGAAGGTTCTGCTATCACAGGGG - Intergenic
1094019305 12:25897304-25897326 GGTAGGGGCTGATATCACAGGGG - Intergenic
1096260805 12:50089845-50089867 GTCAGGGGGTGCTCTCCCAGAGG - Intronic
1097130951 12:56810323-56810345 GGAGGGGGCTGAGCTGGCAGGGG + Intergenic
1099503826 12:83447463-83447485 GGAAGGCACTTCTCTGGCAGCGG - Intergenic
1102252185 12:111394851-111394873 GGCTGGGGCTGCTCCCACAGAGG - Intergenic
1103436204 12:120928970-120928992 GGAAGGGGCTGCTTCAGCTGTGG + Intergenic
1105932226 13:25063242-25063264 AGAAGGAGCTGCTTTCTCAGAGG - Intergenic
1106480726 13:30135260-30135282 GGAAGGAGCTGCCCCCGCAATGG - Intergenic
1106809925 13:33349896-33349918 GGAAGGGGCAGCCCTCGCGAAGG + Intronic
1107607929 13:42080377-42080399 GGAAGGAACTTCTCTCCCAGGGG - Intronic
1108046164 13:46386922-46386944 GGAAGGGGCTCCTCGCGGGGTGG - Intronic
1108095244 13:46894210-46894232 GGAACGGGCTGCTCTCAGAGCGG + Intronic
1109858803 13:68171037-68171059 GGCAGGCTCTGCACTCGCAGCGG + Intergenic
1112160918 13:96867124-96867146 GGAAAGAGCTGCCCTGGCAGGGG + Intergenic
1113379386 13:109787618-109787640 GGAAGGGGGTGCTCCTGCAGCGG - Intergenic
1113379396 13:109787667-109787689 GGAAGGGGGGGCTCTTGAAGCGG - Intergenic
1113464312 13:110503319-110503341 GGAGGGGGCTCCTCTCACTGTGG - Intronic
1113589039 13:111485149-111485171 GGCAGGGGCTGACCTCGCCGGGG + Intergenic
1113955101 13:114096113-114096135 GGAAGGGGGTGCTCTCTGGGTGG + Intronic
1116764168 14:49050587-49050609 GGAAGAGGCGACTCCCGCAGTGG - Intergenic
1119715349 14:76855099-76855121 GGAAGGGGCTGCCATCTGAGAGG + Intronic
1121237490 14:92403176-92403198 AGAAGAGGCTGCTCACCCAGAGG - Intronic
1121782341 14:96629988-96630010 GGAACGGGCTGCTCTTGAACAGG + Intergenic
1122077725 14:99246517-99246539 GAAAGGGGCACCGCTCGCAGGGG + Intronic
1122140804 14:99661942-99661964 GGAAGGGGCGGATCTGGGAGAGG - Intronic
1122811656 14:104292270-104292292 GGAGGGGGCTGCAGTGGCAGCGG + Intergenic
1122835812 14:104430433-104430455 CTAGGGTGCTGCTCTCGCAGCGG - Intergenic
1122860536 14:104580470-104580492 AGAAGGGGCTGCACTCTCAGGGG + Intronic
1122862116 14:104587395-104587417 GGAGGGGGCTGCAATGGCAGAGG - Intronic
1202883704 14_KI270722v1_random:84720-84742 GGAAGGGGCTGAGGTGGCAGGGG + Intergenic
1124387648 15:29223759-29223781 GGAAAGGGCTGCAGGCGCAGGGG - Intronic
1125507955 15:40277893-40277915 GGCAGGGACTGCTCTCCCACTGG - Intergenic
1125736739 15:41932336-41932358 GGCAGGGTCTGCTCTGGGAGAGG + Intronic
1126317880 15:47390132-47390154 GGAAGGGGCTGATCTCAGTGGGG + Intronic
1126416934 15:48427630-48427652 GGAAAGGGCAGATCTCACAGTGG + Exonic
1127142706 15:55993676-55993698 GGGAGGCGCTGCTGTCGCTGAGG - Intronic
1127713356 15:61623746-61623768 GAAGGGACCTGCTCTCGCAGTGG - Intergenic
1128416140 15:67447710-67447732 AGAAGGGGCTGCTCAGGTAGTGG - Intronic
1129722445 15:77885250-77885272 GGAAGGGGCTGCTCTTAGATGGG - Intergenic
