ID: 1077332928

View in Genome Browser
Species Human (GRCh38)
Location 11:1991241-1991263
Sequence CCACCTGCAGGCCGGCTTGC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 191
Summary {0: 2, 1: 0, 2: 0, 3: 16, 4: 173}

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1077332928_1077332945 23 Left 1077332928 11:1991241-1991263 CCAGCAAGCCGGCCTGCAGGTGG 0: 2
1: 0
2: 0
3: 16
4: 173
Right 1077332945 11:1991287-1991309 GGCTTCCCTCAGCCCTGGAAGGG No data
1077332928_1077332937 2 Left 1077332928 11:1991241-1991263 CCAGCAAGCCGGCCTGCAGGTGG 0: 2
1: 0
2: 0
3: 16
4: 173
Right 1077332937 11:1991266-1991288 TTCCAGGAAGGGGCCCCCGCTGG No data
1077332928_1077332936 -8 Left 1077332928 11:1991241-1991263 CCAGCAAGCCGGCCTGCAGGTGG 0: 2
1: 0
2: 0
3: 16
4: 173
Right 1077332936 11:1991256-1991278 GCAGGTGGGCTTCCAGGAAGGGG 0: 2
1: 1
2: 9
3: 75
4: 528
1077332928_1077332947 25 Left 1077332928 11:1991241-1991263 CCAGCAAGCCGGCCTGCAGGTGG 0: 2
1: 0
2: 0
3: 16
4: 173
Right 1077332947 11:1991289-1991311 CTTCCCTCAGCCCTGGAAGGGGG No data
1077332928_1077332934 -10 Left 1077332928 11:1991241-1991263 CCAGCAAGCCGGCCTGCAGGTGG 0: 2
1: 0
2: 0
3: 16
4: 173
Right 1077332934 11:1991254-1991276 CTGCAGGTGGGCTTCCAGGAAGG 0: 2
1: 1
2: 0
3: 39
4: 330
1077332928_1077332943 18 Left 1077332928 11:1991241-1991263 CCAGCAAGCCGGCCTGCAGGTGG 0: 2
1: 0
2: 0
3: 16
4: 173
Right 1077332943 11:1991282-1991304 CCGCTGGCTTCCCTCAGCCCTGG No data
1077332928_1077332935 -9 Left 1077332928 11:1991241-1991263 CCAGCAAGCCGGCCTGCAGGTGG 0: 2
1: 0
2: 0
3: 16
4: 173
Right 1077332935 11:1991255-1991277 TGCAGGTGGGCTTCCAGGAAGGG 0: 2
1: 1
2: 3
3: 26
4: 284
1077332928_1077332946 24 Left 1077332928 11:1991241-1991263 CCAGCAAGCCGGCCTGCAGGTGG 0: 2
1: 0
2: 0
3: 16
4: 173
Right 1077332946 11:1991288-1991310 GCTTCCCTCAGCCCTGGAAGGGG No data
1077332928_1077332944 22 Left 1077332928 11:1991241-1991263 CCAGCAAGCCGGCCTGCAGGTGG 0: 2
1: 0
2: 0
3: 16
4: 173
Right 1077332944 11:1991286-1991308 TGGCTTCCCTCAGCCCTGGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1077332928 Original CRISPR CCACCTGCAGGCCGGCTTGC TGG (reversed) Intergenic
900126756 1:1072188-1072210 CCAGCTGCAGGCCCGGATGCCGG - Exonic
900192681 1:1358161-1358183 CCTCCTGCAGCCCCTCTTGCTGG - Intronic
900242428 1:1623464-1623486 CCACCTGCACGCCCGCCTGGGGG - Exonic
900981364 1:6047954-6047976 CCACCTGCAGGTCTGCTCCCAGG + Intronic
901053377 1:6437163-6437185 CCTCCTGCAGGGCCGCTGGCTGG - Intronic
901057873 1:6457209-6457231 CCGCCTCCAGGCGGGCATGCTGG - Exonic
