ID: 1077332931

View in Genome Browser
Species Human (GRCh38)
Location 11:1991249-1991271
Sequence CTGGAAGCCCACCTGCAGGC CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 366
Summary {0: 2, 1: 0, 2: 1, 3: 35, 4: 328}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1077332931_1077332945 15 Left 1077332931 11:1991249-1991271 CCGGCCTGCAGGTGGGCTTCCAG 0: 2
1: 0
2: 1
3: 35
4: 328
Right 1077332945 11:1991287-1991309 GGCTTCCCTCAGCCCTGGAAGGG No data
1077332931_1077332950 24 Left 1077332931 11:1991249-1991271 CCGGCCTGCAGGTGGGCTTCCAG 0: 2
1: 0
2: 1
3: 35
4: 328
Right 1077332950 11:1991296-1991318 CAGCCCTGGAAGGGGGCCAACGG No data
1077332931_1077332944 14 Left 1077332931 11:1991249-1991271 CCGGCCTGCAGGTGGGCTTCCAG 0: 2
1: 0
2: 1
3: 35
4: 328
Right 1077332944 11:1991286-1991308 TGGCTTCCCTCAGCCCTGGAAGG No data
1077332931_1077332937 -6 Left 1077332931 11:1991249-1991271 CCGGCCTGCAGGTGGGCTTCCAG 0: 2
1: 0
2: 1
3: 35
4: 328
Right 1077332937 11:1991266-1991288 TTCCAGGAAGGGGCCCCCGCTGG No data
1077332931_1077332947 17 Left 1077332931 11:1991249-1991271 CCGGCCTGCAGGTGGGCTTCCAG 0: 2
1: 0
2: 1
3: 35
4: 328
Right 1077332947 11:1991289-1991311 CTTCCCTCAGCCCTGGAAGGGGG No data
1077332931_1077332946 16 Left 1077332931 11:1991249-1991271 CCGGCCTGCAGGTGGGCTTCCAG 0: 2
1: 0
2: 1
3: 35
4: 328
Right 1077332946 11:1991288-1991310 GCTTCCCTCAGCCCTGGAAGGGG No data
1077332931_1077332943 10 Left 1077332931 11:1991249-1991271 CCGGCCTGCAGGTGGGCTTCCAG 0: 2
1: 0
2: 1
3: 35
4: 328
Right 1077332943 11:1991282-1991304 CCGCTGGCTTCCCTCAGCCCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1077332931 Original CRISPR CTGGAAGCCCACCTGCAGGC CGG (reversed) Intergenic
900735072 1:4294627-4294649 CTGGGAGCCCATGTGCAGACTGG + Intergenic
900981362 1:6047953-6047975 CTGGGAGCAGACCTGCAGGTGGG - Intronic
901231417 1:7643531-7643553 CAGGAATGCCACCTCCAGGCTGG + Intronic
901792671 1:11662499-11662521 CTGGAGGCCCAGCCACAGGCTGG + Exonic
902690091 1:18105739-18105761 CTGGAATCCCACCTGCTCCCTGG + Intergenic
902806766 1:18865830-18865852 CTAGAAACCCACCTCCAGTCTGG + Intronic
903068295 1:20713593-20713615 CTCGAAGTCCACCTGCTGCCAGG + Intronic
903737485 1:25539357-25539379 CTGTAGTCCCACCTACAGGCTGG - Intergenic
905278350 1:36833511-36833533 CTGGGAGCTCACCTGGGGGCAGG - Intronic
905278398 1:36833727-36833749 CTGCCAACCCACCTGGAGGCTGG + Intronic
905713882 1:40131633-40131655 CTGTAATCCCAGCTACAGGCTGG - Intergenic
906544855 1:46613688-46613710 CTGCAGGCCCACCAGCAGACAGG + Intronic
906556673 1:46719278-46719300 CCGGAAGCCCTCCTGGGGGCGGG - Intergenic
