ID: 1077332923

View in Genome Browser
Species Human (GRCh38)
Location 11:1991234-1991256
Sequence CAGGCCGGCTTGCTGGGAAG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 561
Summary {0: 2, 1: 0, 2: 2, 3: 31, 4: 526}

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1077332923_1077332944 29 Left 1077332923 11:1991234-1991256 CCCCTTCCCAGCAAGCCGGCCTG 0: 2
1: 0
2: 2
3: 31
4: 526
Right 1077332944 11:1991286-1991308 TGGCTTCCCTCAGCCCTGGAAGG No data
1077332923_1077332932 -7 Left 1077332923 11:1991234-1991256 CCCCTTCCCAGCAAGCCGGCCTG 0: 2
1: 0
2: 2
3: 31
4: 526
Right 1077332932 11:1991250-1991272 CGGCCTGCAGGTGGGCTTCCAGG 0: 2
1: 0
2: 0
3: 24
4: 256
1077332923_1077332936 -1 Left 1077332923 11:1991234-1991256 CCCCTTCCCAGCAAGCCGGCCTG 0: 2
1: 0
2: 2
3: 31
4: 526
Right 1077332936 11:1991256-1991278 GCAGGTGGGCTTCCAGGAAGGGG 0: 2
1: 1
2: 9
3: 75
4: 528
1077332923_1077332945 30 Left 1077332923 11:1991234-1991256 CCCCTTCCCAGCAAGCCGGCCTG 0: 2
1: 0
2: 2
3: 31
4: 526
Right 1077332945 11:1991287-1991309 GGCTTCCCTCAGCCCTGGAAGGG No data
1077332923_1077332937 9 Left 1077332923 11:1991234-1991256 CCCCTTCCCAGCAAGCCGGCCTG 0: 2
1: 0
2: 2
3: 31
4: 526
Right 1077332937 11:1991266-1991288 TTCCAGGAAGGGGCCCCCGCTGG No data
1077332923_1077332943 25 Left 1077332923 11:1991234-1991256 CCCCTTCCCAGCAAGCCGGCCTG 0: 2
1: 0
2: 2
3: 31
4: 526
Right 1077332943 11:1991282-1991304 CCGCTGGCTTCCCTCAGCCCTGG No data
1077332923_1077332934 -3 Left 1077332923 11:1991234-1991256 CCCCTTCCCAGCAAGCCGGCCTG 0: 2
1: 0
2: 2
3: 31
4: 526
Right 1077332934 11:1991254-1991276 CTGCAGGTGGGCTTCCAGGAAGG 0: 2
1: 1
2: 0
3: 39
4: 330
1077332923_1077332935 -2 Left 1077332923 11:1991234-1991256 CCCCTTCCCAGCAAGCCGGCCTG 0: 2
1: 0
2: 2
3: 31
4: 526
Right 1077332935 11:1991255-1991277 TGCAGGTGGGCTTCCAGGAAGGG 0: 2
1: 1
2: 3
3: 26
4: 284

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1077332923 Original CRISPR CAGGCCGGCTTGCTGGGAAG GGG (reversed) Intergenic
900517941 1:3091992-3092014 CAGGACGGCTTCATGGGGAGGGG + Intronic
900613692 1:3554966-3554988 CAGGGCGGCTGGCAGGGGAGTGG + Intronic
901303663 1:8217310-8217332 CAGGCCAGCTTGTGGGGGAGCGG + Intergenic
901533103 1:9865946-9865968 AAGGTCGCCCTGCTGGGAAGGGG - Intronic
902040347 1:13487771-13487793 CAGGCCTGTTTGTTGGCAAGGGG - Intronic
902062658 1:13658321-13658343 CGGGGCGGCTGGCTGGGAGGGGG - Intergenic
903103542 1:21053683-21053705 CGGGGCGGCTGGCTGGGCAGAGG - Intronic
903637638 1:24833236-24833258 CGGGGCGGCTGGCTGGGCAGAGG + Intronic
903921535 1:26803863-26803885 CGGGGCGGCTGGCTGGGCAGAGG + Intergenic
903993310 1:27289106-27289128 CGGGGCGGCTGGCTGGGCAGAGG + Intronic
904795201 1:33052401-33052423 CAGGGCGGCTGGCTGGGCGGGGG - Intronic
904795332 1:33052676-33052698 CAGGGCGGCTGGCTGGGCGGGGG - Intronic
905175192 1:36130927-36130949 CTGGGGGGCTTCCTGGGAAGAGG + Intergenic
905315860 1:37081211-37081233 CAGGGCGGCTGGCCGGGCAGAGG - Intergenic
905427545 1:37896790-37896812 CAGGGCGGCTGGCCGGGCAGGGG - Intronic
905879050 1:41451642-41451664 CAGGCCTGCCTTCTGGGTAGGGG + Intergenic
906290110 1:44614303-44614325 CAGGCAGGCTCCCTGGGAGGTGG - Intronic
906367446 1:45223062-45223084 CAGGGCGGCTGGCCGGGCAGGGG - Intronic
906487191 1:46241918-46241940 CAGGGCGGCTGGCTGGGCGGGGG - Intergenic
906742060 1:48192792-48192814 CGGGGCGGCTGGCTGGGCAGAGG - Intergenic
906742137 1:48192968-48192990 CAGGGCGGCTGGCCGGGCAGAGG - Intergenic
907402617 1:54233775-54233797 CAGGGCGGCTGGCCGGGCAGGGG - Intronic
907453493 1:54561886-54561908 CGGGGCGGCTGGCTGGGCAGGGG + Intronic
908317863 1:62951599-62951621 CTGGCTGGCTGGCTGGGAAAGGG + Intergenic
909478851 1:76112142-76112164 CAGGGCGGCTGGCCGGGCAGAGG + Intronic
909478902 1:76112269-76112291 CAGGGCGGCTGGCCGGGCAGAGG + Intronic
911486608 1:98512663-98512685 CAGGGCGGCTGGCCGGGCAGAGG + Intergenic
912408927 1:109466665-109466687 CTGGCTGGCTGGCTGGGACGCGG - Exonic
912789818 1:112640102-112640124 CGGGGCGGCTGGCTGGGCAGAGG - Intronic
912789971 1:112640452-112640474 CTGGGCGGCTGGCTGGGCAGAGG - Intronic
912845164 1:113070153-113070175 CAGGGCGGCTGGCTGGGCGGGGG - Intergenic
913994117 1:143638668-143638690 CAGGGCGGCTGGCCGGGCAGGGG - Intergenic
915410944 1:155700834-155700856 CAGGGCGGCTGGCCGGGCAGAGG - Intronic
915426921 1:155834866-155834888 CGGGGCGGCTGGCTGGGCAGAGG - Intronic
915445920 1:155974937-155974959 CAGGCCGGCTGGGTTGGGAGGGG + Intronic
915502400 1:156328162-156328184 CGGGGCGGCTGGCTGGGCAGAGG - Intronic
917375749 1:174349482-174349504 CAGGGCGGCTGGCCGGGCAGAGG + Intronic
918255143 1:182741434-182741456 CAGGGCGGCTGGCCGGGCAGAGG + Intergenic
918255264 1:182741729-182741751 CAGGGCGGCTGGCTGGGCGGGGG + Intergenic
920457667 1:206113364-206113386 CAGGCCGGCATGCAGAGGAGGGG + Intronic
920660463 1:207910571-207910593 CGGAGCGGATTGCTGGGAAGGGG - Intronic
921238025 1:213151625-213151647 CGGGGCGGCTGGCTGGGCAGAGG + Intronic
921238222 1:213152080-213152102 CGGGGCGGCTGGCTGGGCAGAGG + Intronic
921446875 1:215257131-215257153 CAGGCCAGCATGCTGCCAAGTGG + Intergenic
922102833 1:222488659-222488681 CGGGGCGGCTGGCTGGGCAGAGG - Intergenic
922170927 1:223153879-223153901 CAGGCACACATGCTGGGAAGAGG - Intergenic
