ID: 1077332924

View in Genome Browser
Species Human (GRCh38)
Location 11:1991235-1991257
Sequence GCAGGCCGGCTTGCTGGGAA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 207
Summary {0: 2, 1: 0, 2: 0, 3: 24, 4: 181}

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1077332924_1077332943 24 Left 1077332924 11:1991235-1991257 CCCTTCCCAGCAAGCCGGCCTGC 0: 2
1: 0
2: 0
3: 24
4: 181
Right 1077332943 11:1991282-1991304 CCGCTGGCTTCCCTCAGCCCTGG No data
1077332924_1077332944 28 Left 1077332924 11:1991235-1991257 CCCTTCCCAGCAAGCCGGCCTGC 0: 2
1: 0
2: 0
3: 24
4: 181
Right 1077332944 11:1991286-1991308 TGGCTTCCCTCAGCCCTGGAAGG No data
1077332924_1077332936 -2 Left 1077332924 11:1991235-1991257 CCCTTCCCAGCAAGCCGGCCTGC 0: 2
1: 0
2: 0
3: 24
4: 181
Right 1077332936 11:1991256-1991278 GCAGGTGGGCTTCCAGGAAGGGG 0: 2
1: 1
2: 9
3: 75
4: 528
1077332924_1077332934 -4 Left 1077332924 11:1991235-1991257 CCCTTCCCAGCAAGCCGGCCTGC 0: 2
1: 0
2: 0
3: 24
4: 181
Right 1077332934 11:1991254-1991276 CTGCAGGTGGGCTTCCAGGAAGG 0: 2
1: 1
2: 0
3: 39
4: 330
1077332924_1077332945 29 Left 1077332924 11:1991235-1991257 CCCTTCCCAGCAAGCCGGCCTGC 0: 2
1: 0
2: 0
3: 24
4: 181
Right 1077332945 11:1991287-1991309 GGCTTCCCTCAGCCCTGGAAGGG No data
1077332924_1077332935 -3 Left 1077332924 11:1991235-1991257 CCCTTCCCAGCAAGCCGGCCTGC 0: 2
1: 0
2: 0
3: 24
4: 181
Right 1077332935 11:1991255-1991277 TGCAGGTGGGCTTCCAGGAAGGG 0: 2
1: 1
2: 3
3: 26
4: 284
1077332924_1077332946 30 Left 1077332924 11:1991235-1991257 CCCTTCCCAGCAAGCCGGCCTGC 0: 2
1: 0
2: 0
3: 24
4: 181
Right 1077332946 11:1991288-1991310 GCTTCCCTCAGCCCTGGAAGGGG No data
1077332924_1077332937 8 Left 1077332924 11:1991235-1991257 CCCTTCCCAGCAAGCCGGCCTGC 0: 2
1: 0
2: 0
3: 24
4: 181
Right 1077332937 11:1991266-1991288 TTCCAGGAAGGGGCCCCCGCTGG No data
1077332924_1077332932 -8 Left 1077332924 11:1991235-1991257 CCCTTCCCAGCAAGCCGGCCTGC 0: 2
1: 0
2: 0
3: 24
4: 181
Right 1077332932 11:1991250-1991272 CGGCCTGCAGGTGGGCTTCCAGG 0: 2
1: 0
2: 0
3: 24
4: 256

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1077332924 Original CRISPR GCAGGCCGGCTTGCTGGGAA GGG (reversed) Intergenic
900522339 1:3111667-3111689 GCAGGCCGGCTTTCAGGTACCGG + Intronic
900622664 1:3594544-3594566 GGAGGCCGGCTTTATGGGACAGG + Intronic
901251632 1:7784060-7784082 GCCCGCCGGCCTGCTGGGATTGG + Intergenic
901533104 1:9865947-9865969 GAAGGTCGCCCTGCTGGGAAGGG - Intronic
902040348 1:13487772-13487794 GCAGGCCTGTTTGTTGGCAAGGG - Intronic
903228889 1:21909990-21910012 GAAGGCCTGCTTTGTGGGAAGGG - Intronic
903664392 1:24997554-24997576 GTAGGCCGGCTTGGTGGGCTGGG + Intergenic
905775036 1:40662972-40662994 GGAGGTGAGCTTGCTGGGAATGG - Intronic
905879049 1:41451641-41451663 GCAGGCCTGCCTTCTGGGTAGGG + Intergenic