906951397 1:50336866-50336888 CTGGAACACCTCCTCCAGGCTGG - Intergenic
909820110 1:80051092-80051114 TTGGAGGACCCCCTGCAGGCGGG - Intergenic
910291678 1:85605887-85605909 TTGGAAGTCCACTTTCAGGCTGG - Intergenic
912557473 1:110526679-110526701 CTGGAAGCCAACTGGGAGGCAGG + Intergenic
912756202 1:112326533-112326555 CTGGAAGCCGGCAAGCAGGCTGG - Intergenic
915300208 1:154947412-154947434 CTGCAGGCCCAGCTGCAGGTGGG - Exonic
915383218 1:155463119-155463141 CTGGAAGCCCAACTGCAAATTGG - Intronic
915513480 1:156399923-156399945 CTGGAGGCTCCCCTGCAAGCAGG + Intergenic
916107553 1:161442319-161442341 CTGCCGGCCCACCTGCAGCCCGG + Intergenic
916109137 1:161449737-161449759 CTGCCGGCCCACCTGCAGCCCGG + Intergenic
916110725 1:161457118-161457140 CTGCCGGCCCACCTGCAGCCCGG + Intergenic
916112310 1:161464528-161464550 CTGCCGGCCCACCTGCAGCCCGG + Intergenic
916113897 1:161471909-161471931 CTGCCGGCCCACCTGCAGCCCGG + Intergenic
916202301 1:162283731-162283753 CTGGAACACCACCTGCAGACTGG - Intronic
916790611 1:168121874-168121896 CTGGGAGCCCAGTTCCAGGCAGG - Intronic
917807382 1:178625884-178625906 CTGACAGCCAACCTCCAGGCAGG + Intergenic
918049991 1:180965465-180965487 TTGGAAGCCCACCTGACAGCAGG - Intergenic
918059620 1:181049831-181049853 ATGGAAGCCCACCTGTCAGCAGG - Intronic
918251681 1:182708625-182708647 CTGGAAGCCAGCCTGGTGGCAGG - Intergenic
1063276954 10:4579938-4579960 CTAGAGGCCAACCTGCAGGTTGG - Intergenic
1063456059 10:6183447-6183469 CTACAAGCCCAGCTTCAGGCTGG - Intronic
1065122429 10:22542842-22542864 GTGGCAGCCCATCTGCGGGCTGG + Intronic
1065419528 10:25526839-25526861 TTGGAAGCCCACTCACAGGCTGG + Intronic
1067070288 10:43126120-43126142 CTGGAAAACATCCTGCAGGCTGG + Intronic
1067715811 10:48690736-48690758 CTGGATGACCAGCTGCAGGGAGG - Intronic
1069869034 10:71521896-71521918 CTGGCCCCCCACCTGCAGACAGG + Intronic
1069891911 10:71657223-71657245 CTCAAGGCCAACCTGCAGGCAGG - Intronic
1071166799 10:82816598-82816620 CTGGAATTCCACCTGAAGGTGGG + Intronic
1072891497 10:99329294-99329316 CTGGGAACCCAGCCGCAGGCAGG - Exonic
1074386718 10:113022401-113022423 ACGGAAGCTCAGCTGCAGGCCGG - Intronic
1074881527 10:117663252-117663274 GTGGAGGCCCACGGGCAGGCTGG - Intergenic
1074891751 10:117741785-117741807 GTGGGAGCCCTCCTGCAGTCAGG + Intergenic
1075258716 10:120945021-120945043 CTGGAGCCCCATCTCCAGGCAGG - Intergenic
1075702134 10:124476589-124476611 CTGGGGGACCACCTGCAGGTAGG - Intronic
1076402974 10:130195365-130195387 CCGGAAACCCAGGTGCAGGCAGG + Intergenic
1077332931 11:1991249-1991271 CTGGAAGCCCACCTGCAGGCCGG - Intergenic
1077641049 11:3881793-3881815 CTGCAATCCCAGCTACAGGCAGG - Intronic
1078896400 11:15600687-15600709 ATGTGTGCCCACCTGCAGGCTGG - Intergenic
