ID: 1077332927

View in Genome Browser
Species Human (GRCh38)
Location 11:1991240-1991262
Sequence CACCTGCAGGCCGGCTTGCT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 153
Summary {0: 2, 1: 0, 2: 0, 3: 8, 4: 143}

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1077332927_1077332937 3 Left 1077332927 11:1991240-1991262 CCCAGCAAGCCGGCCTGCAGGTG 0: 2
1: 0
2: 0
3: 8
4: 143
Right 1077332937 11:1991266-1991288 TTCCAGGAAGGGGCCCCCGCTGG No data
1077332927_1077332947 26 Left 1077332927 11:1991240-1991262 CCCAGCAAGCCGGCCTGCAGGTG 0: 2
1: 0
2: 0
3: 8
4: 143
Right 1077332947 11:1991289-1991311 CTTCCCTCAGCCCTGGAAGGGGG No data
1077332927_1077332943 19 Left 1077332927 11:1991240-1991262 CCCAGCAAGCCGGCCTGCAGGTG 0: 2
1: 0
2: 0
3: 8
4: 143
Right 1077332943 11:1991282-1991304 CCGCTGGCTTCCCTCAGCCCTGG No data
1077332927_1077332934 -9 Left 1077332927 11:1991240-1991262 CCCAGCAAGCCGGCCTGCAGGTG 0: 2
1: 0
2: 0
3: 8
4: 143
Right 1077332934 11:1991254-1991276 CTGCAGGTGGGCTTCCAGGAAGG 0: 2
1: 1
2: 0
3: 39
4: 330
1077332927_1077332945 24 Left 1077332927 11:1991240-1991262 CCCAGCAAGCCGGCCTGCAGGTG 0: 2
1: 0
2: 0
3: 8
4: 143
Right 1077332945 11:1991287-1991309 GGCTTCCCTCAGCCCTGGAAGGG No data
1077332927_1077332944 23 Left 1077332927 11:1991240-1991262 CCCAGCAAGCCGGCCTGCAGGTG 0: 2
1: 0
2: 0
3: 8
4: 143
Right 1077332944 11:1991286-1991308 TGGCTTCCCTCAGCCCTGGAAGG No data
1077332927_1077332936 -7 Left 1077332927 11:1991240-1991262 CCCAGCAAGCCGGCCTGCAGGTG 0: 2
1: 0
2: 0
3: 8
4: 143
Right 1077332936 11:1991256-1991278 GCAGGTGGGCTTCCAGGAAGGGG 0: 2
1: 1
2: 9
3: 75
4: 528
1077332927_1077332946 25 Left 1077332927 11:1991240-1991262 CCCAGCAAGCCGGCCTGCAGGTG 0: 2
1: 0
2: 0
3: 8
4: 143
Right 1077332946 11:1991288-1991310 GCTTCCCTCAGCCCTGGAAGGGG No data
1077332927_1077332935 -8 Left 1077332927 11:1991240-1991262 CCCAGCAAGCCGGCCTGCAGGTG 0: 2
1: 0
2: 0
3: 8
4: 143
Right 1077332935 11:1991255-1991277 TGCAGGTGGGCTTCCAGGAAGGG 0: 2
1: 1
2: 3
3: 26
4: 284

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1077332927 Original CRISPR CACCTGCAGGCCGGCTTGCT GGG (reversed) Intergenic
900192680 1:1358160-1358182 CTCCTGCAGCCCCTCTTGCTGGG - Intronic
900343178 1:2198320-2198342 CACCTGCAGACCGGTGGGCTAGG + Intronic
900414613 1:2529316-2529338 CTCCTGCGGGCCGGCCAGCTTGG + Exonic
900979554 1:6038741-6038763 CACCAGGAAGCCGGCTTCCTCGG - Intronic
901448047 1:9319952-9319974 CACCTGCAGGCCTGGTCCCTGGG + Intronic
901552022 1:10002623-10002645 CACCTGCAGTCCTGGCTGCTGGG - Intronic