907750336 1:57257175-57257197 GCAGGCCTGTGTGCTGGGGAAGG - Intronic
908317862 1:62951598-62951620 ACTGGCTGGCTGGCTGGGAAAGG + Intergenic
911056032 1:93709330-93709352 GCAGGCTGGCTTGGAGGGACAGG - Intronic
912522340 1:110254234-110254256 GCAGGCTGTCTAGCTGAGAATGG - Intronic
913469216 1:119172949-119172971 GGTGTCCGGCTTTCTGGGAAAGG + Intergenic
915445919 1:155974936-155974958 GCAGGCCGGCTGGGTTGGGAGGG + Intronic
916889798 1:169104752-169104774 GCAGGACAGGTTGCTGGGAAGGG - Intergenic
917606710 1:176638635-176638657 ACAGGCCGGAGTGCTGGGGAGGG + Intronic
920389787 1:205592240-205592262 GTAGGCCAGCATGCTGGGGAAGG - Exonic
921138744 1:212285704-212285726 GCCGGCCGGCTGGCTGGCGACGG + Exonic
921924077 1:220697441-220697463 GCAGGCTGGGTGGCTGGGACAGG + Exonic
923568383 1:235093378-235093400 GAGGGCTGCCTTGCTGGGAAGGG - Intergenic
924425299 1:243944704-243944726 GCAGGCCAGCTTGTTGGGGAAGG + Intergenic
1064805810 10:19130330-19130352 GCATGGAGGCTTGCTGGGATTGG - Intronic
1066461256 10:35614279-35614301 GCAAGCTGGCTTCCTGGGAAGGG + Intergenic
1067830059 10:49606395-49606417 GGAGGGGGGCTTGCTGGGGATGG - Intergenic
1069717272 10:70529343-70529365 GCAGGCGGGCTGGCAGGGTAAGG - Intronic
1070515481 10:77201533-77201555 GCAGGAAGGCATGCTGGGGAAGG + Intronic
1070704257 10:78626364-78626386 GCACTCCAGCTTGCTGGAAAGGG + Intergenic
1073117069 10:101097243-101097265 CCAGGCAAGCTGGCTGGGAAGGG - Intronic
1074153376 10:110778242-110778264 GCAGGGCTGCTGGCTGGGGAAGG + Intronic
1075551225 10:123394190-123394212 GCAGGAAGGCTTCCTGGAAAAGG + Intergenic
1076611889 10:131731288-131731310 GCTGGCAAGCTTGCAGGGAAGGG + Intergenic
1076882240 10:133245229-133245251 GGTGGGCGGCTTGCTGGGCAGGG - Intergenic
1076883812 10:133252312-133252334 GCAGGACGGGCTGCTGGGCAGGG - Intergenic
1077332924 11:1991235-1991257 GCAGGCCGGCTTGCTGGGAAGGG - Intergenic
1077365241 11:2158940-2158962 GCAGCCCTGCTTACTGGGAGGGG + Intronic
1078454119 11:11461961-11461983 ACAGGCAGGCTTCCTGGGAGAGG - Intronic
1080298670 11:30759259-30759281 GGAGCCAGGCATGCTGGGAACGG + Intergenic
1080445097 11:32331289-32331311 TCTGGCCTGCTTGCTGGCAAAGG - Intergenic
1083262599 11:61531312-61531334 GCAGGCAAGCTGGCTGGGAAGGG + Intronic
1083310854 11:61783007-61783029 GCAGGCTGGCTGGCTGGGTAGGG - Intronic
1087226094 11:95600794-95600816 CCAGGACAGCTTGCTGGGACAGG - Intergenic
1089198848 11:116711268-116711290 GGAGGCCGGCCTGTGGGGAAGGG - Intergenic
1089531377 11:119132011-119132033 GCAGGCTGTCCTGCTTGGAATGG + Intronic
1089691458 11:120189241-120189263 GCAGGCAGGCTTCCTGGAAGAGG + Intergenic
1090050832 11:123377573-123377595 GGAGGCCGGCTGGAAGGGAAAGG + Intergenic
1090075365 11:123577381-123577403 GCAGGCCGGCGTGCTGCGGTTGG - Exonic
1090626484 11:128613350-128613372 GCAGGAGGGCTGGCTGGGACAGG - Intergenic
