ID: 1077332925

View in Genome Browser
Species Human (GRCh38)
Location 11:1991236-1991258
Sequence TGCAGGCCGGCTTGCTGGGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 229
Summary {0: 2, 1: 0, 2: 1, 3: 24, 4: 202}

Found 10 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1077332925_1077332937 7 Left 1077332925 11:1991236-1991258 CCTTCCCAGCAAGCCGGCCTGCA 0: 2
1: 0
2: 1
3: 24
4: 202
Right 1077332937 11:1991266-1991288 TTCCAGGAAGGGGCCCCCGCTGG No data
1077332925_1077332945 28 Left 1077332925 11:1991236-1991258 CCTTCCCAGCAAGCCGGCCTGCA 0: 2
1: 0
2: 1
3: 24
4: 202
Right 1077332945 11:1991287-1991309 GGCTTCCCTCAGCCCTGGAAGGG No data
1077332925_1077332932 -9 Left 1077332925 11:1991236-1991258 CCTTCCCAGCAAGCCGGCCTGCA 0: 2
1: 0
2: 1
3: 24
4: 202
Right 1077332932 11:1991250-1991272 CGGCCTGCAGGTGGGCTTCCAGG 0: 2
1: 0
2: 0
3: 24
4: 256
1077332925_1077332935 -4 Left 1077332925 11:1991236-1991258 CCTTCCCAGCAAGCCGGCCTGCA 0: 2
1: 0
2: 1
3: 24
4: 202
Right 1077332935 11:1991255-1991277 TGCAGGTGGGCTTCCAGGAAGGG 0: 2
1: 1
2: 3
3: 26
4: 284
1077332925_1077332946 29 Left 1077332925 11:1991236-1991258 CCTTCCCAGCAAGCCGGCCTGCA 0: 2
1: 0
2: 1
3: 24
4: 202
Right 1077332946 11:1991288-1991310 GCTTCCCTCAGCCCTGGAAGGGG No data
1077332925_1077332936 -3 Left 1077332925 11:1991236-1991258 CCTTCCCAGCAAGCCGGCCTGCA 0: 2
1: 0
2: 1
3: 24
4: 202
Right 1077332936 11:1991256-1991278 GCAGGTGGGCTTCCAGGAAGGGG 0: 2
1: 1
2: 9
3: 75
4: 528
1077332925_1077332943 23 Left 1077332925 11:1991236-1991258 CCTTCCCAGCAAGCCGGCCTGCA 0: 2
1: 0
2: 1
3: 24
4: 202
Right 1077332943 11:1991282-1991304 CCGCTGGCTTCCCTCAGCCCTGG No data
1077332925_1077332947 30 Left 1077332925 11:1991236-1991258 CCTTCCCAGCAAGCCGGCCTGCA 0: 2
1: 0
2: 1
3: 24
4: 202
Right 1077332947 11:1991289-1991311 CTTCCCTCAGCCCTGGAAGGGGG No data
1077332925_1077332934 -5 Left 1077332925 11:1991236-1991258 CCTTCCCAGCAAGCCGGCCTGCA 0: 2
1: 0
2: 1
3: 24
4: 202
Right 1077332934 11:1991254-1991276 CTGCAGGTGGGCTTCCAGGAAGG 0: 2
1: 1
2: 0
3: 39
4: 330
1077332925_1077332944 27 Left 1077332925 11:1991236-1991258 CCTTCCCAGCAAGCCGGCCTGCA 0: 2
1: 0
2: 1
3: 24
4: 202
Right 1077332944 11:1991286-1991308 TGGCTTCCCTCAGCCCTGGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1077332925 Original CRISPR TGCAGGCCGGCTTGCTGGGA AGG (reversed) Intergenic
900351223 1:2235621-2235643 TCCAGGCTGCCTTGCTGGGGTGG + Intronic
901217285 1:7561843-7561865 TCCAGGCCGGCGTGCAGGCAGGG - Intronic
901229869 1:7635694-7635716 TGCAGGCCGCCCTGCTGAGCTGG + Intronic
902040349 1:13487773-13487795 TGCAGGCCTGTTTGTTGGCAAGG - Intronic