1079399272 11:20092727-20092749 CTGGAATCCATCCTGAAGGCAGG - Intronic
1080531933 11:33184953-33184975 CTGGAAGTCCACATTCAAGCTGG - Intergenic
1081678822 11:44987693-44987715 CTGGAAACAACCCTGCAGGCGGG - Intergenic
1083999165 11:66286899-66286921 CTGGAAGCTCATCTGCGGGCTGG + Intronic
1084284629 11:68122969-68122991 CTGGAAGTTGACCTGCAGGGAGG + Intergenic
1084519723 11:69655839-69655861 ATGTAAACCCAGCTGCAGGCCGG - Intronic
1088681835 11:112250040-112250062 CTGGAAGGCACCCTCCAGGCGGG - Intronic
1088743376 11:112784956-112784978 CTGGAAGCCCAGATGGAGGGTGG + Intergenic
1089364602 11:117913779-117913801 CTCGAAACCCAGCTGCTGGCAGG + Exonic
1091209724 11:133845758-133845780 TTGGGAGCTCACCTCCAGGCAGG + Intergenic
1202815914 11_KI270721v1_random:46425-46447 CTGGAAGCCCACCTGCAGGCCGG - Intergenic
1091388802 12:112536-112558 CTGGAAGCCCAGGTGCTGCCTGG - Intronic
1091779408 12:3204507-3204529 CTGGACCCCCACAGGCAGGCAGG - Intronic
1092013862 12:5140152-5140174 CTGGAAGCCCACATGCACTGGGG - Intergenic
1096531508 12:52245496-52245518 CTGGAAGCCGCCCTGCAGCGGGG + Exonic
1098212825 12:68184504-68184526 CTGGAAGCCATGCTGGAGGCAGG + Intergenic
1102566608 12:113801356-113801378 CTGGACCCCCAGCTGAAGGCCGG - Intergenic
1102969649 12:117155899-117155921 CTGGGACCCCACCTGCATGATGG - Exonic
1103348615 12:120267195-120267217 CTGTAATCCCACCAGGAGGCAGG - Intergenic
1104038074 12:125112295-125112317 CTGGAAGCTGAGCTGCAGGGTGG - Intronic
1104605276 12:130183561-130183583 GTGGAATCCCAGCTGCAGGTGGG - Intergenic
1105839504 13:24241629-24241651 CAGGAAGCCCACCTGGTGGTTGG + Intronic
1106321768 13:28646100-28646122 CAGGCAGCTCACCTGCAGTCAGG + Intergenic
1106331527 13:28743837-28743859 CAGGAAGGCCTCCTGCAGGTGGG + Intergenic
1106610140 13:31271075-31271097 CTGGAGGCCCACATGCATGGAGG - Intronic
1107740315 13:43443707-43443729 CTGGAAGGCAACCTGCATGTAGG + Intronic
1108020484 13:46123101-46123123 CTGCAAGCCCATCTGCACACTGG + Intergenic
1109521035 13:63511332-63511354 CAGGAAGACCCCCTTCAGGCTGG + Intergenic
1111298592 13:86316839-86316861 CTGGCAGGCCACCTGCATGGTGG + Intergenic
1114484176 14:23053358-23053380 CAGCAAGCCCAGCTGCAGGGAGG + Intronic
1114550976 14:23532742-23532764 CTGGCAGCCCACCTGCGGGAGGG - Exonic
1118134575 14:63008720-63008742 CTCAAAGCACACCTGCAAGCTGG + Intronic
1118303282 14:64633759-64633781 CCGGCAGCCCACCTTCAGCCTGG + Intergenic
1119740879 14:77013007-77013029 CTGGAAGCCAACAAGCTGGCTGG + Intergenic
1121330891 14:93049259-93049281 GTGGAAGGCCTCCTGCATGCAGG + Intronic
1121333787 14:93064418-93064440 CAGGAAGGCCACCAGCAGCCAGG - Intronic
1121334230 14:93067320-93067342 CTGGAAGCCTGCCTGCAAGAAGG + Intronic