901217288 1:7561848-7561870 CCTCCTCCAGGCCGGCGTGCAGG - Intronic
901448046 1:9319951-9319973 CCACCTGCAGGCCTGGTCCCTGG + Intronic
901816077 1:11794282-11794304 CCAGCTGCAGGCCAGGCTGCGGG - Intronic
902476479 1:16691250-16691272 CCACCTCCAGGCGGGCATGCTGG + Intergenic
902480899 1:16711000-16711022 CCTCCTGCAGGGCCGCTGGCTGG + Intergenic
902622118 1:17656653-17656675 CCACCTGCTCGCTGGCCTGCAGG + Exonic
903068993 1:20717443-20717465 CCGCCTGCAGGGCGGCCTGCCGG + Intronic
904591910 1:31619629-31619651 CCACCAGCAGGCTGGCCGGCAGG - Exonic
905105412 1:35560799-35560821 CGACCTGCTGGCCGTGTTGCGGG + Exonic
907959557 1:59265823-59265845 CCAGCTGCAGGAAGGATTGCCGG + Intergenic
911274071 1:95840139-95840161 CCACCTGCAGGCCTGGAGGCTGG - Intergenic
911589435 1:99729602-99729624 CCACCTGGAGACCCGCTTTCCGG - Intronic
914418333 1:147505160-147505182 CCACCTGCTGGCTAGCTGGCTGG + Intergenic
915359654 1:155278193-155278215 CCTCCTCCAGTCCTGCTTGCTGG + Intronic
917472199 1:175335346-175335368 TGACCTGCAGGCTGGCTGGCTGG + Intronic
917959461 1:180130806-180130828 CCATCTGCAGGCTGGCGTGGTGG - Intergenic
920215835 1:204361032-204361054 CAACCTCCAGGCAGGCTCGCTGG + Intronic
1063381548 10:5589112-5589134 CCACCTGCAGGGCCTCTGGCTGG + Intergenic
1069818549 10:71213578-71213600 GCCTCGGCAGGCCGGCTTGCAGG + Intronic
1070721535 10:78760563-78760585 GCACCTGCAGGCCTGCATCCTGG - Intergenic
1072248998 10:93567143-93567165 GCACCTGCAGCGCGGCGTGCGGG + Exonic
1075600236 10:123762085-123762107 CAACCTGCAGGGCGGCGAGCTGG - Exonic
1075641382 10:124066966-124066988 CCAGCTGCAGAGCGCCTTGCGGG - Intronic
1077011708 11:381672-381694 CCACCTCCAGCCCTGCCTGCAGG - Exonic
1077038101 11:504772-504794 CCACAAGCAGGCCGGATTCCAGG + Intronic
1077076146 11:703102-703124 CCACCTGCAGGACGGCCTCCAGG - Exonic
1077332928 11:1991241-1991263 CCACCTGCAGGCCGGCTTGCTGG - Intergenic
1077484353 11:2832021-2832043 CCACCTCCAGGCAGCCCTGCAGG + Intronic
1077484354 11:2832024-2832046 CCACCTGCAGGGCTGCCTGGAGG - Intronic
1081458574 11:43249774-43249796 CCACCTGCTGGTCAGCTTGCAGG + Intergenic
1081869141 11:46375425-46375447 CCACCTGCAGCGCGGCCTGTGGG - Exonic
1082822246 11:57552024-57552046 CACCTTGCAGGCCTGCTTGCAGG - Exonic
1083310857 11:61783013-61783035 CCGACTGCAGGCTGGCTGGCTGG - Intronic
1085168593 11:74427686-74427708 CCACCTTCAGGCTTGCCTGCTGG + Intergenic
1085623955 11:78057832-78057854 CCACCTGCAAGCAGGCTCCCTGG - Intronic
1089616329 11:119696795-119696817 CCGCCTGCAGTCCTGCTTTCCGG - Intronic
1202815911 11_KI270721v1_random:46417-46439 CCACCTGCAGGCCGGCTTGCTGG - Intergenic
1092139403 12:6172355-6172377 CAAGCTGCAGGCTGCCTTGCAGG - Intergenic