903279459 1:22242234-22242256 TCAAGGCAGGCTTCCTGGGATGG + Intergenic
903664391 1:24997553-24997575 GGTAGGCCGGCTTGGTGGGCTGG + Intergenic
904259742 1:29281465-29281487 TGGGGGCAGGCTTGGTGGGAGGG + Intronic
904336319 1:29800555-29800577 TCCTGGCAGGCTTGCTGGGCTGG + Intergenic
904464227 1:30698497-30698519 TCCTGGCAGGCTTGCTGGGCTGG - Intergenic
907269058 1:53279941-53279963 TGCTGGCCTGCTCCCTGGGAAGG + Intronic
914195387 1:145445737-145445759 TGCAGGCCGGGCTCCAGGGATGG - Intergenic
915528822 1:156491744-156491766 TGCAGCTCGGCCTGCTGGGATGG - Intronic
916470581 1:165118783-165118805 TCCAGGGAGGCTTCCTGGGAAGG + Intergenic
916889799 1:169104753-169104775 AGCAGGACAGGTTGCTGGGAAGG - Intergenic
917475739 1:175367511-175367533 TGCAGGCAGGCTCTCTGGGAAGG + Intronic
919611524 1:199751086-199751108 TGCAGCCCAGGTTTCTGGGAAGG + Intergenic
920212286 1:204336907-204336929 GGCAGGGCAGTTTGCTGGGAAGG + Intronic
922903615 1:229157298-229157320 TGCAGAGTGGCTTGTTGGGAAGG - Intergenic
923568384 1:235093379-235093401 TGAGGGCTGCCTTGCTGGGAAGG - Intergenic
924379278 1:243446825-243446847 TGCAGCCAGGCTTTCTCGGATGG + Intronic
1064821681 10:19342729-19342751 TTAAGGCAGGCTTTCTGGGAAGG + Intronic
1066461255 10:35614278-35614300 GGCAAGCTGGCTTCCTGGGAAGG + Intergenic
1067348198 10:45453614-45453636 TGCAGGCAGGCTTGAGAGGATGG - Intergenic
1068881101 10:62049543-62049565 TCCAGGCTGGCTTTCTGGGATGG + Intronic
1070704256 10:78626363-78626385 TGCACTCCAGCTTGCTGGAAAGG + Intergenic
1071957818 10:90778453-90778475 TGAAGGCCTTCTTGCTGGTAGGG - Intronic
1073059737 10:100726276-100726298 TGCAGGCCTGGAAGCTGGGAGGG + Intergenic
1073141700 10:101252754-101252776 TGCAGGCCAGCTACTTGGGAGGG - Intergenic
1073946706 10:108758844-108758866 TGCAGGTCGTCTTGTTGGGAAGG + Intergenic
1074683940 10:115940400-115940422 AGCAGGCTGGCTTCCTGGGCTGG + Intronic
1075280214 10:121132513-121132535 GGCAGGCTGGATTGCTGGGTAGG - Intergenic
1076212656 10:128660828-128660850 TTCAGGCCGACTTCCTGGGCTGG + Intergenic
1076548138 10:131259878-131259900 TGCAGGCTGGCGTGCTGGAGTGG - Intronic
1077332925 11:1991236-1991258 TGCAGGCCGGCTTGCTGGGAAGG - Intergenic
1077365240 11:2158939-2158961 AGCAGCCCTGCTTACTGGGAGGG + Intronic
1077365347 11:2159325-2159347 TGCAGGGCGGGGGGCTGGGAAGG - Intronic
1077468149 11:2743501-2743523 TGCATGCCGGGGAGCTGGGAGGG - Intronic
1078651630 11:13200215-13200237 TGGAGGTGGGCTTGGTGGGAGGG + Intergenic
1078651645 11:13200343-13200365 TGGAGGTGGGCTTGGTGGGAGGG - Intergenic
1078852625 11:15178453-15178475 TGCAGGCTGGGCTGCAGGGAGGG + Intronic
1079117069 11:17646663-17646685 GGCCGGCCTGCCTGCTGGGAAGG - Intronic