1121789336 14:96687219-96687241 CAGGAAGCCCATCTCCAGCCTGG + Intergenic
1121797550 14:96747642-96747664 CTGTAAAGCCACCTTCAGGCTGG + Intergenic
1121917467 14:97848870-97848892 CTGGAAGGAGACCTGCAGGGAGG - Intergenic
1122268562 14:100558027-100558049 CTGGAGCCCCACCTGCAGCTGGG - Intronic
1122742889 14:103882045-103882067 CTGGGAGCGCTTCTGCAGGCAGG - Intergenic
1122820438 14:104342131-104342153 CTGCAGCGCCACCTGCAGGCTGG + Intergenic
1122854744 14:104554688-104554710 CTCGCTGCCCTCCTGCAGGCCGG + Intronic
1122932959 14:104943139-104943161 CTGGACGTCCACCTCCATGCTGG + Exonic
1122933184 14:104944129-104944151 CTGGACGTCCACCTCCACGCTGG + Exonic
1122933422 14:104945119-104945141 CTGGACGTCCACCTCCACGCTGG + Exonic
1122933885 14:104947099-104947121 CTGGACGTCCACCTCCATGCTGG + Exonic
1122933997 14:104947594-104947616 CTGGACGTCCACCTCCATGCTGG + Exonic
1122934344 14:104949079-104949101 CTGGACGTCCACCTCCATGCTGG + Exonic
1122934702 14:104950564-104950586 CTGGACGTCCACCTCCATGCTGG + Exonic
1122935287 14:104953039-104953061 CTGGACGTCCACCTCCATGCTGG + Exonic
1202831868 14_GL000009v2_random:43189-43211 CTGGAGGCCCACATGCAGTGGGG - Intergenic
1124206829 15:27727975-27727997 TTGGAAGCCAGACTGCAGGCTGG - Intergenic
1124646981 15:31444169-31444191 CTTGAGGACCACATGCAGGCTGG - Intergenic
1125085155 15:35721420-35721442 CATGCAGCACACCTGCAGGCAGG + Intergenic
1125724614 15:41861956-41861978 CTGGAAGCAGCCCAGCAGGCAGG + Intronic
1129273677 15:74432503-74432525 GTGGGAGCCCAGGTGCAGGCAGG - Intronic
1130126390 15:81097402-81097424 CTCAAAGCCCACCTCCAGGCCGG - Intronic
1133305294 16:4804510-4804532 CTCCATGCTCACCTGCAGGCCGG + Exonic
1133346751 16:5076194-5076216 CTGGATGTGCACCTGAAGGCTGG - Intronic
1136466156 16:30445414-30445436 CAGGAAGCCGGCCTGCCGGCAGG - Exonic
1136872821 16:33824290-33824312 CAGGAAGACCAGCTGCAGGGAGG - Intergenic
1138161994 16:54763034-54763056 CTGGGTGCTCACCTGTAGGCAGG + Intergenic
1138494961 16:57402472-57402494 CTGGCAGCCTGCCTGCAGTCGGG - Intergenic
1138788000 16:59869193-59869215 CTGGGGGCCCACCTGCACACTGG - Intergenic
1139649920 16:68357065-68357087 CTGGAACCCCCACTGCAAGCAGG + Exonic
1141373262 16:83506574-83506596 CTGGGAGCCCTCCTGGGGGCTGG - Intronic
1141469636 16:84229620-84229642 CAGGAAGGGCCCCTGCAGGCCGG - Intronic
1141624354 16:85253505-85253527 CTGGAGTCCCTCCTGTAGGCTGG + Intergenic
1141827220 16:86489050-86489072 CTGGAATCCAACCCACAGGCAGG + Intergenic
1142275918 16:89118871-89118893 ATGGGAGCGCAGCTGCAGGCAGG - Intronic
1203099350 16_KI270728v1_random:1291764-1291786 CAGGAAGACCAGCTGCAGGGAGG + Intergenic
