ID: 1077332921

View in Genome Browser
Species Human (GRCh38)
Location 11:1991219-1991241
Sequence GGAAGGGGCTGCTCTCGCAG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 259
Summary {0: 2, 1: 0, 2: 2, 3: 17, 4: 238}

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1077332921_1077332930 0 Left 1077332921 11:1991219-1991241 CCTCTGCGAGAGCAGCCCCTTCC 0: 2
1: 0
2: 2
3: 17
4: 238
Right 1077332930 11:1991242-1991264 CAGCAAGCCGGCCTGCAGGTGGG 0: 2
1: 0
2: 0
3: 19
4: 168
1077332921_1077332929 -1 Left 1077332921 11:1991219-1991241 CCTCTGCGAGAGCAGCCCCTTCC 0: 2
1: 0
2: 2
3: 17
4: 238
Right 1077332929 11:1991241-1991263 CCAGCAAGCCGGCCTGCAGGTGG 0: 2
1: 0
2: 0
3: 32
4: 226
1077332921_1077332932 8 Left 1077332921 11:1991219-1991241 CCTCTGCGAGAGCAGCCCCTTCC 0: 2
1: 0
2: 2
3: 17
4: 238
Right 1077332932 11:1991250-1991272 CGGCCTGCAGGTGGGCTTCCAGG 0: 2
1: 0
2: 0
3: 24
4: 256
1077332921_1077332935 13 Left 1077332921 11:1991219-1991241 CCTCTGCGAGAGCAGCCCCTTCC 0: 2
1: 0
2: 2
3: 17
4: 238
Right 1077332935 11:1991255-1991277 TGCAGGTGGGCTTCCAGGAAGGG 0: 2
1: 1
2: 3
3: 26
4: 284
1077332921_1077332936 14 Left 1077332921 11:1991219-1991241 CCTCTGCGAGAGCAGCCCCTTCC 0: 2
1: 0
2: 2
3: 17
4: 238
Right 1077332936 11:1991256-1991278 GCAGGTGGGCTTCCAGGAAGGGG 0: 2
1: 1
2: 9
3: 75
4: 528
1077332921_1077332937 24 Left 1077332921 11:1991219-1991241 CCTCTGCGAGAGCAGCCCCTTCC 0: 2
1: 0
2: 2
3: 17
4: 238
Right 1077332937 11:1991266-1991288 TTCCAGGAAGGGGCCCCCGCTGG No data
1077332921_1077332926 -4 Left 1077332921 11:1991219-1991241 CCTCTGCGAGAGCAGCCCCTTCC 0: 2
1: 0
2: 2
3: 17
4: 238
Right 1077332926 11:1991238-1991260 TTCCCAGCAAGCCGGCCTGCAGG 0: 2
1: 0
2: 1
3: 16
4: 149
1077332921_1077332934 12 Left 1077332921 11:1991219-1991241 CCTCTGCGAGAGCAGCCCCTTCC 0: 2
1: 0
2: 2
3: 17
4: 238
Right 1077332934 11:1991254-1991276 CTGCAGGTGGGCTTCCAGGAAGG 0: 2
1: 1
2: 0
3: 39
4: 330

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1077332921 Original CRISPR GGAAGGGGCTGCTCTCGCAG AGG (reversed) Intergenic