1079451678 11:20604179-20604201 TGGGAGCCTGCTTGCTGGGAAGG + Intronic
1080765898 11:35296551-35296573 TGCAGGCCACCTTGATGGGTTGG - Intronic
1081653637 11:44842193-44842215 AGGAGGCCTGCTTGCTGGCATGG - Intronic
1081780395 11:45706687-45706709 TGCTGGACAGCATGCTGGGATGG + Intergenic
1081911343 11:46701591-46701613 TGCAGCCCGGCCTGCTGTGGGGG + Exonic
1083262598 11:61531311-61531333 GGCAGGCAAGCTGGCTGGGAAGG + Intronic
1083310855 11:61783008-61783030 TGCAGGCTGGCTGGCTGGGTAGG - Intronic
1084087112 11:66859813-66859835 TGCAGGCCCACGTGCTGGGCGGG + Exonic
1085277017 11:75306904-75306926 TGCAGGCTGGACTGCTGGAATGG - Intronic
1085476938 11:76794852-76794874 TGCAGGCCCCATTGCAGGGAGGG + Intronic
1089198849 11:116711269-116711291 TGGAGGCCGGCCTGTGGGGAAGG - Intergenic
1202815908 11_KI270721v1_random:46412-46434 TGCAGGCCGGCTTGCTGGGAAGG - Intergenic
1092061174 12:5551753-5551775 TGGAGAGCTGCTTGCTGGGAAGG + Intronic
1094753181 12:33438175-33438197 TGGAGCCCTGCGTGCTGGGAGGG - Intronic
1098439656 12:70504456-70504478 TGCAGGGAGGCCTGCAGGGAGGG - Intergenic
1100397298 12:94196251-94196273 TGGAGGTGGGCCTGCTGGGAGGG + Intronic
1101315678 12:103626911-103626933 TGCAATCTGGCTAGCTGGGAAGG - Intronic
1102225310 12:111224312-111224334 TGCAGCCAGGCTTCCTGAGAGGG + Intronic
1103736489 12:123064184-123064206 TGCTGGCAGCGTTGCTGGGAGGG - Intronic
1104914928 12:132259779-132259801 TGCAGGGGGCCTTGGTGGGAAGG - Intronic
1106483818 13:30155722-30155744 GGCAGGCTGGTGTGCTGGGATGG + Intergenic
1108958269 13:56187830-56187852 AGCAGGCTGGGTTTCTGGGATGG + Intergenic
1110626873 13:77662516-77662538 GGCAGCCCGGCCAGCTGGGAAGG + Intergenic
1111079789 13:83289066-83289088 TGCAGGCTGGCCTCCTGGGCTGG - Intergenic
1112432204 13:99359856-99359878 TGCAGGCCACCATGCAGGGAAGG - Intronic
1115640564 14:35333153-35333175 TCCAGGCCTCCTTCCTGGGAGGG + Intergenic
1117862350 14:60105786-60105808 GGTAGGGTGGCTTGCTGGGAAGG - Intronic
1119223133 14:72925288-72925310 TTCAAGCCGGCTGGATGGGAGGG - Intergenic
1120903984 14:89603056-89603078 TGCAAGGGGGATTGCTGGGAAGG - Intronic
1120924204 14:89781838-89781860 TGCAGGGCTGATGGCTGGGATGG + Intergenic
1121097088 14:91224973-91224995 TGCATGCCCACTTTCTGGGAGGG + Exonic
1122123452 14:99566778-99566800 TGCAGGCCCCCTCGTTGGGAGGG - Intronic
1122520568 14:102340666-102340688 TGCAGGTAGGGTTGTTGGGAGGG + Intronic
1122851459 14:104534741-104534763 AGCAGGCTGGCTTCCTGGGCTGG - Intronic
1122881562 14:104692695-104692717 CCCAGGCCGACTGGCTGGGAGGG - Intronic
1122959664 14:105088556-105088578 TCCAGGCAGGCTGCCTGGGAGGG - Intergenic
1123038075 14:105479339-105479361 TGCAGGCCGGCTCGCCGTGGGGG - Intronic