1091356252 11:134940111-134940133 GCAGAGCGGCCTGTTGGGAAAGG - Intergenic
1202815907 11_KI270721v1_random:46411-46433 GCAGGCCGGCTTGCTGGGAAGGG - Intergenic
1091591801 12:1846813-1846835 GAAGGCTGGGTTCCTGGGAAGGG + Intronic
1091974087 12:4810892-4810914 GAAGGCCGGCTTGCTAGGGCAGG - Exonic
1095983221 12:47984334-47984356 GCAGGCCGGGGAGCTGGGGAAGG - Intronic
1096811459 12:54173011-54173033 GCAAGGCGGCTTGAAGGGAAGGG + Intronic
1097817021 12:64086035-64086057 GAAAGCTGGCTTGTTGGGAATGG - Intronic
1098019117 12:66135145-66135167 ACAGGGCGGCTGGCTGGGCAGGG - Intronic
1102720658 12:115013402-115013424 GCAGGCCTGCTATCTGGTAATGG - Intergenic
1104247803 12:127060400-127060422 TCAAGCCGGAGTGCTGGGAAAGG + Intergenic
1104914927 12:132259778-132259800 GCAGGGGGCCTTGGTGGGAAGGG - Intronic
1105069576 12:133226510-133226532 GCAGCCCTGCTGGCTGGAAAAGG + Intronic
1105252091 13:18708464-18708486 GCAGCCTGCCTTCCTGGGAAAGG + Intergenic
1108958270 13:56187831-56187853 GCAGGCTGGGTTTCTGGGATGGG + Intergenic
1109149196 13:58823614-58823636 GCAGGCTGGGCTTCTGGGAAAGG - Intergenic
1119659320 14:76439251-76439273 GCAGGTAGGGTGGCTGGGAAGGG - Intronic
1121006195 14:90492041-90492063 GCTGGCCTGCTTTCTGGGACTGG - Intergenic
1121737008 14:96225701-96225723 TCTGGCCTGCTTGCTGGGCAGGG + Intronic
1121819097 14:96951495-96951517 GGAGGCCGGCATGGTGGGTAAGG + Intergenic
1122097360 14:99381565-99381587 CTAGGCTGGCTTGCAGGGAAGGG - Intergenic
1122607218 14:102954858-102954880 GCAGGCCGGCCAGCTGGGAGTGG - Intronic
1122757147 14:103990462-103990484 TCAGGAGGGCTGGCTGGGAAGGG - Intronic
1123035515 14:105470266-105470288 GGCGGCGGGCTGGCTGGGAAGGG - Exonic
1127073320 15:55303852-55303874 ACGGGCCGGCTGGCTGGGCAGGG - Intronic
1128792618 15:70444325-70444347 TCAGGCCGGCTTGCTGGCAGGGG - Intergenic
1132285314 15:100658331-100658353 ACAGACCTGCTTCCTGGGAAGGG - Intergenic
1132300753 15:100774191-100774213 ACAGGGCGGCTGGCTGGGCAGGG + Intergenic
1132313084 15:100871186-100871208 GAAGGCAGGCTTACTGAGAAGGG - Intergenic
1133237744 16:4395440-4395462 GCAGCCCTGCGTGCTGGGGATGG - Intronic
1134042122 16:11076753-11076775 GCAGGCCAGCTTCCTGGGCTGGG - Intronic
1134797446 16:17054268-17054290 GCAGGCAGGAGTCCTGGGAAAGG + Intergenic
1135403719 16:22183547-22183569 GCAGCCAGGCTTGCCTGGAAGGG + Intronic
1136048292 16:27632669-27632691 GCAGGCAGGCTGGTTGGGAGGGG + Intronic
1136617350 16:31406587-31406609 GAAGGCAGGCTTGGTGGGGACGG + Intronic
1136627637 16:31471966-31471988 GCAGGCCGGCGGGCTGGGCTCGG + Intronic
1137530615 16:49276648-49276670 GCAGACCTCCTTCCTGGGAAAGG - Intergenic
1139433122 16:66921794-66921816 GCAGGCCTGCGTGCCGGGAGAGG - Exonic
1141139432 16:81487480-81487502 GCGGGCCGGCTTGGCGGGAATGG + Intronic
1141171327 16:81693510-81693532 TCAGGCCGGCTGTCTGGGGATGG + Intronic