1130305965 15:82712198-82712220 GGAAGGGGATCCTAGCGCAGGGG - Intergenic
1132321715 15:100930382-100930404 GGTAGGGGCAGCTCTCCCTGTGG - Intronic
1132604566 16:788388-788410 GGGCGGGGCTGCGCGCGCAGCGG - Intronic
1133045885 16:3088097-3088119 GGGAGGGGCGGCCCTGGCAGAGG - Intergenic
1133221928 16:4322607-4322629 GGGGGGGGCTGCTCCTGCAGGGG - Intronic
1134086779 16:11362721-11362743 GGAAGGGTCTTCTGTTGCAGGGG + Intronic
1135521939 16:23184249-23184271 GGAAGGGGCTGATGGGGCAGAGG + Intronic
1138555564 16:57769475-57769497 GGCAGGGGCTGCTGTCTGAGCGG + Intronic
1139596900 16:67963527-67963549 GAAAAGGGCTGCTCTCTCTGTGG + Intronic
1140223773 16:73063218-73063240 GGAAGGGGCTGCTCTCATCCTGG + Intergenic
1140731841 16:77863608-77863630 GGAGGGGGCTGCTCTGGGAAAGG + Intronic
1141864515 16:86740952-86740974 TGAAGGGGCTGCACTGGCCGGGG - Intergenic
1141919248 16:87124258-87124280 AGAAGCTGCTGCTCTCTCAGTGG - Intronic
1142476170 17:191620-191642 GGAACGGGCGACTGTCGCAGGGG - Intergenic
1143152340 17:4815421-4815443 GAAAGGGGCTACTCTGGGAGAGG + Intronic
1144826369 17:18107823-18107845 GGCAGGGGCTGCCCTGGGAGGGG - Exonic
1145261570 17:21357768-21357790 GGAAGGGCCTGCTGTGGGAGGGG + Intergenic
1149651393 17:58278614-58278636 GGTTGGGGCTGCCCTCTCAGTGG + Intronic
1149995722 17:61405111-61405133 GGGAAGGGCTGCTCTCGGGGAGG - Intronic
1150121986 17:62611526-62611548 CGAATGGACTGCTCTGGCAGGGG - Intronic
1151518558 17:74612897-74612919 AGAAGGGGCTGCCCTGGCATAGG - Intronic
1151559544 17:74862986-74863008 GGAGGGGGCTGTTCTGGGAGGGG - Intronic
1151563749 17:74885461-74885483 TGAAGGGGCTGCTCATGCTGTGG + Intronic
1151654606 17:75490114-75490136 GGAAGGGCCAGCTCTCTCAGGGG - Intronic
1152463066 17:80451381-80451403 GGCAGGGGCTGATCTCTCAAGGG - Intergenic
1154148481 18:11886558-11886580 GGAAGACGCTGCTCCTGCAGAGG - Exonic
1154327587 18:13402887-13402909 GGAAGGGGTTGCTCTCCCACTGG + Intronic
1156854702 18:41768228-41768250 GGAACTGTCTGCTCTGGCAGTGG - Intergenic
1160805315 19:989977-989999 GGAAGGGGCTTCTCTCTTGGGGG + Intronic
1160908867 19:1465710-1465732 GGAAGGGGCTGCCCAGGAAGAGG - Exonic
1161517435 19:4704190-4704212 GGAAGAGGCCACTCTCGCTGTGG + Exonic
1161967306 19:7555602-7555624 GGCAGGGGCTGCTCGCACATCGG + Exonic
1162671322 19:12260103-12260125 GGTGGCGGCTCCTCTCGCAGTGG - Intronic
1162792597 19:13070714-13070736 GGCAGGGGCTGCACTCGCACCGG + Intronic
1164501948 19:28827639-28827661 GGAAGGGGCTGCACGCATAGAGG - Intergenic
1166802714 19:45468282-45468304 GGGAGGGGTTGCTCCCCCAGGGG - Exonic
1167517691 19:49932784-49932806 GGAGGGGGCTGCTGTGGCGGGGG - Exonic
1167772798 19:51531358-51531380 GGAAGGGGCTGATGTTCCAGTGG - Exonic
1202659129 1_KI270708v1_random:51868-51890 GGAAGGGGCTGAGGTGGCAGGGG + Intergenic
925011571 2:489326-489348 GGAAGGGGATGCATTCGCTGAGG - Intergenic