1142776588 17:2144831-2144853 CTGGAATCCCAGCTTTAGGCAGG + Intronic
1142952221 17:3492797-3492819 CTGACAGCTCACCTGGAGGCTGG - Intronic
1143750456 17:9023203-9023225 CCGGCCGCCCACCTGCAGGTCGG - Exonic
1144623724 17:16833878-16833900 CAGGCACCCTACCTGCAGGCCGG + Intergenic
1144882706 17:18438838-18438860 CAGGCACCCCACCTGCAGGCCGG - Intergenic
1145059392 17:19723159-19723181 CTGGAGGCTCACCTGCAAGGCGG + Intergenic
1145077602 17:19868199-19868221 CTTGAACCCCAGCTGCAGGCAGG + Intergenic
1145149527 17:20505548-20505570 CAGGCACCCCACCTGCAGGCCGG + Intergenic
1146364880 17:32215119-32215141 CTGGCAGACCACCTGAAGTCAGG - Intronic
1146420203 17:32677937-32677959 CTGGAAGGACACCTGGAGGGCGG - Intronic
1147215807 17:38898401-38898423 CTTGTAGCGCACCTGCAGGAGGG - Exonic
1147324567 17:39664020-39664042 CTGGAAGCCTGCATGCAGGCAGG - Intergenic
1147567966 17:41549052-41549074 GAGGGAGCCCGCCTGCAGGCAGG - Intergenic
1147578058 17:41613810-41613832 CAGGCACCCCACCTGCAGGCTGG + Intronic
1147757636 17:42779492-42779514 CTGGAAGGCTGCCTGCAGCCAGG - Exonic
1148048505 17:44758389-44758411 CCTGAAGCCCTCCTGGAGGCCGG + Intergenic
1148080295 17:44964215-44964237 CTGGAAGCCTCTCTACAGGCAGG + Intronic
1148568562 17:48647955-48647977 CTGGACAACCACCTGCAGGAAGG - Intergenic
1148731631 17:49840229-49840251 CTGGAAGCCCCCCAACAGGCAGG - Intronic
1149406950 17:56362060-56362082 CTGCAGGCCCTCCTGGAGGCTGG + Intronic
1149584272 17:57774900-57774922 CTGGATGTCCTCCTGCTGGCGGG - Intergenic
1149661913 17:58338460-58338482 CCAGAGCCCCACCTGCAGGCTGG + Intergenic
1149867621 17:60159396-60159418 CAGGAAGCCGGCCAGCAGGCAGG - Exonic
1150329332 17:64282521-64282543 CTGGAAGCCCACCTGAGAGAGGG + Intergenic
1151216034 17:72576848-72576870 ATGGGAGCCCACCAGCATGCAGG + Intergenic
1151400094 17:73850348-73850370 CTGGAAGCCCACCAGAGGCCAGG - Intergenic
1151443880 17:74150774-74150796 CTGGACGCCATCCTGAAGGCCGG + Intergenic
1151731474 17:75914039-75914061 CTCGGAGGCCACCTGCAGGGAGG + Exonic
1152407932 17:80108082-80108104 GTGCCAGCCCACCTCCAGGCAGG - Intergenic
1152687629 17:81702463-81702485 CTGATGGCCCAGCTGCAGGCAGG + Intronic
1153170926 18:2314845-2314867 CTGGATCTCCATCTGCAGGCTGG + Intergenic
1153324537 18:3804521-3804543 TTGCCAGCCCACCTGGAGGCTGG - Intronic
1153446175 18:5175145-5175167 ATGGAACCCCACCTGCAGAGAGG + Intronic
1153581958 18:6582467-6582489 CTGAAAGGCCACCTGCCTGCCGG + Intronic
1154123437 18:11669968-11669990 CTGGAACCCACCCTGCAGGCTGG + Intergenic
1154244026 18:12679392-12679414 CAGGAAGCACACTAGCAGGCAGG + Intronic
1154410820 18:14141256-14141278 AAGCAAGCTCACCTGCAGGCTGG + Intergenic
1156465273 18:37344831-37344853 CTGCAAGGCCACCAGCAAGCTGG - Intronic