923568382 1:235093377-235093399 AGGGCTGCCTTGCTGGGAAGGGG - Intergenic
924824163 1:247522214-247522236 CAGGGCGGCTGGCTGGGCGGGGG - Intronic
1063577911 10:7278556-7278578 CTGCCCAGCTTGCTGGAAAGGGG - Intronic
1064663492 10:17629054-17629076 CGGGGCGGCTGGCTGGGCAGAGG + Intergenic
1065324493 10:24538777-24538799 CAGGCTGGATTGCTGTGACGTGG + Intronic
1065594216 10:27296215-27296237 CAGGGCGGCTGGCCGGGCAGAGG + Intergenic
1065594314 10:27296440-27296462 CGGGGCGTCTTGCTGGGCAGAGG + Intergenic
1066533737 10:36367561-36367583 CAGGCAGGCAGGCTTGGAAGAGG + Intergenic
1067026556 10:42847675-42847697 CGGGGCGGCTGGCTGGGCAGAGG - Intergenic
1068668067 10:59697071-59697093 CAGGGCGGCTGGCGGGGCAGAGG - Intronic
1069570771 10:69493104-69493126 CAGGCCAGCTGGCTGGGGTGTGG - Intronic
1069625376 10:69864739-69864761 ATGGCCGCCTTGCTCGGAAGAGG + Intronic
1069632347 10:69904571-69904593 AAGGCCGGCTTTCTAGGGAGGGG + Intronic
1070317956 10:75333308-75333330 CGGGGCGGCTGGCTGGGCAGAGG + Intergenic
1070704258 10:78626365-78626387 CACTCCAGCTTGCTGGAAAGGGG + Intergenic
1070802896 10:79254156-79254178 CAGCAGGGCTTGCTAGGAAGCGG - Intronic
1070966773 10:80534903-80534925 CAGGGCGGCTGGCTGGGCGGGGG - Intergenic
1071082103 10:81824844-81824866 CAGGCCCACTTGTTGGGATGTGG - Intergenic
1071509230 10:86250734-86250756 CAGACCGGGTGGCTGGGCAGAGG - Intronic
1071616705 10:87081335-87081357 CAGGGCGGCTGGCTGGGTGGGGG - Intronic
1072013359 10:91323241-91323263 CGGGGCGGCTGGCTGGGCAGAGG + Intergenic
1072116976 10:92376027-92376049 CAGGGCGGCTGGCTGGGCGGGGG - Intergenic
1072117135 10:92376386-92376408 CAGGGCGGCTGGCTGGGCGGGGG - Intergenic
1072149596 10:92674514-92674536 CAGGGCGGCTGGCTGGGCGGGGG + Intergenic
1072772473 10:98152956-98152978 CAGGGCGGCTGGCTGGGTGGGGG - Intronic
1072807108 10:98430544-98430566 CAGGGCAGCTTTCTGGGCAGAGG - Intronic
1072949594 10:99838757-99838779 CAGGGCGGCTGGCTGGGCGGGGG + Intronic
1072949861 10:99839340-99839362 CAGGGCGGCTGGCTGGGCGGGGG + Intronic
1072999990 10:100277972-100277994 CAGGGCGGCTGGCCGGGCAGAGG - Intronic
1073386471 10:103129843-103129865 CAGGGCGGCTGGCCGGGCAGAGG - Intronic
1073900480 10:108215177-108215199 CATGCAGGCTGGCAGGGAAGTGG + Intergenic
1074062749 10:109982396-109982418 CAGGCTGTTTTCCTGGGAAGTGG - Intergenic
1074588078 10:114787494-114787516 CAGGGCGGCTGGCCGGGCAGAGG - Intergenic
1075659142 10:124181372-124181394 CAGGACTGCTTGCTGGTAACAGG - Intergenic
1076405428 10:130209176-130209198 CAGGCCTGATTCCTGGGAAGAGG + Intergenic
1076611890 10:131731289-131731311 CTGGCAAGCTTGCAGGGAAGGGG + Intergenic
1077242097 11:1515945-1515967 CAGGCCGTCTGGCTGATAAGTGG - Intergenic
1077332923 11:1991234-1991256 CAGGCCGGCTTGCTGGGAAGGGG - Intergenic
1077365242 11:2158941-2158963 CAGCCCTGCTTACTGGGAGGGGG + Intronic
1078447475 11:11415313-11415335 CAGCCCTGATTCCTGGGAAGTGG - Intronic
1079043172 11:17077581-17077603 CAAGCCGGATTGCTGGGCGGGGG - Intronic
1080098291 11:28430992-28431014 CAGGGCGGCTGGCCGGGCAGAGG - Intergenic
1082632920 11:55561888-55561910 CAGTCCAGCTTGTTGGGAAGTGG - Intergenic
1083262600 11:61531313-61531335 CAGGCAAGCTGGCTGGGAAGGGG + Intronic
1083310853 11:61783006-61783028 CAGGCTGGCTGGCTGGGTAGGGG - Intronic
1083832160 11:65239691-65239713 CGGGGCGGCTGGCTGGGCAGGGG - Intergenic
1084122478 11:67077669-67077691 CAGGCAGGCGTGCAGTGAAGAGG - Intergenic
1084585629 11:70060253-70060275 CAGTTCGGCTTGTTGGGAAGTGG + Intergenic
1085513045 11:77098125-77098147 CGGGGCGGCTGGCTGGGCAGAGG + Intronic
1085754543 11:79192055-79192077 CGGGACGGCTGGCTGGGCAGAGG - Intronic
1086243288 11:84721129-84721151 GAGGCCGACTTCCCGGGAAGGGG + Intronic
1086366307 11:86111289-86111311 CGGGGCGGCTGGCTGGGCAGAGG - Intergenic
1086366382 11:86111465-86111487 CGGGGCGGCTGGCTGGGCAGAGG - Intergenic
1086799968 11:91160790-91160812 CAGGCTGACTTAATGGGAAGTGG - Intergenic
1086881649 11:92158074-92158096 CGGGGCGGCTGGCTGGGCAGAGG - Intergenic
1087057160 11:93946919-93946941 CAGGGCGGCTGGCTGGGCGGGGG + Intergenic
1087118397 11:94546624-94546646 CAGACTGGTTTTCTGGGAAGAGG - Exonic
1089198847 11:116711267-116711289 GAGGCCGGCCTGTGGGGAAGGGG - Intergenic
1089420817 11:118331213-118331235 CAGGGCGGCTGGCCGGGCAGAGG + Intergenic
1089420914 11:118331438-118331460 CAGGGCGGCTGGCCGGGCAGAGG + Intergenic
1089420988 11:118331613-118331635 CAGGGCGGCTGGCCGGGCAGAGG + Intergenic
1090323240 11:125863751-125863773 CAGGGCGGCTGGCCGGGCAGGGG - Intergenic
1090906895 11:131084348-131084370 CGGGGCGGCTGGCTGGGCAGAGG + Intergenic
1202815906 11_KI270721v1_random:46410-46432 CAGGCCGGCTTGCTGGGAAGGGG - Intergenic
1091378761 12:42515-42537 CGGGGCGGCTGGCTGGGCAGAGG - Intergenic
1091591802 12:1846814-1846836 AAGGCTGGGTTCCTGGGAAGGGG + Intronic
1092331328 12:7589958-7589980 CGGGGCGGCTGGCTGGGAGGGGG + Intergenic
1092401987 12:8184691-8184713 CGGGCCGGCTGGCTGGGCAGAGG - Intronic
1092402006 12:8184740-8184762 CGGGGCGGCTGGCTGGGCAGGGG - Intronic
1092827746 12:12414458-12414480 CGGGGCGGCTGGCTGGGCAGAGG + Intronic
1093302624 12:17474393-17474415 CAGTTCGGCTTGTTAGGAAGTGG - Intergenic
1093710296 12:22321909-22321931 GAGGCAGGCTGGCTTGGAAGGGG - Intronic
1094103466 12:26785617-26785639 CGGGGCGGCTGGCTGGGCAGGGG - Intronic