1097641747 12:62191255-62191277 CTACCTGCAGCCCCGCTTCCCGG + Exonic
1104980440 12:132570994-132571016 CCACCCGCAGGCCAGCATCCTGG - Intronic
1106405018 13:29465735-29465757 CCCCCAGCATGCCGGCTGGCTGG - Intronic
1107765909 13:43734317-43734339 TTACCTGCAGCCCTGCTTGCAGG - Intronic
1108574375 13:51778749-51778771 TCACCTGCAGGAGGGCTGGCTGG + Intronic
1112432209 13:99359861-99359883 CCCCCTGCAGGCCACCATGCAGG - Intronic
1113175115 13:107554851-107554873 TCACAAGCAGGCTGGCTTGCAGG + Intronic
1113880104 13:113620144-113620166 CCACCCACAGGCCGGCCGGCTGG - Intronic
1116954722 14:50912116-50912138 CCACCTGCAAGGGGGCTTGTTGG + Intronic
1117453235 14:55872651-55872673 CCACTTGCAGGCAGGTTGGCTGG - Intergenic
1118326801 14:64786760-64786782 CCAGCTGCAGGCCTTCCTGCAGG - Exonic
1119643438 14:76330946-76330968 CCATCTGCAGGCTGTCTAGCAGG - Intronic
1121411431 14:93751080-93751102 CCACCTGCTGGCCGGGACGCAGG + Intronic
1122393686 14:101407825-101407847 CCACCTGCATGCAGGCATGGTGG - Intergenic
1123020165 14:105394284-105394306 CCACCTGCAGGCAGCCCTGGGGG + Intronic
1127525972 15:59792242-59792264 GCAGCTGGGGGCCGGCTTGCAGG - Intergenic
1129960676 15:79681565-79681587 CCAGGTGCTGGCCGGCTTGCAGG - Intergenic
1130536752 15:84790865-84790887 CCACCTGTAGCCCACCTTGCGGG - Exonic
1132725912 16:1338311-1338333 CCCCCTGCAGGGCGGCTTCAGGG - Intronic
1132809795 16:1792087-1792109 CAACCTGCAGGGCGGCCAGCTGG - Exonic
1132866889 16:2097491-2097513 CCACCTGCAGTCTGGTGTGCTGG - Exonic
1133034690 16:3028258-3028280 CCACCTGCATGTCGTCCTGCGGG + Exonic
1134524875 16:14935612-14935634 CCACCTGCAGTCTGGTGTGCTGG + Intronic
1134548023 16:15125313-15125335 CCACCTGCAGTCTGGTGTGCTGG - Intronic
1134712464 16:16334099-16334121 CCACCTGCAGTCTGGTGTGCTGG + Intergenic
1134720329 16:16377411-16377433 CCACCTGCAGTCTGGTGTGCTGG + Intergenic
1134947098 16:18334474-18334496 CCACCTGCAGTCTGGTGTGCTGG - Intronic
1134954363 16:18374595-18374617 CCACCTGCAGTCTGGTGTGCTGG - Intergenic
1136466157 16:30445415-30445437 CTGCCGGCAGGCCGGCTTCCTGG + Exonic
1137026914 16:35486138-35486160 CCACCTGCAGGTCCGGGTGCTGG + Intergenic
1138459145 16:57137826-57137848 CCAGCTGCAGGCTGGCTCCCAGG + Intronic
1138998284 16:62478556-62478578 CCACCTGCAGGTTGGCAAGCTGG - Intergenic
1141804524 16:86334070-86334092 CCACGTGCCAGCCGGCTTTCTGG + Intergenic
1142288879 16:89183634-89183656 CCTCCTGCAGGAAGGCTGGCCGG - Exonic
1142292173 16:89198236-89198258 CCGCCTCCAGGCCGGCCTCCAGG + Exonic
1142581289 17:944637-944659 CCTCCTACCGGCTGGCTTGCTGG - Intronic