1123417307 15:20103129-20103151 TGCTGGCTGGCTGGCTGGGCTGG + Intergenic
1123417529 15:20104078-20104100 TGCTGGCTGGCTGGCTGGGCCGG + Intergenic
1123418000 15:20106052-20106074 TGCTGGCTGGCTGGCTGGGCTGG + Intergenic
1123526582 15:21109983-21110005 TGCTGGCTGGCTGGCTGGGCTGG + Intergenic
1123526904 15:21111356-21111378 TGCTGGCTGGCTGGCTGGGCTGG + Intergenic
1123704282 15:22939898-22939920 TGCTGGCCGGCTTCATGGCAGGG - Intronic
1123980368 15:25596701-25596723 TGCAGCCCGGCGTGCTGGGCTGG - Intergenic
1125511009 15:40292268-40292290 TGGAAGCTGGCTTGATGGGAAGG + Intronic
1128749860 15:70141094-70141116 TGCAGGCCAGCCTGCTGCCAAGG + Intergenic
1128792619 15:70444326-70444348 GTCAGGCCGGCTTGCTGGCAGGG - Intergenic
1129104724 15:73298534-73298556 TGGAGGCGGGATTGCTGGCACGG - Exonic
1131003125 15:88954528-88954550 TCCAGGCCTGCTGGCTGGGCTGG - Intergenic
1133589355 16:7227710-7227732 TGCAGGCCAGCCTGCAGGCAGGG - Intronic
1134042123 16:11076754-11076776 GGCAGGCCAGCTTCCTGGGCTGG - Intronic
1136048291 16:27632668-27632690 AGCAGGCAGGCTGGTTGGGAGGG + Intronic
1138496303 16:57411332-57411354 TGCAGGCTGCCTGGCTGGCAGGG - Intronic
1139440225 16:66963044-66963066 GGCTCACCGGCTTGCTGGGAAGG + Intronic
1142223248 16:88865462-88865484 GCCAGGCAGCCTTGCTGGGAAGG - Intronic
1142590907 17:1005570-1005592 TGCATGCAGGCAGGCTGGGAAGG + Exonic
1143034599 17:3987174-3987196 GGTAGGCAGGCTGGCTGGGAGGG - Intergenic
1144021065 17:11240754-11240776 CGCAGGCTGGCTCCCTGGGACGG - Intergenic
1144527000 17:15999213-15999235 AGCTGGCCGGGTCGCTGGGAGGG - Intronic
1146367623 17:32241470-32241492 TGCAGGGGTGCTTGGTGGGATGG + Intronic
1148135433 17:45288873-45288895 CGCAGGCCGGGTTGGTGGGGGGG - Intronic
1148342090 17:46879267-46879289 AGGAGGCCGGGTCGCTGGGAAGG + Intronic
1149519799 17:57310119-57310141 TCCAGGCAGGCCTGCTGGGCCGG - Intronic
1149566447 17:57643920-57643942 GCCAGGCCTGCCTGCTGGGAAGG - Intronic
1149790048 17:59468808-59468830 TGAAGGCAGGCTTGCAGGGACGG - Intergenic
1150501337 17:65653632-65653654 CACAGGAAGGCTTGCTGGGAGGG + Intronic
1150774046 17:68065075-68065097 TGAAGGCAGGGTTGCAGGGAGGG - Intergenic
1151483844 17:74386455-74386477 AGCAGGCTGGCTTCCTGGGCTGG + Intergenic
1152476379 17:80521134-80521156 GGCAGGCAGGCTGGCTGGGAAGG - Intergenic
1152613996 17:81329627-81329649 GGCAGGCCGGCAGGCTGGGCTGG + Intronic
1152945469 17:83195414-83195436 TGAAGACCGGTTTCCTGGGACGG + Intergenic
1158022037 18:52854733-52854755 TGCTGGCGGGCTTTCTGTGATGG - Intronic
1159023955 18:63166094-63166116 TGCTGGCTGGCTTCCTCGGAGGG + Intronic
1160380455 18:78450925-78450947 TGAAGGCCGTCTTGCAGGGGAGG - Intergenic
1160741723 19:689327-689349 TCCAGGGCGGCCTCCTGGGAAGG + Intronic