1094541873 12:31369513-31369535 TGGGCCAGCTTGCTGGGAAGCGG + Intergenic
1096021982 12:48332439-48332461 CAGGGCGGCTGGCTGGGCGGGGG + Intergenic
1096167450 12:49436759-49436781 CAGGGCGGCTGGCCGGGCAGAGG + Intronic
1096441177 12:51645167-51645189 CAGGGCGGCTGGCCGGGCAGAGG - Intronic
1098019116 12:66135144-66135166 CAGGGCGGCTGGCTGGGCAGGGG - Intronic
1098883999 12:75942452-75942474 CGGGGCGGCTGGCTGGGCAGAGG - Intergenic
1100027189 12:90145078-90145100 CAGGCATGCTGGCTGGCAAGAGG + Intergenic
1100136278 12:91557078-91557100 CTGTCCAGCTTGCTGGGAGGAGG + Intergenic
1102254518 12:111407742-111407764 CAGAGCGGCCAGCTGGGAAGGGG + Intronic
1103234420 12:119360190-119360212 CAGGGCGGCTGGCTGGGCAGAGG + Intronic
1103457198 12:121076513-121076535 CGGGGCGGCTGGCTGGGCAGAGG - Intergenic
1103513373 12:121490432-121490454 CAGGCTGGCTTGCTAGCCAGAGG + Intronic
1103641808 12:122357699-122357721 CGGGGCGGCTGGCTGGGCAGGGG - Intronic
1105367937 13:19779746-19779768 CGGGCCGGCTGGCTGGGCGGAGG - Intronic
1105429880 13:20326775-20326797 CAGGCAGCCTTACTGGGAATAGG - Intergenic
1106400871 13:29428819-29428841 CCGGCAGGCTGGCTGGCAAGGGG - Intronic
1106746948 13:32716805-32716827 CAGGGCGGCTGGCCGGGCAGGGG - Intronic
1106918664 13:34540852-34540874 CAGGGCGGCTGGCTGGGCGGGGG - Intergenic
1107560284 13:41551847-41551869 GAGGCAGGTTTGCTGGGAGGAGG - Intergenic
1107953281 13:45485306-45485328 CAGGGCAGCTGGCTGGGCAGAGG + Intronic
1108330439 13:49378677-49378699 CGGGGCGGCTGGCTGGGCAGAGG - Intronic
1110922216 13:81102398-81102420 CAGGGCGGCTGGCCGGGCAGGGG - Intergenic
1114174912 14:20310438-20310460 CGGGGCGGCTGGCTGGGCAGAGG - Intergenic
1114174962 14:20310565-20310587 CGGGGCGGCTGGCTGGGCAGAGG - Intergenic
1114567860 14:23645669-23645691 CAGGGCAGCATGGTGGGAAGAGG + Intergenic
1115480735 14:33858708-33858730 CAGGGCAGCTTGCTAAGAAGGGG - Intergenic
1115609875 14:35039468-35039490 CAGGGCGGCTGGCTGGGCGGGGG - Intergenic
1115847572 14:37555492-37555514 CAGGGCGGCTGGCCGGGCAGGGG + Intergenic
1116480673 14:45389962-45389984 CAGGGCGGCTGGCTGGGCGGGGG - Intergenic
1117277254 14:54203889-54203911 CGGGGCGGCTGGCTGGGCAGAGG - Intergenic
1118148768 14:63166060-63166082 CGGGGCGGCTGGCTGGGCAGAGG - Intergenic
1119700420 14:76750712-76750734 CAGGGCGGCTGGCTGGGCAGAGG - Intergenic
1121406255 14:93721004-93721026 CAGGCAGGCTTCCTGGGAGGAGG + Exonic
1122097359 14:99381564-99381586 TAGGCTGGCTTGCAGGGAAGGGG - Intergenic
1122800433 14:104226705-104226727 GAGCCCGGCTATCTGGGAAGTGG - Intergenic
1122959661 14:105088554-105088576 CAGGCAGGCTGCCTGGGAGGGGG - Intergenic
1123035514 14:105470265-105470287 GCGGCGGGCTGGCTGGGAAGGGG - Exonic
1125017017 15:34946849-34946871 CGGGGCGGCTGGCTGGGCAGAGG - Intronic
1125521332 15:40349336-40349358 CAGGGCGGCCTACTGGGGAGGGG - Intergenic
1125554039 15:40569553-40569575 GAAGCCGGCTGGCCGGGAAGTGG + Exonic
1126704079 15:51391632-51391654 CAGGCCATCTTGGTGGAAAGTGG - Intronic
1127073319 15:55303851-55303873 CGGGCCGGCTGGCTGGGCAGGGG - Intronic
1127154172 15:56110054-56110076 CGGGGCGGCTGGCTGGGCAGAGG - Intronic
1127782938 15:62332407-62332429 CAGGGCGGCTGGCTGGGCGGGGG + Intergenic
1128489631 15:68134389-68134411 CAGGGCGGCTGGCCGGGCAGAGG + Intronic
1128537327 15:68500973-68500995 CAGGCCAGCCTGCTGGGAGCAGG - Intergenic
1128597419 15:68964584-68964606 CAGGGCGGCTGGCCGGGCAGGGG + Intronic
1129054037 15:72806981-72807003 CGGGGCGGCTGGCTGGGCAGAGG + Intergenic
1129428587 15:75481716-75481738 CAGGGCGGCTGGCTGGGCGGGGG - Intronic
1129464508 15:75716405-75716427 AAAGCCAGCTTGCTGGGAAATGG + Intergenic
1129720739 15:77876607-77876629 AAAGCCAGCTTGCTGGGAAATGG - Intergenic
1129874775 15:78966700-78966722 CAGGCCTGGTGGCTGAGAAGGGG - Intronic
1130411686 15:83653678-83653700 CAGGCTGGCTTGCGGCGCAGCGG + Intergenic
1131125493 15:89854584-89854606 CAGGGCGGCTGGCTGGGCGGGGG - Intronic
1132081042 15:98865762-98865784 CATGCTGCCTCGCTGGGAAGTGG + Intronic
1132204613 15:99977856-99977878 CTGGCTGTCTTCCTGGGAAGAGG - Intronic
1132300754 15:100774192-100774214 CAGGGCGGCTGGCTGGGCAGGGG + Intergenic
1132560921 16:593457-593479 CAGGGCTGCCTGCTGGGCAGTGG + Intronic
1132749843 16:1452496-1452518 CAGGCTGCCATTCTGGGAAGAGG + Intronic
1132752546 16:1465464-1465486 CAGGCCTGCCTGCTGGGTGGGGG + Intronic
1132845279 16:1998361-1998383 CAGGCCCGCCTGCTGGGTGGTGG + Exonic
1133058287 16:3158395-3158417 CGGGCTGGCCTGCTGGGAGGCGG + Intergenic
1134688473 16:16175199-16175221 CAGGGTGGCTAGCTGGGATGGGG + Intronic
1135403720 16:22183548-22183570 CAGCCAGGCTTGCCTGGAAGGGG + Intronic
1135970892 16:27071071-27071093 CAGGCCAAGTTGCTGGGAGGAGG - Intergenic
1136294117 16:29292010-29292032 CAGGCCTGCTGCCTGGGCAGGGG - Intergenic
1136572375 16:31105022-31105044 CGGGGCGGCTGGCTGGGCAGAGG - Intergenic
1136633981 16:31507820-31507842 CAGGCAGTCTTGCTGGGCATAGG - Exonic
1137012769 16:35339966-35339988 CAGGTGGGCCTGGTGGGAAGTGG - Intergenic
1137275328 16:46929650-46929672 CTGGCTGCGTTGCTGGGAAGCGG - Exonic
1137283927 16:47000417-47000439 CGGGGCGGCTGGCTGGGCAGAGG - Intergenic
1137555901 16:49470269-49470291 CAGGGCGCCCTGCTGGAAAGAGG - Intergenic
1137618027 16:49858277-49858299 CTGGCCGGCAGGCTGGGGAGCGG - Intergenic