1143165934 17:4897330-4897352 CCCCCTGCAGCCAGGCTTCCCGG + Exonic
1144755995 17:17681237-17681259 CCTCCCGCAGGCCGGCCAGCGGG + Intergenic
1144755996 17:17681240-17681262 CCGCCCGCTGGCCGGCCTGCGGG - Intergenic
1144882699 17:18438830-18438852 CCACCTGCAGGCCGGTGGGAGGG - Intergenic
1145149534 17:20505556-20505578 CCACCTGCAGGCCGGTGGGAGGG + Intergenic
1146319899 17:31838985-31839007 CCACCTGGAGTCCTGCATGCAGG - Intergenic
1147428100 17:40355928-40355950 CCACCTCGAGCCAGGCTTGCTGG + Intronic
1147674030 17:42192730-42192752 CCTCCTCCAGGCCACCTTGCTGG - Exonic
1148440434 17:47709083-47709105 CCACGTGAAGGCCGGCTTCCAGG + Exonic
1149758398 17:59207338-59207360 CCACCTGCACTCCAGCCTGCTGG + Intronic
1150425192 17:65072036-65072058 CCAGCTGCATGCCGGCTCTCAGG - Intergenic
1152475526 17:80515534-80515556 CGACCTGAAGGCCGGCTGCCAGG - Intergenic
1158391750 18:57050444-57050466 CCTCCTGCAGGCAGGCCTCCTGG + Intergenic
1160380458 18:78450930-78450952 ACACATGAAGGCCGTCTTGCAGG - Intergenic
1161291614 19:3496736-3496758 GCCCCTGCAGGCCCGCTTCCGGG - Exonic
1161727204 19:5936417-5936439 CCACATGCAGGCAGGCAGGCAGG + Intronic
1164156569 19:22601031-22601053 CCACCTGCAGGTCTTCCTGCAGG + Intergenic
1164746862 19:30622808-30622830 CCACCTGCAGGCCACCTCACCGG + Intronic
1165159905 19:33810023-33810045 CCACCTGCTGGCCGCCTGGAGGG - Intronic
1166892635 19:46003024-46003046 CCACCTGCAGGCCAGCCGGCTGG - Exonic
1167382348 19:49146013-49146035 CCCCCTGCCGGCCGCCTTGGGGG + Intronic
1167587201 19:50381955-50381977 CCACCTGCAGGCCTGCGGGGCGG - Exonic
1202710498 1_KI270714v1_random:17091-17113 CCACCTCCAGGCGGGCATGCTGG + Intergenic
1202714936 1_KI270714v1_random:36905-36927 CCTCCTGCAGGGCCGCTGGCTGG + Intergenic
925174596 2:1773340-1773362 CCTCCTGGAGGCCGCCCTGCTGG - Intergenic
925640199 2:5979619-5979641 CTACCTGCAGGCTGACTTGCTGG - Intergenic
930236102 2:48890179-48890201 GCAGCTGCAGGCAGGCTTGCTGG + Intergenic
932245155 2:70190687-70190709 TCACCTCCCGGCCGGCTTCCGGG + Intronic
938341139 2:130537470-130537492 ACTCCTGCAGGCGGGCCTGCCGG + Intergenic
938341140 2:130537473-130537495 TCACCGGCAGGCCCGCCTGCAGG - Intergenic
938348690 2:130583236-130583258 TCACCGGCAGGCCCGCCTGCAGG + Intronic
938348691 2:130583239-130583261 ACTCCTGCAGGCGGGCCTGCCGG - Intronic
938813958 2:134880687-134880709 CCACCTGGAGGAAGACTTGCAGG - Intronic
945305527 2:208255346-208255368 CCACCTGCAGGCCGGGGAGCGGG + Intronic
1170348206 20:15410742-15410764 CCATCTGCAAGCACGCTTGCAGG + Intronic
1174178014 20:48657170-48657192 CCACCTGCAGGCCAGCCACCTGG + Exonic
1179600678 21:42475692-42475714 CCCACTGCAGCCAGGCTTGCAGG + Intronic
