ID: 1077332923

View in Genome Browser
Species Human (GRCh38)
Location 11:1991234-1991256
Sequence CAGGCCGGCTTGCTGGGAAG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 561
Summary {0: 2, 1: 0, 2: 2, 3: 31, 4: 526}

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1077332923_1077332937 9 Left 1077332923 11:1991234-1991256 CCCCTTCCCAGCAAGCCGGCCTG 0: 2
1: 0
2: 2
3: 31
4: 526
Right 1077332937 11:1991266-1991288 TTCCAGGAAGGGGCCCCCGCTGG No data
1077332923_1077332935 -2 Left 1077332923 11:1991234-1991256 CCCCTTCCCAGCAAGCCGGCCTG 0: 2
1: 0
2: 2
3: 31
4: 526
Right 1077332935 11:1991255-1991277 TGCAGGTGGGCTTCCAGGAAGGG 0: 2
1: 1
2: 3
3: 26
4: 284
1077332923_1077332944 29 Left 1077332923 11:1991234-1991256 CCCCTTCCCAGCAAGCCGGCCTG 0: 2
1: 0
2: 2
3: 31
4: 526
Right 1077332944 11:1991286-1991308 TGGCTTCCCTCAGCCCTGGAAGG No data
1077332923_1077332936 -1 Left 1077332923 11:1991234-1991256 CCCCTTCCCAGCAAGCCGGCCTG 0: 2
1: 0
2: 2
3: 31
4: 526
Right 1077332936 11:1991256-1991278 GCAGGTGGGCTTCCAGGAAGGGG 0: 2
1: 1
2: 9
3: 75
4: 528
1077332923_1077332932 -7 Left 1077332923 11:1991234-1991256 CCCCTTCCCAGCAAGCCGGCCTG 0: 2
1: 0
2: 2
3: 31
4: 526
Right 1077332932 11:1991250-1991272 CGGCCTGCAGGTGGGCTTCCAGG 0: 2
1: 0
2: 0
3: 24
4: 256
1077332923_1077332934 -3 Left 1077332923 11:1991234-1991256 CCCCTTCCCAGCAAGCCGGCCTG 0: 2
1: 0
2: 2
3: 31
4: 526
Right 1077332934 11:1991254-1991276 CTGCAGGTGGGCTTCCAGGAAGG 0: 2
1: 1
2: 0
3: 39
4: 330
1077332923_1077332943 25 Left 1077332923 11:1991234-1991256 CCCCTTCCCAGCAAGCCGGCCTG 0: 2
1: 0
2: 2
3: 31
4: 526
Right 1077332943 11:1991282-1991304 CCGCTGGCTTCCCTCAGCCCTGG No data
1077332923_1077332945 30 Left 1077332923 11:1991234-1991256 CCCCTTCCCAGCAAGCCGGCCTG 0: 2
1: 0
2: 2
3: 31
4: 526
Right 1077332945 11:1991287-1991309 GGCTTCCCTCAGCCCTGGAAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1077332923 Original CRISPR CAGGCCGGCTTGCTGGGAAG GGG (reversed) Intergenic