ID: 1077332930

View in Genome Browser
Species Human (GRCh38)
Location 11:1991242-1991264
Sequence CAGCAAGCCGGCCTGCAGGT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 189
Summary {0: 2, 1: 0, 2: 0, 3: 19, 4: 168}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1077332921_1077332930 0 Left 1077332921 11:1991219-1991241 CCTCTGCGAGAGCAGCCCCTTCC 0: 2
1: 0
2: 2
3: 17
4: 238
Right 1077332930 11:1991242-1991264 CAGCAAGCCGGCCTGCAGGTGGG 0: 2
1: 0
2: 0
3: 19
4: 168
1077332917_1077332930 29 Left 1077332917 11:1991190-1991212 CCAGGAAACGGCTGCAGGGCGGG 0: 2
1: 0
2: 1
3: 25
4: 174
Right 1077332930 11:1991242-1991264 CAGCAAGCCGGCCTGCAGGTGGG 0: 2
1: 0
2: 0
3: 19
4: 168

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1077332930 Original CRISPR CAGCAAGCCGGCCTGCAGGT GGG Intergenic