1156636027 18:39030441-39030463 CTTGCAGCCCACTAGCAGGCAGG - Intergenic
1157496807 18:48162102-48162124 CAGGCCGCCCACCTCCAGGCAGG + Intronic
1159768303 18:72517484-72517506 CTGAAAGCCTACCTGCTGCCAGG - Intergenic
1160101358 18:75922909-75922931 CAGGAAGCCCACCTGCCACCCGG - Intergenic
1160694153 19:474522-474544 CTGGGAGCCCAGCAGGAGGCAGG - Intronic
1161775747 19:6261169-6261191 CAGGAGGCCCACTTGCAGGCAGG + Intronic
1162440907 19:10691557-10691579 CAGGTAGCCGACCTGCAGGAGGG + Exonic
1162473478 19:10886314-10886336 CTGTAATCCCAGCTACAGGCTGG - Intronic
1162622039 19:11851255-11851277 CTGTCAGCCCACATGCAGGTAGG - Intronic
1162937513 19:13988668-13988690 GGGGGTGCCCACCTGCAGGCAGG - Intronic
1163604591 19:18267018-18267040 CTGGAAGCGCACCTGCTGTGGGG + Exonic
1164806263 19:31119406-31119428 CTTGAAGCCCAGCTGCATTCTGG - Intergenic
1164821593 19:31255314-31255336 CTGAAACCCCAGCTGCTGGCTGG + Intergenic
1164951423 19:32340270-32340292 CAGGAAACGCACCAGCAGGCTGG - Intergenic
1165348141 19:35261842-35261864 CCGAAAGCCCAGCTCCAGGCTGG - Intronic
1165416476 19:35697089-35697111 CAGGAAGTCCACCTGGAGCCAGG - Intergenic
1165438198 19:35808396-35808418 ATGGAATCCCACCTGGAGGCAGG + Intronic
1165825744 19:38704849-38704871 CTGGAAGGCCACCTTCAGGTTGG + Intronic
1166072522 19:40395338-40395360 CTGGATGCCCACCTGCCCTCAGG - Exonic
1167045169 19:47045443-47045465 CAGGAAGCCCGCGTGCAGGAGGG - Exonic
1167112457 19:47470316-47470338 CTGGGACCTCACCTGCAGCCAGG + Intronic
1167591260 19:50405764-50405786 CTGCAAGGCCTCCTGCAGCCAGG + Intronic
1168266988 19:55228624-55228646 CTGGAACCCCAGCAGCCGGCGGG - Intronic
925618982 2:5772039-5772061 CTGAAACCCCACATGCAGGGTGG + Intergenic
927176181 2:20410564-20410586 CTGGAAGCTCAGGTCCAGGCGGG + Intergenic
927687177 2:25179157-25179179 CAGGCAGCCCACCTGCGGCCCGG + Intergenic
927778786 2:25922970-25922992 CTGTAATCCCAGCTACAGGCAGG - Intergenic
928332697 2:30369825-30369847 CTGAAAGCCCCTTTGCAGGCTGG + Intergenic
929089887 2:38204765-38204787 CTGGGAGCCATCTTGCAGGCTGG + Intergenic
929670750 2:43875190-43875212 CGGGATGCCCACCTACTGGCTGG + Exonic
932285804 2:70530748-70530770 CAGCAATACCACCTGCAGGCAGG + Intronic
933632248 2:84671651-84671673 CTGGAAGCCAAGCAGCAGGAAGG - Intronic
934522391 2:95027364-95027386 CTGGAAGCCCCGCTACCGGCAGG - Intronic
934865769 2:97809022-97809044 CTGGAGGCCAACCCGCAGACTGG - Intronic
935812648 2:106814679-106814701 CTGGATGCCCTACTGCATGCAGG + Intronic
935920553 2:108008472-108008494 CTGGAAGCCCATATGCAGTCTGG - Exonic
935983975 2:108654546-108654568 GTGGAAGCCCAGGTCCAGGCAGG + Intronic
936136410 2:109898199-109898221 GTGGAAGCCCAGGTCCAGGCAGG + Intergenic