925064961 2:922471-922493 GGCAGGGACGGCTCTAGCAGTGG - Intergenic
926161571 2:10493700-10493722 GGTAGGGGCTGCTGAGGCAGAGG - Intergenic
926238588 2:11068212-11068234 GGAAGGGACTGCTCTGACTGGGG + Intergenic
928719303 2:34100821-34100843 GGAAGGTGCTGCTGTAGCTGGGG - Intergenic
930103120 2:47618156-47618178 AGGAGGGAGTGCTCTCGCAGAGG + Intergenic
932144238 2:69304926-69304948 GGGTGGGGCTGCTGTCGCTGAGG + Intergenic
932397545 2:71458488-71458510 AGAAGGGACTGCTCTAGGAGGGG - Intronic
934648527 2:96073277-96073299 GGGAAGGGCTCCTCTGGCAGGGG + Intergenic
937147095 2:119656819-119656841 GGAGGGGGCTGCTTCTGCAGAGG - Intronic
937265062 2:120610165-120610187 GGAAGTGGATGCTGTCCCAGAGG - Intergenic
937917687 2:127106966-127106988 GGCAGGGGCCGCTCTCGCGCGGG + Exonic
940007266 2:149019434-149019456 GGTAGGTGCTGCTATGGCAGAGG + Intronic
944810952 2:203327698-203327720 GAAAGGGGCTAATCTGGCAGGGG + Intergenic
948201502 2:236132799-236132821 GTGAGGGGCTGCCCTCGCTGTGG - Intergenic
948572235 2:238924947-238924969 TGCAGCGGCTGCTGTCGCAGAGG - Intergenic
948693504 2:239721254-239721276 GGCAGGGCCTGCCCTGGCAGGGG + Intergenic
948889561 2:240900348-240900370 GGAAGGGGGTGTTCTCTCAGTGG + Intergenic
948937674 2:241178135-241178157 GGTAGGGGCTGCTCGAGGAGAGG + Intronic
949009957 2:241672733-241672755 GGACTGGGCTGCTCTCGAGGGGG + Exonic
1169497680 20:6130690-6130712 GGAAGGGGATGCCCTCACAATGG - Intergenic
1171973380 20:31578616-31578638 GGAGGGGGCGGCGCTCGTAGGGG + Intergenic
1175424326 20:58854434-58854456 TGCAGGGGCTGCCCTGGCAGCGG - Exonic
1175637706 20:60599557-60599579 GGCAGGGGCTGCGCTCGCCCTGG - Intergenic
1175987920 20:62773254-62773276 GGTAGGAGCTGCTGCCGCAGGGG - Intergenic
1176014298 20:62921351-62921373 GGAAGGCGCTGCTGTGTCAGCGG - Intronic
1176068709 20:63215233-63215255 AGCAGGGGCTGCTCTAGGAGAGG - Intronic
1176097171 20:63349498-63349520 GGAAGAGGCTGCTGCAGCAGGGG + Intronic
1178334543 21:31731828-31731850 GGAAGAGGCTGCGCCCGAAGCGG + Exonic
1179739663 21:43411059-43411081 GGACGCGCCTCCTCTCGCAGCGG - Intergenic
1180153969 21:45968696-45968718 AGAAGGGTTTGCTCACGCAGTGG - Intergenic
1180326588 22:11435392-11435414 GGAAGGGGCTGAGGTGGCAGGGG + Intergenic
1180665857 22:17511448-17511470 TGAAGGGGCGGCTCTGGGAGGGG - Intronic
1181461824 22:23090228-23090250 AGCAGGGGCTGCTCTTGGAGAGG - Intronic
1182343872 22:29645635-29645657 GGCTGGGTCTGCTCTCGCTGGGG - Intronic
1184114114 22:42412279-42412301 GGTAGGGGCTGCACCTGCAGAGG - Intronic
1185178598 22:49346511-49346533 TGAAGGTGCTGCTGTTGCAGAGG + Intergenic
953109307 3:39918357-39918379 GGAAGAGGGTCCTCTGGCAGAGG - Intronic
953797829 3:45999026-45999048 GGAAGGAGCTGCCATCACAGTGG - Intergenic
953798809 3:46005743-46005765 GGAGGGGGCTTCTCTCTCAGAGG - Intergenic
954902368 3:54030905-54030927 GGATGGAGCTTCTCTAGCAGTGG - Intergenic