902415068 1:16233637-16233659 CACCTCCAGGCCAGCCAGCTTGG + Exonic
903068994 1:20717444-20717466 CGCCTGCAGGGCGGCCTGCCGGG + Intronic
903359805 1:22769755-22769777 CACATGCAGGCTGGCTGGATGGG + Intronic
904400531 1:30253820-30253842 CACCTGCAGGGAGGCTTTCTTGG + Intergenic
916656786 1:166884021-166884043 CACTTTCAGGCCGGCTGGTTCGG + Intergenic
921069085 1:211643842-211643864 CCCCAGCAGGCCGGTGTGCTGGG + Intergenic
922703689 1:227777533-227777555 AACCTTCATGGCGGCTTGCTAGG + Intronic
1068529028 10:58163970-58163992 TACCTGCAGGACGGTTTGCCTGG + Intergenic
1069818551 10:71213579-71213601 CCTCGGCAGGCCGGCTTGCAGGG + Intronic
1071345112 10:84685037-84685059 CAGCGACAGGCCGGCTGGCTGGG - Intergenic
1072248999 10:93567144-93567166 CACCTGCAGCGCGGCGTGCGGGG + Exonic
1076504894 10:130965098-130965120 GACCTGGAGGCCAGCCTGCTGGG - Intergenic
1077332927 11:1991240-1991262 CACCTGCAGGCCGGCTTGCTGGG - Intergenic
1078359279 11:10655939-10655961 CCCCTGCAGGCAGGGCTGCTGGG - Intronic
1081770828 11:45649787-45649809 CACCTGCTGGCAGGCGTTCTGGG + Exonic
1081795088 11:45813212-45813234 CACCAGCAGGCAGCCTTTCTAGG + Intergenic
1083310856 11:61783012-61783034 CGACTGCAGGCTGGCTGGCTGGG - Intronic
1084690744 11:70724706-70724728 CACCTGCAGCCAGGCTCTCTGGG + Intronic
1085623954 11:78057831-78057853 CACCTGCAAGCAGGCTCCCTGGG - Intronic
1202815910 11_KI270721v1_random:46416-46438 CACCTGCAGGCCGGCTTGCTGGG - Intergenic
1094065588 12:26357887-26357909 AAGCTGCAGGGCGGCTAGCTCGG + Intronic
1096089519 12:48889642-48889664 CACCTGGAGCCCCGCTTTCTGGG + Intergenic
1100641254 12:96484188-96484210 CACCTGTAGGTCTGCCTGCTAGG - Intergenic
1103424110 12:120816635-120816657 CACCTGCAGTCCTGGCTGCTTGG - Intronic
1104444563 12:128823245-128823267 CACCTGCTGGCGGGATTCCTCGG + Intronic
1104783511 12:131435297-131435319 CACCTGCAGAATGCCTTGCTGGG + Intergenic
1104783521 12:131435355-131435377 CACCTGCAGAATGCCTTGCTGGG + Intergenic
1104783579 12:131435703-131435725 CACCTGCAGAATGCCTTGCTGGG + Intergenic
1105021872 12:132822090-132822112 CTCCTGGAGGCCATCTTGCTCGG + Exonic
1105576584 13:21658812-21658834 CACCTGCAGCCCAGGTTTCTGGG + Intergenic
1108574376 13:51778750-51778772 CACCTGCAGGAGGGCTGGCTGGG + Intronic
1112325959 13:98442988-98443010 CACCTGCAGCCCAGCTTTTTTGG + Intronic
1113175116 13:107554852-107554874 CACAAGCAGGCTGGCTTGCAGGG + Intronic
1114704429 14:24711001-24711023 CAGCTGCAGGCATGCTGGCTAGG - Intergenic
1119231863 14:72986310-72986332 CATCTGAAGGCTGGCTTGCCTGG - Intronic
1119483713 14:74975161-74975183 CACCTGGAGGCCGGCCAGCTTGG - Intergenic
1122230576 14:100304761-100304783 CACCTGAAAGCAGGCCTGCTTGG - Intronic