1179627218 21:42655499-42655521 CCACCTGCAGGCTGCTTTTCTGG - Intronic
1180089905 21:45528550-45528572 TACCCTGCAGGCCGGCATGCGGG - Intronic
1180249072 21:46567559-46567581 GCACCTGCGGGACGGCTTCCTGG + Exonic
1180982474 22:19885317-19885339 CCAGCTGCTGGCCGGTATGCGGG + Intronic
1182603979 22:31489522-31489544 CTACCCGCCGGCCGCCTTGCGGG + Exonic
1183583758 22:38740353-38740375 CCTGCTGCAGGCCGGCCAGCTGG + Exonic
1184100304 22:42338460-42338482 GCCCCTGCAGGCCGGGCTGCCGG - Intronic
1184453493 22:44596599-44596621 GCAGCTGCAGGCTGGGTTGCAGG - Intergenic
1185087728 22:48749728-48749750 CCTCCAGGAGGCCGGCTGGCAGG + Intronic
949547046 3:5081370-5081392 CCACCTTCGGGCCAGCGTGCAGG + Intergenic
950855350 3:16099448-16099470 CTGCCTGCAGGCCTGCCTGCTGG - Intergenic
952374710 3:32756510-32756532 CCCACTTCAGGCAGGCTTGCTGG - Intronic
953326053 3:42013529-42013551 CCACCTGCGGGCCGCCCTCCAGG - Intergenic
953661919 3:44897437-44897459 CCAACTGGAGCCCAGCTTGCAGG - Intronic
953981322 3:47414553-47414575 CCACCTGCAGGCCGCTTACCTGG + Exonic
955913138 3:63878939-63878961 TCACCTGCTGGCCAGCTTCCAGG - Intronic
958732329 3:97972490-97972512 CCACTTGCGGGCCGGCGTGGCGG - Intergenic
963526550 3:146422414-146422436 CCACCTGCAGGCTGGGTGGGTGG - Intronic
967930651 3:194687936-194687958 CACCCTGCAGGCCGACTTGCGGG + Exonic
968067498 3:195766827-195766849 CCAGCTGCTGACCGGCTAGCGGG - Intronic
968550083 4:1217591-1217613 CCACCGGCAGCCCGACTTCCGGG - Intronic
968757382 4:2423849-2423871 GCACCTCCAGGCAGCCTTGCTGG + Intronic
968910934 4:3476626-3476648 CCACTTGCAGGCTGGCCTGCTGG + Intronic
969456376 4:7302060-7302082 GTACCTGCATCCCGGCTTGCCGG + Intronic
970072888 4:12182309-12182331 TCACCTGCAGTCCAGCTTTCAGG - Intergenic
974896097 4:67940976-67940998 CCACCTGCAGGATGGCCAGCCGG + Intronic
978835560 4:113145696-113145718 CCATCTGCTAGCTGGCTTGCTGG - Intronic
983207942 4:164930779-164930801 CCACCTGCAGGAAGCCCTGCAGG + Intergenic
986190849 5:5494900-5494922 GCACCTGCCGGCAGGCCTGCGGG - Intergenic
991975759 5:72182573-72182595 CCACCTGGAAGTGGGCTTGCTGG + Intronic
1002052286 5:176577833-176577855 ACACATGCACGCCCGCTTGCTGG - Intronic
1003073031 6:2959579-2959601 CCACGTGCGGGCAGGCGTGCAGG - Exonic
1006501380 6:34461252-34461274 CCACCTCCATGCAGGTTTGCAGG + Intergenic
1006510006 6:34516511-34516533 CCTCCTGCAGCCAGGCCTGCTGG + Intronic
1006513211 6:34532705-34532727 CCACCTGGAGGCTGGGGTGCTGG + Exonic
1006818863 6:36874610-36874632 CCACGTGGAGGCCGGCCTCCCGG + Intronic
1007232753 6:40359989-40360011 CCACCTGCAGTCCTGCTCACAGG - Intergenic