957163114 3:76635706-76635728 GGAAGTGTCTGCACTCGCATTGG - Intronic
961041745 3:123682993-123683015 GGAAGGGTTTCCTCTGGCAGAGG - Intronic
961404081 3:126666707-126666729 GGAAGTGGCAGCACTGGCAGTGG + Intergenic
961649341 3:128409746-128409768 GGAAGTGTCTGCTCAGGCAGCGG - Intergenic
961819398 3:129567533-129567555 GGAAGGGGATGCCCTGGCTGCGG + Exonic
963483300 3:145904097-145904119 GGAGGGGGCTGATGTGGCAGGGG - Intergenic
967104190 3:186242233-186242255 TGAAGGGCCTGCTTTTGCAGGGG - Intronic
968567081 4:1318670-1318692 GGAAGGTGCTGCTGTGGCCGAGG + Intronic
971768970 4:30871519-30871541 GGAAGTGGCTGCCCTGTCAGAGG - Intronic
979448377 4:120840327-120840349 GGGAGGGGCTCCTCTGGGAGTGG + Intronic
979473277 4:121125720-121125742 TGGAGGGGCTGCTCTCTCATAGG + Intergenic
985808802 5:2068341-2068363 GGAAGGGGCTGCCAGCCCAGGGG + Intergenic
986338251 5:6770383-6770405 GGAAGGGGCAGTTCCCGAAGGGG - Intergenic
986855103 5:11859123-11859145 TGAAGGAGATGCTCTTGCAGTGG - Intronic
988073551 5:26324777-26324799 GCAGGGGGCTGCTCTCACTGGGG - Intergenic
992067203 5:73119770-73119792 GGAAGGGGGTTCTATCGCAAAGG + Intergenic
995604303 5:113834720-113834742 GGAGGGGGCAGCTTGCGCAGTGG + Intergenic
996559081 5:124809232-124809254 GGCGGCGGCTTCTCTCGCAGCGG + Intergenic
997210127 5:132072274-132072296 GGATGGGGCTGGCCTCACAGTGG + Intergenic
998003432 5:138641904-138641926 GGTAGGGCCTGCTCCTGCAGCGG + Intronic
1000443022 5:161285308-161285330 GTAAGGGGCTGCTGATGCAGAGG + Intergenic
1006039445 6:31241922-31241944 GGAAGAGGATTCTCTCCCAGAGG + Intergenic
1006891528 6:37433294-37433316 GGAGGCGGCGGCTCTGGCAGCGG + Exonic
1007396274 6:41579502-41579524 GAAAGGGGCTGCTGACCCAGGGG + Intronic
1017399293 6:154040394-154040416 GGTAAGGGCTGCTATGGCAGGGG - Intronic
1017724161 6:157265392-157265414 GGACTGGGTTCCTCTCGCAGTGG - Intergenic
1018056344 6:160055446-160055468 AGAAAGGGCCGCTCTCCCAGGGG + Intronic
1018796116 6:167186844-167186866 GGAAGGAGCTGCTTTGGAAGAGG - Intronic
1018820205 6:167368213-167368235 GGAAGGAGCTGCTTTGGAAGAGG + Intronic
1018966515 6:168494749-168494771 GGATGGGGCTGCTCCAGCCGAGG - Intronic
1019177294 6:170166585-170166607 GGGAGGGGCTGCTCCCGGAAGGG + Intergenic
1019317178 7:392093-392115 GGAAGCGTCTGTTCTCGCTGTGG - Intergenic
1019526437 7:1482502-1482524 GGCAGGGGCTGCTGACTCAGGGG - Intronic
1022876236 7:34533573-34533595 GGAAGTGGCTGCCTTTGCAGAGG - Intergenic
1023966961 7:44967767-44967789 GGGTGGGGCTGCTCTCCCAGAGG - Intronic
1024626356 7:51211195-51211217 GGATGGGGCTGCTCCATCAGAGG - Intronic
1024700335 7:51899562-51899584 GAGAGGGTCTGCTCTGGCAGAGG - Intergenic
1025777284 7:64570342-64570364 GCCGGGGGCTGCTCTCCCAGAGG - Intergenic
1029063310 7:97822396-97822418 GGAACTGCCTGCTCTCCCAGTGG + Intergenic
1032128858 7:129212983-129213005 GGAAGGACCTGCTCCCACAGGGG + Exonic
