ID: 1077332924

View in Genome Browser
Species Human (GRCh38)
Location 11:1991235-1991257
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 207
Summary {0: 2, 1: 0, 2: 0, 3: 24, 4: 181}

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1077332924_1077332932 -8 Left 1077332924 11:1991235-1991257 CCCTTCCCAGCAAGCCGGCCTGC 0: 2
1: 0
2: 0
3: 24
4: 181
Right 1077332932 11:1991250-1991272 CGGCCTGCAGGTGGGCTTCCAGG 0: 2
1: 0
2: 0
3: 24
4: 256
1077332924_1077332937 8 Left 1077332924 11:1991235-1991257 CCCTTCCCAGCAAGCCGGCCTGC 0: 2
1: 0
2: 0
3: 24
4: 181
Right 1077332937 11:1991266-1991288 TTCCAGGAAGGGGCCCCCGCTGG No data
1077332924_1077332934 -4 Left 1077332924 11:1991235-1991257 CCCTTCCCAGCAAGCCGGCCTGC 0: 2
1: 0
2: 0
3: 24
4: 181
Right 1077332934 11:1991254-1991276 CTGCAGGTGGGCTTCCAGGAAGG 0: 2
1: 1
2: 0
3: 39
4: 330
1077332924_1077332943 24 Left 1077332924 11:1991235-1991257 CCCTTCCCAGCAAGCCGGCCTGC 0: 2
1: 0
2: 0
3: 24
4: 181
Right 1077332943 11:1991282-1991304 CCGCTGGCTTCCCTCAGCCCTGG No data
1077332924_1077332936 -2 Left 1077332924 11:1991235-1991257 CCCTTCCCAGCAAGCCGGCCTGC 0: 2
1: 0
2: 0
3: 24
4: 181
Right 1077332936 11:1991256-1991278 GCAGGTGGGCTTCCAGGAAGGGG 0: 2
1: 1
2: 9
3: 75
4: 528
1077332924_1077332945 29 Left 1077332924 11:1991235-1991257 CCCTTCCCAGCAAGCCGGCCTGC 0: 2
1: 0
2: 0
3: 24
4: 181
Right 1077332945 11:1991287-1991309 GGCTTCCCTCAGCCCTGGAAGGG No data
1077332924_1077332946 30 Left 1077332924 11:1991235-1991257 CCCTTCCCAGCAAGCCGGCCTGC 0: 2
1: 0
2: 0
3: 24
4: 181
Right 1077332946 11:1991288-1991310 GCTTCCCTCAGCCCTGGAAGGGG No data
1077332924_1077332935 -3 Left 1077332924 11:1991235-1991257 CCCTTCCCAGCAAGCCGGCCTGC 0: 2
1: 0
2: 0
3: 24
4: 181
Right 1077332935 11:1991255-1991277 TGCAGGTGGGCTTCCAGGAAGGG 0: 2
1: 1
2: 3
3: 26
4: 284
1077332924_1077332944 28 Left 1077332924 11:1991235-1991257 CCCTTCCCAGCAAGCCGGCCTGC 0: 2
1: 0
2: 0
3: 24
4: 181
Right 1077332944 11:1991286-1991308 TGGCTTCCCTCAGCCCTGGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1077332924 Original CRISPR GCAGGCCGGCTTGCTGGGAA GGG (reversed) Intergenic