1141631130 16:85288707-85288729 CCAGGCAGGCTTCCTGGGAGAGG + Intergenic
1141908263 16:87041676-87041698 GCAGCCAGGCTTGCTGGGCAAGG + Intergenic
1142223246 16:88865461-88865483 CCAGGCAGCCTTGCTGGGAAGGG - Intronic
1142601442 17:1054803-1054825 TCAGGGAGGCTTCCTGGGAAAGG + Intronic
1143034598 17:3987173-3987195 GTAGGCAGGCTGGCTGGGAGGGG - Intergenic
1144375714 17:14638505-14638527 GCAGGCAGGCTAGCAGGTAATGG + Intergenic
1144526999 17:15999212-15999234 GCTGGCCGGGTCGCTGGGAGGGG - Intronic
1144665839 17:17101852-17101874 GCAGGCAGGCTTTCTGGGCATGG - Intronic
1147447601 17:40484276-40484298 GCACGCAGGCTTGCTGTGAAAGG + Intronic
1147905654 17:43820986-43821008 GCAGGCCCGCCTCCTGGCAAGGG + Exonic
1147986287 17:44309245-44309267 GCTGGCTCCCTTGCTGGGAATGG + Intronic
1148135432 17:45288872-45288894 GCAGGCCGGGTTGGTGGGGGGGG - Intronic
1149566445 17:57643919-57643941 CCAGGCCTGCCTGCTGGGAAGGG - Intronic
1150001411 17:61443173-61443195 GCAGACCGGCTGGCTGGGTGTGG - Intergenic
1151714309 17:75823657-75823679 AAAGGCCGGCCTGCTGGGAATGG + Intronic
1152594963 17:81233518-81233540 GGGGGCCGGCTTGCTGCTAACGG - Intronic
1153958905 18:10123747-10123769 GCAGGCCAGCAAGCTGGGCAGGG - Intergenic
1154059125 18:11042346-11042368 GCAGGCCTGCAGGCTGGGGATGG + Intronic
1154498380 18:14979186-14979208 GCAGAGCGGCCTGTTGGGAAAGG + Intergenic
1157338678 18:46759048-46759070 GCAGGCTGGCTTCTTGGGAGTGG + Intronic
1157385921 18:47260120-47260142 TAAGGACGGCTTGCTGGGAACGG - Intergenic
1158718308 18:59900050-59900072 GCAGGCAGGGATGCTGGGATCGG - Exonic
1160385029 18:78491700-78491722 GCAGGTGGGCTGGCTGTGAAGGG + Intergenic
1160769413 19:823633-823655 GCAGCCCAGCTTCCTGGGACAGG + Intergenic
1161154050 19:2723123-2723145 GCAGGCAGGCGGACTGGGAAGGG - Intronic
1161490284 19:4557523-4557545 GCAGGGCGGCTTCCTCGGCAAGG - Intronic
1163796857 19:19342796-19342818 GCAGGCCGGCTACCTGGAGAAGG + Exonic
1164879701 19:31721583-31721605 GCAGGCCTGGTTGCAGGGATCGG - Intergenic
1165481809 19:36069005-36069027 ACGGGCCGGCTGGCTGGGCAGGG + Intronic
1166806487 19:45490417-45490439 GCAGCCCTGCTTGCGGTGAAGGG - Intronic
1167303938 19:48696268-48696290 GGAGGGCGGCTGGCTGGGGAGGG - Intronic
1168515140 19:57004559-57004581 GCCGGCCTGCTCGCTGGGCATGG - Intergenic
925147755 2:1592248-1592270 GCAGGCTGCCCTGCTGGGAGGGG + Intergenic
926483243 2:13426001-13426023 GCAGGCCTGCTTGTCTGGAAAGG + Intergenic
927852212 2:26506485-26506507 GCTGCCCGGCCTGCTGGGATGGG + Intronic
930025161 2:47025206-47025228 GCAGCCCTGCCTGCTGGGGATGG + Intronic
932667189 2:73707599-73707621 GCAGAGAGGCTTGCTGGGATGGG + Intergenic
934243747 2:90291749-90291771 GCTGGCCGGCTGGCTTGGCAGGG - Intergenic
937325448 2:120987398-120987420 GCATGCGGGGCTGCTGGGAAGGG - Intronic
937343680 2:121109222-121109244 GCAGGCCTGCTGGCTGGGCGCGG + Intergenic