1032427024 7:131830535-131830557 GGAGGGGGCTGCTCAGGGAGGGG + Intergenic
1033790302 7:144785106-144785128 GGAAGGGGAAGCTGTCCCAGGGG + Intronic
1035162445 7:156961067-156961089 ATATGGGGCTGCTCTCGTAGAGG + Intronic
1035414495 7:158671608-158671630 GGAAGGAGCTGCTCTAACAATGG + Exonic
1036207415 8:6815410-6815432 GGAAGTGGGTGCCCTAGCAGAGG - Intronic
1037958225 8:23075244-23075266 TGGAGGGGCTGCTCAGGCAGAGG - Intergenic
1039667271 8:39547539-39547561 GGCAGGAGGTGCTCTAGCAGGGG + Intergenic
1039711771 8:40062172-40062194 GGATGGGGCTGCCCCAGCAGGGG - Intergenic
1040366835 8:46726091-46726113 GGAACTGCCTGCTCTCACAGTGG - Intergenic
1043428369 8:80171230-80171252 GGAAGGAGCGGCTCTGGCGGGGG - Intronic
1044898866 8:96923114-96923136 AGATGGGGCTTCTCTGGCAGAGG - Intronic
1045463144 8:102444036-102444058 GGAAGGGGCTGATTTCCCTGTGG + Intergenic
1046756826 8:117980876-117980898 GCATGGGGGTGCCCTCGCAGCGG - Intronic
1049196456 8:141318336-141318358 GGAAGTGGCTGCTCAGGCTGTGG - Intergenic
1049630390 8:143651584-143651606 GGATGGGGCTGCTTTTGCAGTGG + Exonic
1049644030 8:143728116-143728138 GGAAGTGGCTGGTCTGGAAGCGG + Exonic
1049655801 8:143796485-143796507 GGGAGGGGCTGCTCAGGCCGGGG + Intronic
1049673825 8:143880976-143880998 GACATGGGCTGCTCTCCCAGTGG + Intergenic
1051343015 9:16128776-16128798 GGAAGAGGCACCTCTCCCAGAGG - Intergenic
1055797053 9:79986145-79986167 GGAATGAGCTGCTCTCACATAGG + Intergenic
1056102242 9:83311164-83311186 GGAAGGGGCTGCTCTCCTCCAGG + Intronic
1056361349 9:85860786-85860808 GGTGGGGGATGCTCTCACAGTGG - Intergenic
1056842070 9:90005716-90005738 GGAAGGGGCTGCACACTCATAGG + Intergenic
1058801998 9:108553352-108553374 GGTTGGGGCTGCTTTCTCAGTGG + Intergenic
1059999590 9:119946068-119946090 GAAAGGGTCTGCTCTCTTAGAGG + Intergenic
1060421007 9:123469487-123469509 GGAAGGGGCTGCTGGCACAGAGG - Intronic
1060913707 9:127371039-127371061 GGAAGGTGCTGCCCTTGCACTGG - Intronic
1061193296 9:129094523-129094545 GGTAGGGGCAACTCTCCCAGGGG - Intergenic
1061516412 9:131092952-131092974 GGAGGGGGCTGGGCCCGCAGAGG - Exonic
1062062333 9:134503128-134503150 GGAGGGGGCTGCACTCGCAGTGG + Intergenic
1062348088 9:136124714-136124736 GGAAGGGGATTCTCCCGCAGGGG - Intergenic
1062577864 9:137216935-137216957 GGAAGAGGCTGCTCTGGCCTGGG - Exonic
1185669422 X:1794550-1794572 GGAAGAACCTGCTCTCCCAGGGG + Intergenic
1186992387 X:15084312-15084334 GGGAGGGGCTGCCCTGTCAGAGG - Intergenic
1187280469 X:17854877-17854899 TGAGGGGGCTGCCCTCACAGGGG - Intronic
1192583781 X:72305175-72305197 GGAGGGGGCTGCTCGCCCAAGGG - Intronic
1195157901 X:102141809-102141831 GGTAGGGGCTGCGCGCTCAGCGG + Intronic
1195732554 X:107981382-107981404 GGCAGGGCCTGCCCCCGCAGAGG - Exonic
1198639532 X:138741524-138741546 GGAGAGGGCTCCTCTTGCAGTGG - Intronic
1199699371 X:150364576-150364598 AGAAGGGGCTGCTTTTGCTGGGG + Intronic