1124141476 15:27080921-27080943 CACCAGCAGGCTAGCTTGCCTGG - Intronic
1128215281 15:65930340-65930362 CTCCTGCAGGCAGCCTGGCTGGG - Intronic
1128537328 15:68500979-68501001 CAGCAGCAGGCCAGCCTGCTGGG - Intergenic
1130687772 15:86054009-86054031 CATCTGCATGTTGGCTTGCTTGG - Intergenic
1132809794 16:1792086-1792108 AACCTGCAGGGCGGCCAGCTGGG - Exonic
1135131113 16:19854563-19854585 GACCTGCAGGCTGGCTCTCTAGG - Intronic
1136466158 16:30445416-30445438 TGCCGGCAGGCCGGCTTCCTGGG + Exonic
1137026915 16:35486139-35486161 CACCTGCAGGTCCGGGTGCTGGG + Intergenic
1140263518 16:73400894-73400916 CACCAGCAGGCCTGGTGGCTGGG - Intergenic
1141161691 16:81633371-81633393 CACCTGCTGGCCTGTTGGCTCGG + Intronic
1142365179 16:89646347-89646369 CAGCAGCAGGGCGGCTCGCTTGG + Intronic
1145747212 17:27329180-27329202 CTGCTGCAGGCTGGGTTGCTGGG - Intergenic
1147428101 17:40355929-40355951 CACCTCGAGCCAGGCTTGCTGGG + Intronic
1147674029 17:42192729-42192751 CTCCTCCAGGCCACCTTGCTGGG - Exonic
1148335256 17:46836700-46836722 CACCTCCAGCCTGGCTTGCCAGG - Intronic
1148440435 17:47709084-47709106 CACGTGAAGGCCGGCTTCCAGGG + Exonic
1149685196 17:58531188-58531210 CACCTCCAGGGAGGCTGGCTGGG + Intronic
1149758399 17:59207339-59207361 CACCTGCACTCCAGCCTGCTGGG + Intronic
1152651183 17:81493879-81493901 CATCTCCAGGCCGCCATGCTGGG - Intergenic
1152918074 17:83052132-83052154 CAACTCCAGGCCGCCTGGCTTGG - Intergenic
1154126989 18:11700396-11700418 CTCCTGCAGGCCGTTTGGCTTGG + Intronic
1156745021 18:40379984-40380006 CACCTGCAGTCCCAGTTGCTAGG + Intergenic
1158391751 18:57050445-57050467 CTCCTGCAGGCAGGCCTCCTGGG + Intergenic
1158586375 18:58739706-58739728 AACCTGCAGGCAGGCAGGCTGGG - Intronic
1159006827 18:63020604-63020626 CACCTGCTGGACTGCCTGCTAGG - Intergenic
1159023953 18:63166090-63166112 CAGCTGCTGGCTGGCTTCCTCGG + Intronic
1160380457 18:78450929-78450951 CACATGAAGGCCGTCTTGCAGGG - Intergenic
1160765743 19:806858-806880 GACCAGCAGGGCGGCCTGCTGGG - Intronic
1160767525 19:815079-815101 CACCTGCAGGGCGGAAGGCTCGG + Exonic
1160778958 19:869343-869365 CACCTCCAGGCCGGGTGTCTGGG - Intronic
1160936840 19:1600148-1600170 CGCCAGCAGGCGGGTTTGCTGGG - Intronic
1161816371 19:6502175-6502197 CACCTGCAGGCCGGCCAGTGCGG - Exonic
1162910678 19:13846607-13846629 CACATGCAGGGCTGCCTGCTGGG + Intergenic
1163697007 19:18769088-18769110 CACCTGAAGCCAGGCTTCCTAGG + Intronic
1165014532 19:32870984-32871006 AACCTGCCCACCGGCTTGCTGGG + Intergenic
1165885642 19:39076337-39076359 CACCTGCAGTCCCAGTTGCTCGG + Intergenic
1168206842 19:54856539-54856561 CAGGTGCATGCCGGCATGCTTGG - Intronic