1163301122 19:16447105-16447127 TGTGGGCCGGCCTGCTGGGAGGG - Intronic
1165070167 19:33251143-33251165 TCCAGGCAGGCTTCCTGGGCTGG + Intergenic
1165723123 19:38093693-38093715 GGCAGGCTGGCTGGCTTGGAAGG - Intronic
1166359932 19:42248875-42248897 TGCAGGCGGGCTGGCTGAGGGGG - Exonic
1166806488 19:45490418-45490440 TGCAGCCCTGCTTGCGGTGAAGG - Intronic
1167719382 19:51168138-51168160 AGCAGGTCAGGTTGCTGGGATGG - Intergenic
1167772693 19:51530888-51530910 AGCAGGTCAGATTGCTGGGATGG + Exonic
925147754 2:1592247-1592269 CGCAGGCTGCCCTGCTGGGAGGG + Intergenic
926934205 2:18070958-18070980 TGCAGGCTGGCTGGCTGGGAAGG - Intronic
927852211 2:26506484-26506506 GGCTGCCCGGCCTGCTGGGATGG + Intronic
928288862 2:30019722-30019744 TGTGGGCATGCTTGCTGGGAGGG - Intergenic
929787490 2:45002977-45002999 TGCAGCATGGATTGCTGGGAAGG - Intergenic
932667188 2:73707598-73707620 TGCAGAGAGGCTTGCTGGGATGG + Intergenic
933962682 2:87415548-87415570 TGCTGGCCGGCTGGCTTGGATGG - Intergenic
933963372 2:87418584-87418606 TGCTGGCCGGCTGGCTTGGATGG - Intergenic
934244862 2:90297627-90297649 TGCTGGCTGGCTGGCTTGGATGG - Intergenic
934263877 2:91499376-91499398 TGCTGGCTGGCTGGCTTGGATGG + Intergenic
934263962 2:91499722-91499744 TGCTGGCTGGCTGGCTTGGATGG + Intergenic
934729673 2:96648684-96648706 AGCAGGCTGGCTTCCTGGGCTGG + Intergenic
935672804 2:105570304-105570326 TGTGGGCCGGCATGCTGGGATGG - Intergenic
937325449 2:120987399-120987421 TGCATGCGGGGCTGCTGGGAAGG - Intronic
937854995 2:126665943-126665965 TGCAGCCTGCCCTGCTGGGAGGG + Intronic
937951471 2:127391092-127391114 AGCAGGCCAAATTGCTGGGAAGG + Intergenic
937952963 2:127402358-127402380 TGCAGGCCTGCAGGATGGGAGGG - Intergenic
937984219 2:127631368-127631390 TGCAGGCAGGCTGGTGGGGAAGG - Intronic
938058938 2:128237398-128237420 AGCAGGCTGGCTTCCTGGGCTGG - Intronic
946017470 2:216615488-216615510 TCTAGGCCAGCTTCCTGGGAAGG + Intergenic
946306951 2:218861454-218861476 ACCTGGCAGGCTTGCTGGGAAGG + Intronic
948320433 2:237064529-237064551 TGCAGGCAGGCTTCCTGCGTGGG - Intergenic
1169417667 20:5431788-5431810 TGCTGGGAGGCTGGCTGGGATGG - Intergenic
1169661619 20:7984448-7984470 TGCAGGAAGGCTTGGTGGGTTGG + Intronic
1172132455 20:32664728-32664750 TGCAGGACCACTGGCTGGGATGG - Intergenic
1174283787 20:49457934-49457956 TGCTGGCCTTCATGCTGGGAGGG + Intronic
1174411497 20:50339577-50339599 AGGAGGCTGGATTGCTGGGAGGG - Intergenic
1175158610 20:56991376-56991398 TGCAGGCAGCCTTGCTACGAGGG + Intergenic
1175818565 20:61896308-61896330 GGTGGGCCGGCTTGCTGAGAAGG + Intronic
1180007880 21:45031650-45031672 TGGAGCCCTGCCTGCTGGGAAGG - Intergenic
1180159608 21:45993169-45993191 TGCAGGGCGCCTGCCTGGGAAGG + Intronic