1138334205 16:56239863-56239885 TAGGCCTGGTTGCTGGGCAGAGG + Intronic
1138467141 16:57200815-57200837 CGGGGCGGCTGGCTGGGCAGAGG + Intronic
1138642144 16:58395986-58396008 CAGGGCGGCTGGCTGGGCAGAGG + Intronic
1138642318 16:58396416-58396438 CGGGGCGGCTGGCTGGGCAGAGG + Intronic
1138642485 16:58396788-58396810 CAGGGCGGCTGGCCGGGCAGAGG + Intronic
1139639239 16:68278960-68278982 CAGGGCGGCTGGCCGGGCAGGGG + Intronic
1139864395 16:70051595-70051617 CGGGGCGGCTGGCTGGGCAGAGG - Intergenic
1140212333 16:72980258-72980280 CAGGCTGGCTGGATGGGTAGGGG + Intronic
1141139433 16:81487481-81487503 CGGGCCGGCTTGGCGGGAATGGG + Intronic
1142007030 16:87694202-87694224 CAGGGTGGCGGGCTGGGAAGGGG + Intronic
1142100020 16:88266056-88266078 CAGGCCTGCTGCCTGGGCAGGGG - Intergenic
1142223245 16:88865460-88865482 CAGGCAGCCTTGCTGGGAAGGGG - Intronic
1142401068 16:89859018-89859040 GAGGCGGGCAGGCTGGGAAGTGG + Intronic
1143104306 17:4520697-4520719 CAGACTGCCATGCTGGGAAGGGG - Intronic
1144375483 17:14635833-14635855 CAGGATGGATTGATGGGAAGTGG - Intergenic
1145174239 17:20685429-20685451 CAGGGCGGCTGGCCGGGCAGAGG - Intergenic
1145206039 17:20985080-20985102 CAGGGCGGCTGGCTGGGCGGGGG - Intergenic
1145717287 17:27034165-27034187 CGGGGCGGCTGGCTGGGCAGAGG - Intergenic
1145996970 17:29110402-29110424 CAGGCCTGCCTGCTGGGACCCGG + Intronic
1146003257 17:29144304-29144326 GAGCCAGGCTGGCTGGGAAGAGG - Intronic
1146626539 17:34439457-34439479 CTGGCAGGCTTGTTGGGAGGAGG + Intergenic
1147172878 17:38631609-38631631 CAGGGCGGCTGGCCGGGCAGAGG - Intergenic
1147387783 17:40092022-40092044 GAGGACGGGTTGCTGGGAATAGG + Intronic
1147446574 17:40478514-40478536 CAGGACGCCTTGGTGGGCAGCGG + Intronic
1147686405 17:42289010-42289032 CGGGCCCGGTTTCTGGGAAGGGG - Intronic
1147963531 17:44181018-44181040 CAGGGCGGCTGGCCGGGCAGAGG - Intergenic
1147974368 17:44238650-44238672 CAGGGCGGCTGGCTGGGCGGGGG - Intergenic
1148243020 17:46012568-46012590 AGGGCCAGCCTGCTGGGAAGGGG - Intronic
1148406547 17:47420952-47420974 CGGGGCGGCTGGCTGGGCAGAGG - Intronic
1148816037 17:50329001-50329023 CAGGGAGGCTTGCTGGGCACAGG - Intergenic
1150214062 17:63456940-63456962 CAGGGCGGCTGGCCGGGCAGGGG - Intergenic
1151172135 17:72255705-72255727 CATGACTGCTTGCTGAGAAGCGG + Intergenic
1151208791 17:72528359-72528381 CAGGGTGGCATGCAGGGAAGAGG - Intergenic
1151714310 17:75823658-75823680 AAGGCCGGCCTGCTGGGAATGGG + Intronic
1151945868 17:77319590-77319612 CAGGCCAGCGTGCTGAGAAAAGG - Intronic
1152487283 17:80602348-80602370 CGGGGCGGCTGGCTGGGCAGGGG + Intronic
1152695823 17:81794620-81794642 CTGGACGGCTGGCTGGGGAGAGG - Intergenic
1152728002 17:81957095-81957117 GAGGCCAGGTGGCTGGGAAGAGG + Intronic
1152777231 17:82210208-82210230 CAGGCTGGCTTGCAGGGGCGCGG - Intronic
1152928571 17:83098984-83099006 CAGGCCGGCGTGGTGGGAATTGG + Intergenic
1152944294 17:83190748-83190770 CTGGGGGGCTTGGTGGGAAGGGG - Intergenic
1153498923 18:5728735-5728757 CCAGCAGGCTTGCTGTGAAGGGG - Intergenic
1153651389 18:7243545-7243567 CAGGGTGTCTTGCTGGCAAGCGG + Intergenic
1153958904 18:10123746-10123768 CAGGCCAGCAAGCTGGGCAGGGG - Intergenic
1154406540 18:14096881-14096903 TATTCCGACTTGCTGGGAAGTGG + Intronic
1157444345 18:47733526-47733548 CAGGCTGGGATGCTGGGAAGCGG + Intergenic
1157629188 18:49080010-49080032 CGGGGCGGCTGGCTGGGCAGAGG + Intronic
1159965707 18:74594081-74594103 CAGAGTGGCTTGCTGGGAGGAGG - Intergenic
1160527644 18:79546850-79546872 CAGCCCAGCCTGCTGGGGAGTGG - Intergenic
1160765745 19:806863-806885 CAGGCCGCCCTGCTGGTCAGCGG + Intronic
1160778955 19:869337-869359 CAGGCCGGGTGTCTGGGCAGAGG - Intronic
1161154049 19:2723122-2723144 CAGGCAGGCGGACTGGGAAGGGG - Intronic
1161270100 19:3385037-3385059 CAGGCCTGCCTGCTGAGCAGAGG - Intronic
1161358173 19:3831376-3831398 CTCGGCAGCTTGCTGGGAAGCGG + Exonic
1163164700 19:15487902-15487924 CAGGCGGGCTGGCTCGGCAGGGG - Intronic
1163462530 19:17447805-17447827 CAGGCTGTCTGGCTTGGAAGTGG - Intronic
1163542317 19:17918607-17918629 CGGGGCGGCTGGCTGGGCAGAGG - Intergenic
1163945308 19:20530014-20530036 CAGGGCGGCTGGCCGGGCAGGGG + Intergenic
1164652482 19:29899576-29899598 CAGGGCGGCTGGCTGGGCGGGGG + Intergenic
1164653078 19:29900916-29900938 CAGGGCGGCTGGCTGGGCGGGGG + Intergenic
1165199437 19:34132787-34132809 CGGGGCGGCTGGCTGGGCAGAGG - Intergenic
1165225610 19:34352698-34352720 CTGGGCAGCGTGCTGGGAAGCGG - Exonic
1165481810 19:36069006-36069028 CGGGCCGGCTGGCTGGGCAGGGG + Intronic
1165727582 19:38123870-38123892 CAGGGCGGCTGGCCGGGCAGAGG + Intronic
1165842570 19:38797830-38797852 CGGGGCGGCTGGCTGGGCAGGGG + Intergenic
1166162697 19:40965638-40965660 CTGGGCGGCTTGCCGGGCAGAGG + Intergenic
1166162978 19:40966291-40966313 CGGGGCGGCTGGCCGGGAAGAGG + Intergenic
1166180092 19:41102943-41102965 CAGGGCGGCTGGCCGGGCAGAGG - Intergenic
1166180143 19:41103070-41103092 CAGGGCGGCTGGCCGGGCAGAGG - Intergenic
1166180351 19:41103526-41103548 CGGGGCGGCTGGCTGGGCAGAGG - Intergenic
1166191806 19:41180748-41180770 CAGGGCGGCTGGCCGGGCAGGGG - Intergenic
1166197701 19:41217858-41217880 CAGACGGGGGTGCTGGGAAGGGG + Intergenic
1166261684 19:41645021-41645043 CAGGGCGGCTGGCTGGGCGGGGG - Intronic