937951472 2:127391093-127391115 GCAGGCCAAATTGCTGGGAAGGG + Intergenic
942795343 2:179812146-179812168 GCAGGCGGGGTTGCAGAGAAAGG + Intronic
946152980 2:217788853-217788875 GCAGGCCGGCTGCAGGGGAATGG + Intergenic
946359101 2:219208336-219208358 GCAGGCCTACCTGCTGGGAGAGG - Exonic
1169716115 20:8620447-8620469 GCAGGCTGTCTGGCTGGGCACGG + Intronic
1171316794 20:24202504-24202526 GCAGGTCTTCTTCCTGGGAAGGG - Intergenic
1174313391 20:49677344-49677366 GCAGGGGGTCTTGCTGGGGATGG - Intronic
1174411496 20:50339576-50339598 GGAGGCTGGATTGCTGGGAGGGG - Intergenic
1176177559 20:63735847-63735869 GCAGGCCGGCTTCCTGAGCCCGG - Exonic
1176837622 21:13808316-13808338 GCAGACTGCCTTCCTGGGAAAGG + Intergenic
1179170790 21:38971230-38971252 GGAGGTTGTCTTGCTGGGAATGG + Intergenic
1179842767 21:44087973-44087995 GCCCGCCTGCCTGCTGGGAAAGG + Intronic
1180007879 21:45031649-45031671 GGAGCCCTGCCTGCTGGGAAGGG - Intergenic
1180871781 22:19150532-19150554 GCAGGGCGACCTGCGGGGAAGGG + Intergenic
1180918728 22:19507272-19507294 GCAGGCAGGCCTGGTGAGAAAGG + Intronic
1180961316 22:19763643-19763665 TCAGGCCGGCCTCCTGGGAGAGG - Intronic
1184428884 22:44429398-44429420 GCTGGGCTGCTTGCTGGGAGGGG + Intergenic
1184934499 22:47710955-47710977 ACAGGCCAGGTTGCTAGGAAGGG + Intergenic
1185095724 22:48804986-48805008 GCTGGCCTGCTTCCTGGGCAGGG + Intronic
1185299414 22:50071857-50071879 CCAGCCCGGCCTGCTGGGGAGGG + Intronic
949129819 3:486666-486688 CCAGGCAAGCTTGCTGGAAATGG - Intergenic
950630124 3:14276704-14276726 GCCGGCCCGATGGCTGGGAAGGG + Intergenic
953207883 3:40848055-40848077 GCAGACTGCCATGCTGGGAAGGG + Intergenic
953809245 3:46097633-46097655 TCAGGCCTGCATGCAGGGAAGGG - Intergenic
954952918 3:54490800-54490822 GGAAGCGGGGTTGCTGGGAAGGG + Intronic
956691010 3:71877594-71877616 GGACCCAGGCTTGCTGGGAAGGG + Intergenic
957271029 3:78030138-78030160 GCAGGCTGGGCTTCTGGGAAGGG + Intergenic
961686150 3:128632883-128632905 GCACGATGGCTTGCTGGGCACGG - Intronic
961696973 3:128712093-128712115 GAAGGCCAGCATGGTGGGAATGG + Intergenic
964303716 3:155318263-155318285 GCAAGGAGGCTTACTGGGAAGGG + Intergenic
969597714 4:8158441-8158463 GCCGGCCGGCGCGCTGGGAAAGG + Intronic
970720304 4:18980677-18980699 GAAGGCCGGTTTCCTGGGGAAGG - Intergenic
973587868 4:52410482-52410504 GCAGGCTGGCTTCCTGGGGCTGG + Intergenic
981807030 4:148728573-148728595 GCAGGCAGGCCTGATGTGAAAGG + Intergenic
982072793 4:151710065-151710087 GCAGGCCAGCTTGCTGAGGAGGG - Intronic
985511551 5:316859-316881 TCAGGCCGGCCTGCTGGCAAAGG + Intronic
986631851 5:9781783-9781805 GCAGGGGGCCTTGCTGAGAAGGG - Intergenic
994093901 5:95831847-95831869 GCAGGGGGGCGTGGTGGGAAAGG - Intergenic
997266104 5:132496283-132496305 GCTGGCCGGCTTCCTGGAAAGGG + Intergenic
998128163 5:139637941-139637963 GCCGGCCGGTGTGCTGGGACTGG + Intergenic