936208287 2:110473286-110473308 GTGGAAGCCCAGGTCCAGGCAGG - Intergenic
937152743 2:119697043-119697065 CTGGCTGACCAGCTGCAGGCTGG + Intergenic
937641171 2:124213181-124213203 CTGGAAGCCAAGCTCAAGGCTGG + Intronic
938770701 2:134498626-134498648 TTGAAAGCCCACATGCTGGCTGG - Intronic
945305522 2:208255338-208255360 CTTGTATGCCACCTGCAGGCCGG + Intronic
945567064 2:211413980-211414002 CTGGAAGCCCACATGCACTGGGG - Intronic
946448322 2:219758633-219758655 CTGGAAGCCCACTGGCAAGAGGG + Intergenic
948320436 2:237064535-237064557 CAGGAAGCCTGCCTGCAGCCGGG + Intergenic
948423097 2:237872471-237872493 GAGGAAGCCCATCTGCAGCCGGG + Intronic
948510353 2:238459772-238459794 CTGGAATCCCTCCTCCATGCTGG + Intergenic
948537092 2:238654417-238654439 CAGGCAGCCTCCCTGCAGGCAGG - Intergenic
1169210515 20:3763972-3763994 CTGGAAGCTCACCTCCAAGAGGG - Intronic
1171023462 20:21607961-21607983 CTGGAAACCCACCTGCACAGAGG - Intergenic
1172219802 20:33265893-33265915 TTGGAGGCCAACTTGCAGGCTGG + Intergenic
1172388150 20:34548249-34548271 CTGGAAGCCAAACTGGAGGTGGG + Intronic
1173167960 20:40699367-40699389 CAGGAAGCCTTCCTGCTGGCTGG + Intergenic
1174044165 20:47721664-47721686 ATAGAAACCCACATGCAGGCCGG - Intronic
1176145385 20:63563134-63563156 CAGGAAGCCGTGCTGCAGGCTGG + Exonic
1176378651 21:6100642-6100664 TTGGCAGCCCACCTGCAGCCTGG - Intergenic
1176423551 21:6534003-6534025 CTGGAGGCAGACCTGGAGGCAGG + Intergenic
1176862237 21:14017163-14017185 AAGCAAGCTCACCTGCAGGCTGG - Intergenic
1178915641 21:36704429-36704451 CTGGATCCCCAGCTGCAGCCTGG - Intronic
1179178987 21:39029333-39029355 CTGGAATCCCAGCTGAATGCTGG - Intergenic
1179409801 21:41153897-41153919 CTGGAAGGCTACCTGCTGGATGG - Intergenic
1179516873 21:41914554-41914576 CTGGAAGAGCCCCTCCAGGCAGG + Intronic
1179567139 21:42256274-42256296 TTGGAAGACCACCTCCTGGCGGG - Intronic
1179699045 21:43142319-43142341 CTGGAGGCAGACCTGGAGGCAGG + Intergenic
1179744824 21:43437595-43437617 TTGGCAGCCCACCTGCAGCCTGG + Intergenic
1180058186 21:45370310-45370332 AGGGAAGCCCACCTGCAGGATGG - Intergenic
1180818145 22:18805978-18806000 CCGGGAGCGCATCTGCAGGCAGG + Intergenic
1180900552 22:19368979-19369001 ATACAAGCCCACATGCAGGCTGG - Intronic
1181204365 22:21240433-21240455 CCGGGAGCGCATCTGCAGGCAGG + Intergenic
1181466682 22:23114146-23114168 CTGGTGGCTCAGCTGCAGGCTGG + Intronic
1182934373 22:34207394-34207416 CTGCAAGGGCACCTGGAGGCTGG - Intergenic
1183739004 22:39659824-39659846 CTGGAAGCCCTCCACCAGGATGG - Exonic
1184070642 22:42144308-42144330 CTGGAAGTCCACATGCAGCAAGG + Intergenic
1185030658 22:48441264-48441286 CAGGAGGCCCACCTGCGAGCAGG - Intergenic