1166549620 19:43656632-43656654 CAGCCCGGCCTGTTTGGAAGAGG + Exonic
1166806486 19:45490416-45490438 CAGCCCTGCTTGCGGTGAAGGGG - Intronic
1167303937 19:48696267-48696289 GAGGGCGGCTGGCTGGGGAGGGG - Intronic
1167593763 19:50417303-50417325 CAGGCCTGGGAGCTGGGAAGGGG - Intronic
1168226525 19:54999119-54999141 CAGGGCGGCTGGCTGGGCGGGGG + Intronic
1168696345 19:58405985-58406007 CAAGGCGGGTTGCTGGGAGGTGG + Intronic
925187554 2:1859753-1859775 CAGGGCGGCTGGATGGGACGTGG - Intronic
925403437 2:3590980-3591002 CGGGGCGGCTGGCTGGGCAGAGG + Intergenic
926107255 2:10160193-10160215 CAGGAAGGCTTCCTGGAAAGGGG - Intronic
926674959 2:15611989-15612011 CAGGGCGGCTGGCCGGGCAGAGG + Intronic
927737398 2:25535488-25535510 CAGACAGGGTTGCTGGGCAGAGG + Intronic
927747317 2:25634199-25634221 CAGGGCGGCTGGCCGGGCAGAGG - Intronic
928086836 2:28351193-28351215 CAGGTAAGCCTGCTGGGAAGAGG - Intergenic
928134987 2:28681413-28681435 CAGGCCTGCTTGCTGGGGCGTGG - Intergenic
928542091 2:32293968-32293990 CGGGGCGGCTGGCTGGGCAGGGG + Intronic
928542110 2:32294017-32294039 CAGGGCGGCTGGCCGGGCAGAGG + Intronic
929515900 2:42605416-42605438 CGGGGCGGCTGGCTGGGCAGAGG + Intronic
929690206 2:44067277-44067299 CAGGGCGGCTGGCTGGGCGGGGG + Intergenic
930063124 2:47307421-47307443 CAGGCAGGCTTGCAGGGAGATGG - Intergenic
930105057 2:47632941-47632963 CAGGCTGGCTCCCTTGGAAGTGG - Intergenic
930208752 2:48614489-48614511 CGGGGCGGCTGGCTGGGCAGAGG + Intronic
931655980 2:64511619-64511641 CAGGGCGGCTGGCCGGGCAGAGG + Intergenic
932710768 2:74061493-74061515 CGGGGCGGCTGGCTGGGCAGAGG + Intronic
933869210 2:86549816-86549838 CAGGCGGGGTGGCCGGGAAGAGG + Intronic
934141628 2:89052782-89052804 CAGTTTGGCTTGTTGGGAAGTGG - Intergenic
934227616 2:90147764-90147786 CAGTTTGGCTTGTTGGGAAGTGG + Intergenic
934998527 2:98988923-98988945 CAGGGCGGCTGGCTGGGCGGGGG + Intergenic
935188234 2:100753644-100753666 CTGCCTGGCTTGCTGGTAAGAGG + Intergenic
935825866 2:106948634-106948656 CAGGCTTGCTTGATGTGAAGTGG + Intergenic
936546535 2:113395266-113395288 CAGGGCGGCTGGCTGGGCGGGGG - Intergenic
937325447 2:120987397-120987419 CATGCGGGGCTGCTGGGAAGGGG - Intronic
938534114 2:132221880-132221902 CGGGGCGGCTGGCTGGGCAGGGG - Intronic
938828811 2:135033268-135033290 CAGGGCGGCTGGCCGGGCAGAGG + Intronic
938888862 2:135682270-135682292 TAGGCCTGCCTACTGGGAAGAGG + Intronic
939584713 2:143991650-143991672 CGGGGCGGCTGGCTGGGCAGAGG - Intronic
939665755 2:144949614-144949636 CAGGCCATATTGGTGGGAAGTGG - Intergenic
940643319 2:156368521-156368543 CAGGGCGGCTGGCCGGGCAGAGG - Intergenic
940643698 2:156369341-156369363 CAGGGCGGCTGGCCGGGCAGAGG - Intergenic
941769094 2:169327846-169327868 CGGGGCGGCTGGCTGGGCAGAGG - Intronic
941769200 2:169328074-169328096 CAGGGCGGCTGGCTGGGCGGGGG - Intronic
943773431 2:191742107-191742129 CGGGGCGGCTGGCTGGGCAGGGG - Intergenic
943773499 2:191742250-191742272 CGGGGCGGCTGGCTGGGCAGGGG - Intergenic
944255387 2:197619020-197619042 CAGGGCGGCTGGCCGGGCAGGGG - Intronic
944283285 2:197922675-197922697 CGGGGCGGCTGGCTGGGCAGAGG + Intronic
944625269 2:201563216-201563238 CTGGGCGGCTGGCTGGGCAGAGG + Intronic
945090298 2:206171618-206171640 CGGGGCGGCTGGCTGGGCAGAGG + Intergenic
946156141 2:217808035-217808057 AAGGCCAGCCTGCTGGGCAGGGG + Intronic
946318252 2:218931861-218931883 CAGGGCGGCTGGCCGGGCAGGGG - Intergenic
946742706 2:222816655-222816677 CAGGGCGGCTGGCCGGGCAGAGG - Intergenic
946872402 2:224096318-224096340 CAGGCAGGCTAGGTGGGCAGAGG + Intergenic
947212128 2:227718018-227718040 CAGGCGCTCTTGGTGGGAAGGGG + Intergenic
947748955 2:232523046-232523068 CAGGCCCGTCTGCAGGGAAGGGG - Exonic
947774647 2:232697737-232697759 CAGGCCGGCTTGCTCGGAGCTGG + Intronic
947838087 2:233189487-233189509 AAGGCAGGCTGGCGGGGAAGTGG - Intronic
947838120 2:233189575-233189597 CAGGCCTTCTTGCTGGGACCTGG + Intronic
948037892 2:234873889-234873911 GAGGCAGGCTGGCGGGGAAGGGG + Intergenic
1169086124 20:2824954-2824976 CAGGGCGGCTGGCCGGGCAGAGG - Intergenic
1169825625 20:9765639-9765661 GAGGGCGGCTTGATGGGAGGAGG - Intronic
1169914773 20:10674024-10674046 CTGCCCGGCGTGCTGGGTAGAGG - Exonic
1170645774 20:18194764-18194786 CAGGGCGGCTGGCCGGGCAGAGG - Intergenic
1171366053 20:24626067-24626089 CAGGGTGGCTGGCTGGGCAGAGG + Intronic
1171861484 20:30405620-30405642 CAGGGCGGCTGGCCGGGCAGAGG - Intergenic
1171861551 20:30405796-30405818 CAGGGCGGCTGGCCGGGCAGAGG - Intergenic
1171957100 20:31470681-31470703 CAGGGCGGCTGGCTGGGCGGGGG + Intronic
1172465754 20:35154119-35154141 CGGGGCGGCTGGCTGGGCAGGGG - Intergenic
1172468913 20:35176465-35176487 CAGGCCTGCAAGCTGGGGAGAGG + Intronic
1172574964 20:36001392-36001414 CAGGGCGGCTGGCCGGGCAGAGG + Intronic
1172717526 20:36976333-36976355 CAGGGCGGCTGGCCGGGCAGGGG + Intergenic
1173769522 20:45645802-45645824 CAGGGCGGCTGGCCGGGCAGAGG + Intergenic
1173908749 20:46648465-46648487 CAGGCCTGCCTCCTGGGAGGAGG + Intronic
1174218583 20:48935748-48935770 CAGGGCGGCTGGCTGGGCGGGGG + Intronic
1174404758 20:50295999-50296021 CAGGCGGGCAGGCTGGGGAGAGG + Intergenic
1174411495 20:50339575-50339597 GAGGCTGGATTGCTGGGAGGGGG - Intergenic
1174878325 20:54250539-54250561 CAGGGCGGCTGGCCGGGCAGAGG + Intergenic