1168500759 19:56891044-56891066 CACCTGCAGTCCGAGTTACTTGG - Intergenic
927911943 2:26905895-26905917 CACCTGGATGGCGGCTTGCGAGG - Intronic
931396879 2:61895643-61895665 AATCTGCAGGCCTGCTTCCTGGG - Intronic
935431367 2:102979616-102979638 CACCTGCAGGCCTGTTTCCATGG + Intergenic
940916839 2:159265563-159265585 CACTTGCAGGCCACCATGCTTGG - Intronic
945305528 2:208255347-208255369 CACCTGCAGGCCGGGGAGCGGGG + Intronic
947765780 2:232636264-232636286 CACTTGGAGGCAGGCTTCCTGGG + Intronic
947771695 2:232675487-232675509 CACCTGCACACCGGCTTCCCAGG + Intronic
947774646 2:232697731-232697753 CAGTGTCAGGCCGGCTTGCTCGG + Intronic
948841391 2:240651333-240651355 CACCTGCAGCACGGCCAGCTGGG - Intergenic
948975226 2:241459697-241459719 GGCCTGCAGCCCAGCTTGCTGGG + Intronic
1169903980 20:10581794-10581816 CACCTGGAGTCCTACTTGCTTGG + Intronic
1170200773 20:13741362-13741384 CACCTGTAGGCCAGCTTGTATGG - Intronic
1170729426 20:18960120-18960142 CACCTGCAGGCCAGAGTCCTTGG - Intergenic
1171459458 20:25290736-25290758 CGCCTGCAGCCCGGCTGGCTAGG - Intronic
1174139147 20:48400656-48400678 GACCTGCAGCTGGGCTTGCTTGG - Intergenic
1174159861 20:48543046-48543068 CCCCTGCCGTCTGGCTTGCTTGG - Intergenic
1174178015 20:48657171-48657193 CACCTGCAGGCCAGCCACCTGGG + Exonic
1175228297 20:57458076-57458098 CTCCTGCAGGCAGGCCTCCTGGG - Intergenic
1175269107 20:57721294-57721316 CACCTGCAGGTGGGCTTCCCTGG - Intergenic
1175822792 20:61919505-61919527 CACCTGCAGGCAGGCAGGCCAGG - Intronic
1179834984 21:44025150-44025172 GCCCTGCAGGGCGGGTTGCTGGG + Intronic
1184100302 22:42338459-42338481 CCCCTGCAGGCCGGGCTGCCGGG - Intronic
1184348559 22:43927928-43927950 CACCTGCAGGACAGGTTCCTTGG - Intronic
1184453492 22:44596598-44596620 CAGCTGCAGGCTGGGTTGCAGGG - Intergenic
950572323 3:13809138-13809160 CACCTGCAGGCCGGCACACCTGG - Intergenic
950635074 3:14308513-14308535 CTCCTGCAGCCCTGCTTGGTTGG - Intergenic
951160042 3:19407965-19407987 AACCTGCTGGCAGACTTGCTTGG + Intronic
952374708 3:32756509-32756531 CCACTTCAGGCAGGCTTGCTGGG - Intronic
954329350 3:49881251-49881273 CCCCTCTAGGCAGGCTTGCTAGG + Intergenic
967298588 3:187989975-187989997 CACCTGCACACCAGCTTCCTGGG + Intergenic
970072887 4:12182308-12182330 CACCTGCAGTCCAGCTTTCAGGG - Intergenic
974901074 4:67998890-67998912 CACCTGCAGGCTAGCTTGCCAGG + Intergenic
983579274 4:169291742-169291764 CAGCTGTAGGCTGGGTTGCTGGG + Intergenic
986190848 5:5494899-5494921 CACCTGCCGGCAGGCCTGCGGGG - Intergenic
987947014 5:24623186-24623208 CATCTGCAGGACTGCTGGCTTGG - Intronic