1007371273 6:41428175-41428197 CCTCCGGAAGGCCGGCTTCCCGG - Intergenic
1007447756 6:41920409-41920431 CCACCTGCAGACAGGGTTGGAGG - Intronic
1011258652 6:85449979-85450001 CAGCCTGGAGGCCGGCTTGGCGG - Intronic
1012475841 6:99613994-99614016 CCACCTGCCCGCCGTCATGCCGG + Exonic
1018892681 6:167994026-167994048 CCCACTGCAGCCCTGCTTGCTGG + Intergenic
1019469502 7:1211237-1211259 CCGCCTGCTGGCCGGCTGCCAGG + Intergenic
1019989693 7:4682749-4682771 CCACCTGCAGCTCAGCTTCCAGG + Exonic
1023767187 7:43522597-43522619 GCAGCTGCAGGCCTGCTTGGAGG - Intronic
1027173023 7:75886149-75886171 CCACATCCAGGCCAGCGTGCAGG - Intronic
1027263485 7:76481047-76481069 CCACCTCCATGCCGGCCTGCCGG - Intronic
1027314856 7:76979146-76979168 CCACCTCCATGCTGGCCTGCCGG - Intergenic
1029680813 7:102107827-102107849 CCACCTGGAGCCCTGGTTGCCGG + Intronic
1029685182 7:102142354-102142376 CCACCTGTAGGAAGGTTTGCTGG + Intronic
1033447715 7:141436973-141436995 CCTCCTGCAGCCCTGCATGCAGG + Intronic
1034939933 7:155224039-155224061 CCAACTGCAGGAAGGCTTCCAGG - Intergenic
1038011631 8:23480883-23480905 CCACCAGCAGGCAGGGGTGCTGG + Intergenic
1039476577 8:37842049-37842071 CCAGCTGCAGGCCGGCGCCCGGG - Exonic
1047994900 8:130325000-130325022 TCACCGGCAGCCCTGCTTGCAGG + Intronic
1049151182 8:141036468-141036490 TCACCTGCTTGCAGGCTTGCAGG + Intergenic
1051170585 9:14315419-14315441 CCTCCTGCAGCCCCGCTGGCTGG + Intronic
1056771974 9:89484155-89484177 CCAGCTGCAGGTGGGCCTGCAGG - Intronic
1057207779 9:93184016-93184038 CCACCTGCGGGCCGGCTACCTGG - Intergenic
1057486226 9:95486640-95486662 CCCCGTGCTGGCCAGCTTGCTGG - Intronic
1057801258 9:98192663-98192685 CCCCCTGCAGCCCGGCGGGCGGG + Intergenic
1060193115 9:121605436-121605458 CCACCTGCAGGCTGAATTTCAGG + Intronic
1061591717 9:131602212-131602234 CCACTTGCAGGCAGGAATGCTGG - Intronic
1062122235 9:134839893-134839915 CCACCCCCAGGCGGGCTTGTGGG + Intronic
1062289190 9:135786969-135786991 CCAGCTGCAGCCAGGCCTGCTGG + Intronic
1062378139 9:136274176-136274198 CCACCTGGAGGCCAGCCTGGAGG + Intergenic
1186130613 X:6461597-6461619 CCACCTGCCCGGTGGCTTGCAGG - Intergenic
1191062881 X:56318249-56318271 CAACATGGAGGCTGGCTTGCAGG - Intergenic
1192937827 X:75879828-75879850 TCACCTCCAGGCCTGCCTGCAGG - Intergenic
1193380638 X:80812447-80812469 CCTCCTTCTGGCCGGCTTACTGG - Intergenic
1194335684 X:92643797-92643819 CCATCTGCAGGCAGCCTTTCTGG - Intergenic
1195138191 X:101931821-101931843 CCACCGGCAGGCGGGCAGGCAGG + Intronic
1200077767 X:153560117-153560139 CCACCAGCAGGCCTGGCTGCAGG - Intronic
1200644113 Y:5760548-5760570 CCATCTGCAGGCAGCCTTTCTGG - Intergenic