1176364816 21:6026462-6026484 GGGGCCAGCTTGCTGGGATGTGG - Intergenic
1176380469 21:6110279-6110301 CAGGCCGGCCGCCTGGGTAGGGG - Intergenic
1176384855 21:6134225-6134247 CAGGCGGGCTTGCAGGGTGGTGG - Intergenic
1177062737 21:16394976-16394998 CAGTTTGGCTTGTTGGGAAGTGG + Intergenic
1178706172 21:34874963-34874985 CAAGCCGGCTGGCAAGGAAGGGG + Intronic
1178948261 21:36966218-36966240 CCGCCCGGCTGGCCGGGAAGAGG + Intronic
1179738617 21:43404027-43404049 CAGGCGGGCTTGCAGGGTGGTGG + Intergenic
1179743003 21:43427961-43427983 CAGGCCGGCCGCCTGGGTAGGGG + Intergenic
1179758702 21:43512083-43512105 GGGGCCAGCTTGCTGGGATGTGG + Intergenic
1179834987 21:44025156-44025178 CAGGGCGGGTTGCTGGGCTGAGG + Intronic
1179876666 21:44272293-44272315 AAGGCAGGCCTGCTGGGCAGAGG + Intergenic
1180830024 22:18900399-18900421 CGGGGCGGCTGGCTGGGCAGAGG + Intergenic
1180871782 22:19150533-19150555 CAGGGCGACCTGCGGGGAAGGGG + Intergenic
1180961315 22:19763642-19763664 CAGGCCGGCCTCCTGGGAGAGGG - Intronic
1181015620 22:20066824-20066846 CAGGCCGGGTCTCTGGGCAGAGG - Intergenic
1181538641 22:23561181-23561203 CGGGGCGGCTGGCTGGGCAGGGG + Intergenic
1181657785 22:24317160-24317182 CGGGGCGGCTGGCTGGGCAGAGG + Intronic
1181657915 22:24317460-24317482 CGGGGCGGCTGGCTGGGCAGGGG + Intronic
1182398943 22:30059801-30059823 CGGGGCGGCTGGCTGGGCAGGGG - Intergenic
1182616177 22:31591673-31591695 CGGGGCGGCTGGCTGGGCAGAGG + Intronic
1182735161 22:32528234-32528256 CGGGGCTGCTGGCTGGGAAGGGG - Intronic
1183052415 22:35274401-35274423 CAGGCTGGCCTTCTAGGAAGGGG + Intronic
1183841299 22:40501704-40501726 CAGGGCGGCTGGCCGGGCAGAGG + Intronic
1184232733 22:43167423-43167445 AAGGCGGGCTTGCTGGGTGGTGG + Exonic
1185299415 22:50071858-50071880 CAGCCCGGCCTGCTGGGGAGGGG + Intronic
1203280115 22_KI270734v1_random:125670-125692 CGGGGCGGCTGGCTGGGCAGAGG + Intergenic
950073986 3:10174196-10174218 CAGGCCAGATTGCTGGTCAGTGG - Intronic
950253609 3:11487489-11487511 CAGGGCGGCTGGCCGGGCAGAGG + Intronic
950630126 3:14276705-14276727 CCGGCCCGATGGCTGGGAAGGGG + Intergenic
951550471 3:23871412-23871434 CAGGGCGGCTGGCCGGGCAGAGG + Intronic
953019259 3:39103518-39103540 CAGGCCCGCCTGCTGGGCTGGGG + Exonic
953715691 3:45315243-45315265 CAGGCAGGTCTGCTGGGGAGTGG + Intergenic
953909498 3:46884497-46884519 GGGGCCCACTTGCTGGGAAGGGG + Intronic
954399426 3:50311744-50311766 CGGGGCGGCTGGCTGGGCAGAGG + Intronic
954481273 3:50803769-50803791 CAGGGCGGCTGGCTGGGCGGGGG + Intronic
954952919 3:54490801-54490823 GAAGCGGGGTTGCTGGGAAGGGG + Intronic
955362799 3:58289841-58289863 CAGGGCGGCTGGCCGGGTAGGGG + Intronic
955362947 3:58290193-58290215 CGGGGCGGCTGGCTGGGCAGAGG + Intronic
955434743 3:58890158-58890180 CGGGGCGGCTGGCTGGGCAGGGG + Intronic
955856495 3:63278568-63278590 CAGGGCGGCTGGCTGGGAGCAGG + Intronic
955933798 3:64083117-64083139 CAGAACGAATTGCTGGGAAGAGG + Intergenic
956270640 3:67444602-67444624 CAGGGCGGCTGGCCGGGCAGAGG - Intronic
956691011 3:71877595-71877617 GACCCAGGCTTGCTGGGAAGGGG + Intergenic
957620254 3:82584940-82584962 CAGGGCGGCTGGCCGGGCAGGGG - Intergenic
958560770 3:95744818-95744840 TAGGGCGGCTGGCTGGGCAGGGG + Intergenic
959415514 3:106074426-106074448 CAGGGCGGCTGGCCGGGCAGAGG + Intergenic
961704476 3:128773480-128773502 CGGGTCGGCTTGCTGGGCGGGGG - Intronic
966015053 3:175131748-175131770 CAGGGCGGCTGGCCGGGCAGGGG + Intronic
966015353 3:175132459-175132481 CGGGGCGGCTGGCTGGGCAGAGG + Intronic
966420024 3:179727771-179727793 CGGGGCGGCTGGCTGGGCAGGGG + Intronic
967169315 3:186811529-186811551 CAGGGCGGCTGGCCGGGCAGAGG + Intergenic
967177605 3:186874275-186874297 CGGGGCGGCTGGCTGGGCAGAGG - Intergenic
967857706 3:194130869-194130891 CAGGTGGGGGTGCTGGGAAGGGG - Intergenic
968967056 4:3774025-3774047 GAGGCCGGCGTGCTGGGAGCTGG + Intergenic
969584762 4:8085259-8085281 CTGGCCAGCTTGCTGGGCCGGGG - Intronic
969878957 4:10157287-10157309 CAGCCTGGCTTCCTGGGAAAAGG + Intergenic
973784949 4:54325449-54325471 CAGGGCGGCTGGCTGGGCGGGGG + Intergenic
975685827 4:76917442-76917464 CGGGGCGGCTGGCTGGGCAGAGG - Intergenic
979622434 4:122812153-122812175 CAAGGCGGCTGGCTGGGCAGGGG - Intergenic
979622481 4:122812280-122812302 CAAGGCGGCTGGCTGGGCAGGGG - Intergenic
980895226 4:138854429-138854451 CAGGGCGGCTGGCTGGGCAGAGG - Intergenic
981750989 4:148092169-148092191 CAGGAAGGCCTGCGGGGAAGAGG - Intronic
982653472 4:158117294-158117316 CAGCCCGGGTTTCTGGGAAAAGG + Intergenic
984533465 4:180944872-180944894 CGGGGCGGCTGGCTGGGCAGGGG - Intergenic
984533671 4:180945325-180945347 CAGGGCGGCTGGCCGGGCAGGGG - Intergenic
984977140 4:185240548-185240570 CAGGGCGGCTGGCCGGGCAGAGG + Intronic
985723684 5:1504364-1504386 CAGGGCCACTGGCTGGGAAGAGG + Intronic
988240043 5:28596971-28596993 CAGGGCGGCTGGCTGGGCGGGGG + Intergenic
989587700 5:43087622-43087644 CGGGGCGGCTGGCTGGGCAGAGG + Intronic
989634914 5:43522418-43522440 CGGGGCGGCTGGCTGGGCAGAGG - Intergenic
990426776 5:55696196-55696218 CGGGGCGGCTGGCTGGGCAGAGG + Intronic
990458876 5:56014625-56014647 CGGGGCGGCTGGCTGGGCAGAGG + Intergenic
991723528 5:69515384-69515406 CAGGGCGGCTGGCCGGGCAGGGG + Intronic
992374062 5:76172076-76172098 CAGGGCGGCTGGCCGGGCAGAGG - Intronic
992374162 5:76172306-76172328 CAGGGCGGCTGGCTGGGCGGGGG - Intronic