1180554410 22:16563511-16563533 CGCTGGCCGGCTTGCTTGGCTGG - Intergenic
1180555285 22:16567228-16567250 GGCAGGCCGGCTGGCTTGGCTGG - Intergenic
1184100298 22:42338455-42338477 TGCAGGCCGGGCTGCCGGGAGGG - Intronic
1184407374 22:44307866-44307888 TGCAGGATGGCCTGCGGGGAGGG + Intronic
1184428883 22:44429397-44429419 CGCTGGGCTGCTTGCTGGGAGGG + Intergenic
1184823386 22:46930186-46930208 TGCAGGCCGGCGTGGTCTGATGG - Intronic
1184934498 22:47710954-47710976 TACAGGCCAGGTTGCTAGGAAGG + Intergenic
949487583 3:4554572-4554594 GGCAGGCAGGCTGGTTGGGAAGG + Intronic
952901376 3:38114154-38114176 TGCAGGCTGCCTGGCTGGGAGGG + Intronic
953019256 3:39103516-39103538 TCCAGGCCCGCCTGCTGGGCTGG + Exonic
953561890 3:43998558-43998580 ACCCGGCCGGCTTCCTGGGAAGG + Intergenic
953904362 3:46861094-46861116 TGCAGGCTGGGATGCTGGAATGG - Intronic
954329353 3:49881255-49881277 TCTAGGCAGGCTTGCTAGGAAGG + Intergenic
955509070 3:59661416-59661438 TGCTGGCGGGGTTCCTGGGAGGG - Intergenic
962848122 3:139288591-139288613 TGCCGGCCGGCTGGCCAGGACGG + Intronic
964303715 3:155318262-155318284 TGCAAGGAGGCTTACTGGGAAGG + Intergenic
964722659 3:159782835-159782857 TACAGGCAGCCTTGCTGTGATGG + Intronic
965165824 3:165193996-165194018 TACAGTCCTGCCTGCTGGGAAGG + Intronic
966803456 3:183786273-183786295 TGCAGGACCGTTTGCTGAGAGGG - Exonic
969408340 4:7010458-7010480 AGCAGGCCGGGTGGCTGGGGTGG + Intronic
970208224 4:13678359-13678381 AGCAGGCTGGCTTCCTGGGCTGG + Intergenic
976425776 4:84901449-84901471 TGGGGGCCTGCTTGCTGGAAGGG - Intronic
982072794 4:151710066-151710088 TGCAGGCCAGCTTGCTGAGGAGG - Intronic
983575723 4:169259702-169259724 TGGAGGCTGCCTTGCTGGTAAGG - Intronic
984321526 4:178203313-178203335 TGAGGGCCTGCTTGCTGGCAGGG + Intergenic
984582691 4:181528714-181528736 TGCAGCCAGGCTTTCTGGGATGG - Intergenic
986631852 5:9781784-9781806 TGCAGGGGGCCTTGCTGAGAAGG - Intergenic
991398023 5:66225012-66225034 TGGAGTGCGGCTTGGTGGGAGGG - Intergenic
997266103 5:132496282-132496304 AGCTGGCCGGCTTCCTGGAAAGG + Intergenic
997366164 5:133326583-133326605 TGCGGGCGGGCTTTCTGGCAGGG - Intronic
999709251 5:154301905-154301927 TGCTGGCTGGCTGGCTGGGTGGG - Intronic
1002168472 5:177362415-177362437 TGCTGGCCTGGTTGGTGGGAGGG - Intronic
1003993589 6:11514158-11514180 TGCGGGCTAGCTTGCTGGTAGGG + Intergenic
1005897635 6:30191581-30191603 TGCAGGCTGGCTTCCTGGAGAGG + Intronic
1006791827 6:36706496-36706518 TCCAGGCCAGCTTCCTGGTAGGG + Intronic
1006794745 6:36724692-36724714 TGCATGCCGGCTTGCCTGGTTGG - Intronic
1006905169 6:37528452-37528474 GGCAGGCAGGCTTGGTGGCAGGG - Intergenic
1007609817 6:43142128-43142150 TGCTGGCCAGCTCGCAGGGAGGG - Intronic