999798773 5:155013667-155013689 GCAGGCCAGCACGGTGGGAAGGG - Intergenic
1000078805 5:157823787-157823809 GCGGACCGGCCTGTTGGGAATGG + Intronic
1001563744 5:172686583-172686605 GCAGGGCTTCTTGCTGGGACCGG - Intronic
1002919224 6:1554552-1554574 CCAGGCTGGCTTGCAGAGAACGG - Intergenic
1003383667 6:5648228-5648250 GGAGGCCGGCTGGCTGCTAAAGG - Intronic
1003503244 6:6719379-6719401 GCTGGGCAGCTTTCTGGGAATGG + Intergenic
1003888915 6:10546108-10546130 GCATGCTGACTTGCTGGGAATGG + Intronic
1005897636 6:30191582-30191604 GCAGGCTGGCTTCCTGGAGAGGG + Intronic
1013088444 6:106876478-106876500 GCAGCCAGGCTGGCTGGGCATGG + Intergenic
1013381837 6:109580669-109580691 GCAGGTCGGCTTCCTGTTAATGG + Intronic
1015228617 6:130887346-130887368 GCAGGCAGGCTGGTTAGGAATGG - Intronic
1019833910 7:3361452-3361474 GCAGGCAGAGATGCTGGGAAGGG - Intronic
1021839659 7:24712477-24712499 GCTGGCTGGCTGGCTGGGGATGG - Intronic
1022401460 7:30042552-30042574 CCAGGACAGCTTTCTGGGAATGG + Intronic
1024606068 7:51023648-51023670 GCCGGCAGCCTTGCTGTGAAAGG - Intronic
1024871079 7:53962125-53962147 GGAGTCAGGCTTTCTGGGAAAGG - Intergenic
1034455518 7:151167859-151167881 GCCGGCCGGGCCGCTGGGAACGG - Intronic
1035772184 8:2156474-2156496 ACAGACCTTCTTGCTGGGAAAGG + Intronic
1037784948 8:21897093-21897115 GCAGCCTGGCATGCTGGGAAGGG + Intergenic
1037985561 8:23288655-23288677 GGGTGCCGCCTTGCTGGGAAGGG + Intronic
1038577205 8:28715581-28715603 GCAGGCCTGATTGTTGGCAAAGG + Exonic
1044340370 8:91040483-91040505 GCAGGCGGGCTTGCCTGGGAAGG + Intronic
1048580483 8:135726174-135726196 GCAGCCTGGCTGGCTGGGATTGG - Intergenic
1049463996 8:142742835-142742857 GCAGGCCAGGCTGCAGGGAAGGG - Intergenic
1052974444 9:34400874-34400896 GCAGGCAGACGAGCTGGGAAGGG + Exonic
1053429668 9:38033768-38033790 GCAGGCCTGCTTGGTGAGTAAGG + Intronic
1055242231 9:74197985-74198007 ACAGGGCGGCTGGCTGGGCAGGG - Intergenic
1056800292 9:89686284-89686306 GCAGGCCGGCTCCCTGGGGATGG - Intergenic
1057221524 9:93260161-93260183 GCATGCTGGCTGGCTGTGAAGGG + Intronic
1060207535 9:121690977-121690999 GCAGGTGGGCTTGCTGAGATTGG - Intronic
1060721588 9:125983241-125983263 GCAGCCTGGCTTCCTGGGATGGG - Intergenic
1061328572 9:129878680-129878702 GCAGAGCAGCTTGCTGGGCATGG - Intronic
1185586092 X:1243046-1243068 GCAGGGGGGCTGGCTGGCAAAGG + Intergenic
1189114360 X:38327605-38327627 GGAGGCCGGGTGGCTGGTAAGGG + Intronic
1190159072 X:48017145-48017167 ACAGGGCGGCTGGCTGGGCAGGG - Intronic
1192204746 X:69088428-69088450 GCAGGGGGCCTGGCTGGGAAAGG + Intergenic
1192344489 X:70289979-70290001 GCAGGCCGGCGCGGTGGGAAGGG - Exonic
1193380634 X:80812441-80812463 TCTGGCCGGCTTACTGGGTAGGG - Intergenic
1195702832 X:107717546-107717568 GCAGGCCAGCTGGCTGGTGAGGG - Intronic
1201401824 Y:13611683-13611705 ACTGCCCGGCTTGCTGGGAGGGG + Intergenic