992374216 5:76172435-76172457 CAGGGCGGCTGGCTGGGCGGGGG - Intronic
992463618 5:76984723-76984745 CAGGGCGGCTGGCTGGGCGGGGG + Intergenic
992469505 5:77042416-77042438 CAGGGCGGCTGGCTGGGCGGGGG + Intronic
992469620 5:77042659-77042681 CGGGGCGGCTGGCTGGGCAGAGG + Intronic
992469876 5:77043208-77043230 CGGGGCGGCTGGCTGGGCAGAGG + Intronic
992574537 5:78096975-78096997 CAGGGCGGCTGGCCGGGCAGAGG - Intronic
992574706 5:78097346-78097368 CAGGGCGGCTGGCCGGGCAGGGG - Intronic
992716258 5:79514059-79514081 CCGGCCGGCTGGCAGAGAAGAGG + Exonic
992978275 5:82140257-82140279 CAGGGCGGCTGGCCGGGCAGGGG - Intronic
993162816 5:84312486-84312508 CAGGGCGGCTGGCCGGGCAGGGG + Intronic
994723179 5:103403811-103403833 CAGTCCCACTTGCTGTGAAGAGG + Intergenic
994891299 5:105639744-105639766 CAGGCCCCCTTGCTGGAAGGTGG - Intergenic
995193670 5:109342290-109342312 CAGGGCGGCTGGCCGGGCAGAGG - Intronic
997335962 5:133109035-133109057 CAGGGCGGCTGGCTGGGCGGGGG - Intergenic
997336015 5:133109163-133109185 CAGGGCGGCTGGCTGGGCGGGGG - Intergenic
997874753 5:137537777-137537799 CGGGGCGGCTGGCTGGGCAGAGG + Intronic
997874783 5:137537855-137537877 CAGGGCGGCTGGCTGGGCGGGGG + Intronic
997930889 5:138070684-138070706 CAGGGCGGCTGGCCGGGCAGAGG - Intergenic
998067535 5:139170913-139170935 CGGGGCGGCTGGCTGGGCAGAGG - Intronic
999177062 5:149639078-149639100 CAGGCCTGTTTGATGGGACGTGG - Intergenic
999181037 5:149670385-149670407 CGGGGCGGCTGGCTGGGCAGAGG + Intergenic
999404953 5:151298585-151298607 AATGCCGGCTTGTTGGTAAGAGG - Exonic
999798772 5:155013666-155013688 CAGGCCAGCACGGTGGGAAGGGG - Intergenic
1001634772 5:173201944-173201966 CAGGGCAGCTTCCTGGGCAGCGG - Intergenic
1003407387 6:5835767-5835789 CGGGGCGGCTGGCTGGGCAGAGG + Intergenic
1003888916 6:10546109-10546131 CATGCTGACTTGCTGGGAATGGG + Intronic
1005644519 6:27827197-27827219 CGGGGCGGCTGGCTGGGCAGAGG + Intergenic
1005644594 6:27827374-27827396 CGGGGCGGCTGGCTGGGCAGAGG + Intergenic
1006148990 6:31976160-31976182 CAGGGCGGCTGGCCGGGCAGAGG + Intronic
1006281768 6:33059653-33059675 CGGGGCGGCTGGCTGGGCAGAGG + Intergenic
1007397519 6:41586127-41586149 CAGGGCAGCCTTCTGGGAAGAGG - Intronic
1008624606 6:53305081-53305103 CGGGGCGGCTCGCTGGGCAGGGG + Intronic
1008624670 6:53305227-53305249 CGGGGCGGCTGGCTGGGCAGAGG + Intronic
1008624699 6:53305305-53305327 CAGGGCGGCTGGCCGGGCAGGGG + Intronic
1010513190 6:76744575-76744597 CAGGGCGGCTGGCGGGGCAGGGG - Intergenic
1011405022 6:87009716-87009738 CAGGGCGGCTGGCCGGGCAGAGG + Intronic
1012983630 6:105853940-105853962 CGGGGCGGCTGGCTGGGCAGAGG + Intergenic
1013206853 6:107953708-107953730 CAGGGCGGCTGGCCGGGCAGGGG - Intronic
1015339779 6:132085121-132085143 AAGGGATGCTTGCTGGGAAGAGG - Intergenic
1015476891 6:133665345-133665367 CAGGGCGGCTGGCTGGGCGGGGG - Intergenic
1017065381 6:150524080-150524102 CAGGCCCTCTTGCTGGGTTGGGG - Intergenic
1017830800 6:158127257-158127279 CAGGGCGGCTGGCTGGGCGGGGG - Intronic
1018393074 6:163355603-163355625 CTGGCGGGGTTGCTGGGAAGCGG - Intergenic
1018727146 6:166621878-166621900 CAGGGCTGCTGGCTGTGAAGGGG - Intronic
1019331742 7:463728-463750 GAGGCCGGCTTCCTGGGGCGAGG + Intergenic
1019552500 7:1610193-1610215 CAGGCCGGCGTGGTGGGAAGAGG - Intergenic
1019669241 7:2268688-2268710 CGGGGCGGCTGGCTGGGCAGAGG - Intronic
1019953183 7:4390205-4390227 CGGGGCGGCTGGCTGGGCAGGGG + Intergenic
1020616254 7:10465378-10465400 CAGGGCGGCTGGCCGGGCAGAGG + Intergenic
1020831818 7:13103011-13103033 CAGGGCGGCTGGCTGGGCGGGGG - Intergenic
1021672289 7:23046127-23046149 CGGGGCGGCTGGCTGGGCAGAGG + Intergenic
1021872478 7:25018969-25018991 CAGGGCGGCTGGCCGGGCAGAGG - Intergenic
1021872679 7:25019427-25019449 CAGGGCGGCTGGCTGGGCGGGGG - Intergenic
1022187915 7:27987531-27987553 CAGGGCGGCTGGCCGGGCAGGGG - Intronic
1022401461 7:30042553-30042575 CAGGACAGCTTTCTGGGAATGGG + Intronic
1023218129 7:37887257-37887279 CAGGACAGCTTTGTGGGAAGAGG - Intronic
1023500391 7:40843729-40843751 CAGGGTGGCTTGGTGGGAAGAGG + Intronic
1024518408 7:50281925-50281947 CAGACAGGCTTGAGGGGAAGGGG - Intergenic
1024585912 7:50842181-50842203 CAGGCAGTCTTGCTGTGGAGAGG + Intergenic
1025793744 7:64718259-64718281 CAGGGCGGCTTGCCGGGCGGGGG - Intergenic
1025808437 7:64856732-64856754 CAGGGCGGCTGGCTGGGCGGGGG - Intergenic
1025821459 7:64967865-64967887 CGGGGCGGCTGGCTGGGCAGAGG + Intergenic
1027087482 7:75275018-75275040 CGGGGCGGCTGGCTGGGCAGAGG - Intergenic
1028685449 7:93585860-93585882 CGGGGCGGCTGGCTGGGCAGAGG + Intergenic
1029568964 7:101358652-101358674 CGGGGCGGCTGGCTGGGCAGAGG + Intergenic
1029569038 7:101358828-101358850 CGGGGCGGCTGGCTGGGCAGAGG + Intergenic
1030091294 7:105861393-105861415 GAGGCAGGCTAGCTGGGATGGGG + Intronic
1030193823 7:106834101-106834123 CAGTTCGGCTTGTTGGAAAGTGG - Intergenic
1030329378 7:108255923-108255945 CAGGGCGGCTGGCTGGGTGGGGG - Intronic
1032291224 7:130591358-130591380 CAGGGCGGCTGGCTGGGCAGAGG - Intronic
1032291363 7:130591691-130591713 CTGGGCGGCTGGCTGGGCAGAGG - Intronic
1033376127 7:140763312-140763334 CAGGGCGGCTGGCCGGGCAGGGG + Intronic
1033757803 7:144409813-144409835 CAGGCTGCCTGGCTGGCAAGTGG + Intronic