1008556709 6:52679452-52679474 TGCAGGTGTGCTTGCTGGGCAGG + Intronic
1012965563 6:105669386-105669408 TGCAGGCAGGCATGCAAGGAGGG + Intergenic
1013052840 6:106553969-106553991 ACCAGTCCGGCTTGCTGGGAGGG + Intronic
1017945225 6:159091095-159091117 TGCAGGCGGGCCTGCAGGGATGG - Intergenic
1019357383 7:587722-587744 TGCAGCCCTCCTGGCTGGGATGG + Intronic
1019884597 7:3892968-3892990 TGCAGCTCGGCCTCCTGGGAAGG - Intronic
1022359783 7:29646894-29646916 TGGAGGCTGGTTTTCTGGGATGG - Intergenic
1022368585 7:29749551-29749573 TGGAGGCTGGTTTTCTGGGATGG - Intergenic
1023957772 7:44901299-44901321 TGCAGGACGGATTGTTGGGCTGG + Intergenic
1024529859 7:50382810-50382832 TGCAGGACTGCGAGCTGGGAGGG - Intronic
1026956673 7:74380724-74380746 TGCAGGTGTGCTTGCTGGGCTGG + Intronic
1029494513 7:100889790-100889812 CGCAGGCAGGCTAGCTGGCACGG - Intergenic
1029621390 7:101692030-101692052 TGCTGGCTGGCTTCCTGGGCTGG - Intergenic
1030496229 7:110304389-110304411 TCCTGGCAGGCTTCCTGGGAAGG - Intergenic
1032490096 7:132318116-132318138 TGCAGGCCTGCTTGTTGTGTGGG - Intronic
1035270608 7:157717702-157717724 TGCAGGACCGCTGGCTGGGGTGG + Intronic
1037784947 8:21897092-21897114 GGCAGCCTGGCATGCTGGGAAGG + Intergenic
1038915146 8:32013132-32013154 TGCAGGAGGACTTGCTGGGATGG + Intronic
1040892746 8:52334860-52334882 TGCAGGTCGGCATGCGGGAATGG - Intronic
1042951763 8:74207387-74207409 TGCAGACTGGATTGCTGGCATGG + Intergenic
1049463997 8:142742836-142742858 TGCAGGCCAGGCTGCAGGGAAGG - Intergenic
1054847554 9:69812530-69812552 AGCAGGCTGGCTTCCTGGGCTGG + Intergenic
1056627626 9:88266571-88266593 AGCAGGCTGGCTTCCTGGGCTGG - Intergenic
1058981549 9:110175154-110175176 GGCAGGCAGGCGTGCTGGGAAGG + Intergenic
1060721589 9:125983242-125983264 GGCAGCCTGGCTTCCTGGGATGG - Intergenic
1061032856 9:128097278-128097300 TTCAGGCCGGCCTGCAGAGAGGG + Intronic
1062527747 9:136985146-136985168 TGCCGGCAGCCCTGCTGGGAGGG + Exonic
1062699276 9:137890613-137890635 TGCAGGCCGGGCTCCAGGGATGG + Intronic
1186733414 X:12434661-12434683 TGCAGGCAGGAATGATGGGAGGG + Intronic
1189270355 X:39747204-39747226 TGGAGGCAGGCTTACTGGGAAGG - Intergenic
1189682853 X:43534842-43534864 AGCAGGCTGGCTTCCTGGGCTGG - Intergenic
1192344490 X:70289980-70290002 CGCAGGCCGGCGCGGTGGGAAGG - Intronic
1192956873 X:76080910-76080932 TGCATGCCAGCTAGTTGGGAGGG - Intergenic
1193380635 X:80812442-80812464 TTCTGGCCGGCTTACTGGGTAGG - Intergenic
1199771059 X:150975697-150975719 TGCAGGCCTTCTGGATGGGATGG + Intergenic
1201283759 Y:12362142-12362164 TTCAAGGCGGCTTGCTGGGAAGG - Intergenic
1201401823 Y:13611682-13611704 AACTGCCCGGCTTGCTGGGAGGG + Intergenic