ID: 1077332931

View in Genome Browser
Species Human (GRCh38)
Location 11:1991249-1991271
Sequence CTGGAAGCCCACCTGCAGGC CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 366
Summary {0: 2, 1: 0, 2: 1, 3: 35, 4: 328}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1077332931_1077332950 24 Left 1077332931 11:1991249-1991271 CCGGCCTGCAGGTGGGCTTCCAG 0: 2
1: 0
2: 1
3: 35
4: 328
Right 1077332950 11:1991296-1991318 CAGCCCTGGAAGGGGGCCAACGG 0: 2
1: 0
2: 2
3: 41
4: 385
1077332931_1077332944 14 Left 1077332931 11:1991249-1991271 CCGGCCTGCAGGTGGGCTTCCAG 0: 2
1: 0
2: 1
3: 35
4: 328
Right 1077332944 11:1991286-1991308 TGGCTTCCCTCAGCCCTGGAAGG No data
1077332931_1077332947 17 Left 1077332931 11:1991249-1991271 CCGGCCTGCAGGTGGGCTTCCAG 0: 2
1: 0
2: 1
3: 35
4: 328
Right 1077332947 11:1991289-1991311 CTTCCCTCAGCCCTGGAAGGGGG No data
1077332931_1077332943 10 Left 1077332931 11:1991249-1991271 CCGGCCTGCAGGTGGGCTTCCAG 0: 2
1: 0
2: 1
3: 35
4: 328
Right 1077332943 11:1991282-1991304 CCGCTGGCTTCCCTCAGCCCTGG No data
1077332931_1077332945 15 Left 1077332931 11:1991249-1991271 CCGGCCTGCAGGTGGGCTTCCAG 0: 2
1: 0
2: 1
3: 35
4: 328
Right 1077332945 11:1991287-1991309 GGCTTCCCTCAGCCCTGGAAGGG No data
1077332931_1077332946 16 Left 1077332931 11:1991249-1991271 CCGGCCTGCAGGTGGGCTTCCAG 0: 2
1: 0
2: 1
3: 35
4: 328
Right 1077332946 11:1991288-1991310 GCTTCCCTCAGCCCTGGAAGGGG No data
1077332931_1077332937 -6 Left 1077332931 11:1991249-1991271 CCGGCCTGCAGGTGGGCTTCCAG 0: 2
1: 0
2: 1
3: 35
4: 328
Right 1077332937 11:1991266-1991288 TTCCAGGAAGGGGCCCCCGCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1077332931 Original CRISPR CTGGAAGCCCACCTGCAGGC CGG (reversed) Intergenic