991975760 5:72182574-72182596 CACCTGGAAGTGGGCTTGCTGGG + Intronic
995395391 5:111681670-111681692 CACATGCAGCCCTGGTTGCTGGG - Intronic
998424436 5:142014438-142014460 CAGCTCCAGACCAGCTTGCTAGG + Intergenic
1001527622 5:172440018-172440040 AACCTGAAGGCTGGCTTTCTAGG + Intronic
1002052285 5:176577832-176577854 CACATGCACGCCCGCTTGCTGGG - Intronic
1002615173 5:180448629-180448651 CAGGTGCAGGCCGGCATGCCCGG + Intergenic
1006513212 6:34532706-34532728 CACCTGGAGGCTGGGGTGCTGGG + Exonic
1008919426 6:56826129-56826151 CACTTGCAGGCTGTCTTTCTAGG - Intronic
1013986334 6:116198603-116198625 CACCTGCAGTCCTACCTGCTTGG + Intronic
1015013594 6:128382055-128382077 CACCTGTAGTCCCACTTGCTAGG + Intronic
1018169688 6:161134870-161134892 GCCCTGCAGGCAGGCTTGATGGG - Exonic
1019018714 6:168900199-168900221 AACGTGCAGGCCGGCATCCTTGG + Intergenic
1023767186 7:43522596-43522618 CAGCTGCAGGCCTGCTTGGAGGG - Intronic
1026020446 7:66700993-66701015 CTCCTCCAGGACGGCTTCCTTGG - Intronic
1031953718 7:127920380-127920402 CCTCTGCAGGGTGGCTTGCTAGG - Intronic
1032031262 7:128485686-128485708 CACGTGCATGCCAGCATGCTTGG - Intronic
1033044559 7:137949849-137949871 CAACTCCAGGCCGAGTTGCTGGG + Intronic
1035066142 7:156106223-156106245 CGCCTGCAGACAGGCTTTCTGGG + Intergenic
1035925371 8:3722181-3722203 CACCTGCAGGCCCACCTACTCGG + Intronic
1038011632 8:23480884-23480906 CACCAGCAGGCAGGGGTGCTGGG + Intergenic
1041711386 8:60897984-60898006 CACCTGCAGTCCTGGTTACTTGG + Intergenic
1042784857 8:72536518-72536540 CACCTGCAGCCCCGCTCGCTCGG - Intergenic
1043655683 8:82662699-82662721 GACCTGCAGGTAGGCCTGCTTGG - Intergenic
1056219614 9:84438166-84438188 CACCTGCTGGCCTGCAGGCTGGG + Intergenic
1057207778 9:93184015-93184037 CACCTGCGGGCCGGCTACCTGGG - Intergenic
1060292897 9:122320480-122320502 CACCTGCAGGCTGGCAGCCTGGG - Intronic
1060930388 9:127486190-127486212 CACCTGCTGGCTTGCTTCCTTGG - Intronic
1061591716 9:131602211-131602233 CACTTGCAGGCAGGAATGCTGGG - Intronic
1061733171 9:132632587-132632609 CACCTCAAGGCCAGCTTGTTAGG - Intronic
1061972242 9:134051040-134051062 CACCTGCATGCCGGGTTCCCAGG + Intronic
1062599346 9:137312955-137312977 CACCTGCAGGCCTGCAGCCTGGG - Intronic
1062616176 9:137396995-137397017 CACCTGCAGGAGGGGCTGCTGGG + Intronic
1187250674 X:17595172-17595194 CAGATGCAGGCTGCCTTGCTGGG + Intronic
1188261642 X:28031137-28031159 CATCAGCATGCCCGCTTGCTAGG - Intergenic
1189298422 X:39935415-39935437 CACCAGCAGGCAGGCTGGCAAGG - Intergenic
1193380637 X:80812446-80812468 CTCCTTCTGGCCGGCTTACTGGG - Intergenic
1197183393 X:123561657-123561679 CACCTGCAGGCCGGCCAGTGTGG + Intergenic