1033813379 7:145044253-145044275 CAGGCGGGCTTACTGAGACGTGG + Intergenic
1034313945 7:150112557-150112579 CAGCCCTCCTGGCTGGGAAGTGG + Intergenic
1034322604 7:150198894-150198916 CGGGGCGGCTGGCTGGGCAGAGG - Intergenic
1034507807 7:151509075-151509097 CATTCCTGCTTGCTGGGAGGGGG - Intronic
1034792951 7:153988235-153988257 CAGCCCTCCTGGCTGGGAAGTGG - Intronic
1035566537 8:644869-644891 CTGTTGGGCTTGCTGGGAAGTGG - Intronic
1035772185 8:2156475-2156497 CAGACCTTCTTGCTGGGAAAGGG + Intronic
1037884530 8:22589284-22589306 GAGGCCGGCCTGTTGGGAGGAGG - Exonic
1038744823 8:30246959-30246981 CAGGGCGGCTGGCCGGGCAGAGG + Intergenic
1039968928 8:42305306-42305328 CAGGTGGGCGTGCCGGGAAGTGG + Intronic
1040093309 8:43419551-43419573 CAGGGCGGCTGGCTGGGCGGGGG + Intergenic
1041286979 8:56272212-56272234 CAGGGCGGCTGGCCGGGCAGGGG + Intergenic
1042303738 8:67311379-67311401 CGGGGCGGCTGGCTGGGCAGAGG - Intronic
1044660972 8:94591614-94591636 CAGGGCGGCTGGCTGGGTGGGGG - Intergenic
1045298628 8:100892556-100892578 CAGGGCGGCTGGCCGGGCAGAGG + Intergenic
1048368562 8:133758103-133758125 CAGGGCGGCTGGCTGGGCGGGGG - Intergenic
1048368611 8:133758230-133758252 CAGGGCGGCTGGCTGGGCGGGGG - Intergenic
1049463995 8:142742834-142742856 CAGGCCAGGCTGCAGGGAAGGGG - Intergenic
1050534931 9:6623004-6623026 CAGGGCGGCTGGCCGGGCAGGGG - Intronic
1052492666 9:29188858-29188880 CAGGGCGGCTGGCCGGGCAGAGG + Intergenic
1052858621 9:33423408-33423430 CGGGGCGGCTGGCTGGGCAGAGG - Intergenic
1052942055 9:34137951-34137973 CGGGGCGGCTGGCTGGGTAGAGG - Intergenic
1052974445 9:34400875-34400897 CAGGCAGACGAGCTGGGAAGGGG + Exonic
1053034122 9:34810076-34810098 AGGGCCGGCTTGCTGGGCTGAGG - Intergenic
1053468220 9:38325305-38325327 CAGGGCGGCTGGCCGGGCAGAGG - Intergenic
1055137341 9:72841085-72841107 CGGGGCGGCTGGCTGGGCAGGGG + Intergenic
1055242230 9:74197984-74198006 CAGGGCGGCTGGCTGGGCAGGGG - Intergenic
1055506717 9:76955735-76955757 CAGGGCGGCTGGCCGGGCAGAGG - Intergenic
1056564194 9:87758591-87758613 CAGGGCGGCTGGCCGGGCAGAGG + Intergenic
1056588406 9:87944400-87944422 CAGGCCCGCCTGCTGGGTGGTGG + Intergenic
1056800291 9:89686283-89686305 CAGGCCGGCTCCCTGGGGATGGG - Intergenic
1057154945 9:92831264-92831286 CAGGGCGGCTGGCCGGGCAGAGG + Intergenic
1057221525 9:93260162-93260184 CATGCTGGCTGGCTGTGAAGGGG + Intronic
1057305660 9:93910700-93910722 GAGGCAGGGTTGCTGGGGAGGGG + Intergenic
1057662479 9:97015225-97015247 CAGGCCGGCTTGGTGAGCCGAGG - Intergenic
1057751652 9:97796983-97797005 CAGGGCGGCTGGCCGGGCAGGGG - Intergenic
1058661440 9:107271946-107271968 CAGGGCGGCTGGCCGGGCAGAGG - Intergenic
1059121290 9:111641898-111641920 CGGGGCGGCTGGCTGGGCAGAGG - Intronic
1059211269 9:112514868-112514890 CAGGGCGGCTGGCTGGGCGGGGG - Intronic
1060006054 9:120000864-120000886 AAGGCAGGCTTCCTGGGAGGTGG - Intergenic
1060065263 9:120496396-120496418 CAGGGCGGCTGGCTGGGCGGGGG - Intronic
1060334799 9:122711405-122711427 CGGGGCGGCTGGCTGGGCAGAGG - Intergenic
1060601361 9:124880364-124880386 CAGGTCAGCCTGCAGGGAAGTGG + Exonic
1060687446 9:125624525-125624547 CAGGGCGGCTGGCTGGGCAGAGG - Intronic
1060703593 9:125780089-125780111 CGGGGCGGCTGGCTGGGCAGAGG + Intronic
1061914879 9:133744852-133744874 CAGGGCGGCTGGCCGGGCAGGGG - Intergenic
1062056938 9:134473691-134473713 CAGGCCTGTGGGCTGGGAAGAGG - Intergenic
1062376271 9:136263202-136263224 CAGGCAGACTTGCTGGGGGGTGG - Intergenic
1185584962 X:1236292-1236314 CAGGGCGGCTGGCCGGGCAGAGG - Intergenic
1186094133 X:6081540-6081562 CAGGCCAGTTTACTGGGAAAAGG - Intronic
1186122451 X:6378747-6378769 CAGGCTGGCTTGCTGGAGACCGG + Intergenic
1186623669 X:11268758-11268780 CAGGCGGGCTTGAAGGGCAGGGG - Intronic
1187546385 X:20256789-20256811 CAGGCCTCCTTGGTGAGAAGAGG + Intronic
1187719660 X:22137788-22137810 CAGGCAGGTGTGCTGTGAAGTGG - Intronic
1188477430 X:30603092-30603114 CGGGGCGGCTGGCTGGGCAGGGG - Intergenic
1188492685 X:30753962-30753984 CGGGGCGGCTGGCTGGGCAGGGG + Intergenic
1189114361 X:38327606-38327628 GAGGCCGGGTGGCTGGTAAGGGG + Intronic
1189502355 X:41574728-41574750 CAGGCTCCCTTGCTGGAAAGTGG + Intronic
1190159071 X:48017144-48017166 CAGGGCGGCTGGCTGGGCAGGGG - Intronic
1190598425 X:52067777-52067799 CAGGGCTGACTGCTGGGAAGAGG - Intronic
1190610399 X:52186296-52186318 CAGGGCTGACTGCTGGGAAGAGG + Intronic
1192344488 X:70289978-70290000 CAGGCCGGCGCGGTGGGAAGGGG - Exonic
1192357996 X:70421753-70421775 CAGGGCTGCTTGCTGGCAGGAGG - Intergenic
1192621627 X:72682301-72682323 CGGGGCGGCTGGCTGGGCAGGGG - Intronic
1192794137 X:74412615-74412637 CAGGGCGGCTGGCCGGGCAGGGG + Intergenic
1193207386 X:78765275-78765297 CAGGGCGGCTGGCCGGGCAGAGG - Intergenic
1194611537 X:96051069-96051091 CGGGACGGCTGGCTGGGCAGGGG + Intergenic
1195702831 X:107717545-107717567 CAGGCCAGCTGGCTGGTGAGGGG - Intronic
1196778611 X:119362361-119362383 CAGGGCGGCTGGCTGGGCAGAGG - Intergenic
1199452616 X:147992363-147992385 CGGGGCGGCTGGCTGGGCAGAGG + Intronic
1199608361 X:149594047-149594069 CAGGACTGCCTCCTGGGAAGTGG - Intronic
1199630759 X:149775313-149775335 CAGGACTGCCTCCTGGGAAGTGG + Intronic
1200007482 X:153097250-153097272 CAGTTCAGCTTGTTGGGAAGTGG + Intergenic
1200133123 X:153862245-153862267 CAGCCAGGCTGGCTGGGGAGTGG + Exonic