1185367421 22:50443313-50443335 GAGGAAGCTCACCTGCAGGCTGG - Intronic
1203222557 22_KI270731v1_random:54982-55004 CCGGGAGCGCATCTGCAGGCAGG - Intergenic
1203268272 22_KI270734v1_random:31832-31854 CCGGGAGCGCATCTGCAGGCAGG + Intergenic
950129831 3:10534348-10534370 GTGCAAGTCCACCTGCTGGCAGG + Intronic
950675187 3:14550332-14550354 CAGGAAGCCCTCCGGCTGGCTGG + Intergenic
950810975 3:15649441-15649463 GTGGCAGCCCACCTGCAGGATGG - Intergenic
951431698 3:22615396-22615418 TAGGAAGCACACCGGCAGGCTGG + Intergenic
951456971 3:22903714-22903736 CTGTAATCCCAGCTACAGGCCGG + Intergenic
952718251 3:36504231-36504253 GTGGAAGACCACCTGAACGCTGG + Intronic
952840230 3:37640050-37640072 CTGGAAGCCCTGCTGTAGCCAGG - Intronic
953447948 3:42983502-42983524 CTGGACGAACATCTGCAGGCTGG - Intronic
953928928 3:46996433-46996455 CTGGTGGCCCCCCTGCAGGAGGG + Exonic
954664991 3:52246836-52246858 CTGGAATCCCTCCGACAGGCTGG + Intronic
955372048 3:58360537-58360559 CTGTAATCCCAGCTCCAGGCTGG + Intronic
956181005 3:66518259-66518281 TTGAAAGCCCACCCACAGGCTGG + Intergenic
956867580 3:73384735-73384757 GAGGAAGCTCACCTGCAGCCAGG - Exonic
959984605 3:112558859-112558881 CTGTAATCCCAGCTACAGGCAGG - Intronic
960962263 3:123080310-123080332 CTGGAGGGCTACCTGGAGGCTGG + Intronic
963248640 3:143084949-143084971 TGGGAAGCCCACCGGCGGGCGGG + Intergenic
966151964 3:176875364-176875386 CTGGAAGCCCAGTTACAGGGAGG + Intergenic
967171107 3:186824517-186824539 CTGGCAGTCCACCTACAGGGAGG + Intergenic
967941349 3:194768863-194768885 CAGGCAGCCCACCTGCAGCTGGG + Intergenic
1202737737 3_GL000221v1_random:22824-22846 CTGGAGGCCCACATGCAGTGGGG - Intergenic
968686023 4:1959365-1959387 CTAAAAGGCCACCTGGAGGCTGG + Intronic
968916314 4:3498490-3498512 CTGGACACCCCCCTGCAGCCTGG - Intronic
974314857 4:60266299-60266321 CTGGAACCCCACCTGGAGATGGG + Intergenic
975223168 4:71838015-71838037 CAGGAAGCCCACTGGCAGGAAGG - Intergenic
975599765 4:76086996-76087018 CTGTCAGCCCAGCTGCAGCCGGG - Intronic
975719560 4:77236597-77236619 CTGGATGCCCACAGGCAGGCAGG - Intronic
976716581 4:88129109-88129131 TTGTAAGTCCACCTGGAGGCTGG - Intronic
981739193 4:147984878-147984900 CTTGAAGCCCTCCTCCAGGTTGG - Intronic
983056561 4:163103858-163103880 GTGGAAGCCCGCCTGCACCCAGG - Intergenic
983125884 4:163950104-163950126 GTGAAACCCCACCTTCAGGCTGG - Intronic
985658966 5:1146262-1146284 CCAAAAGCCCACCTGCTGGCAGG - Intergenic
988030725 5:25759499-25759521 CTGTCAGCCCACCTGCACGTAGG - Intergenic
990816761 5:59794496-59794518 CTGAAAGCGGACCTGCAAGCAGG - Intronic
991032989 5:62101739-62101761 CTGCAAGACCACCTGGAGCCAGG + Intergenic
996942286 5:129022700-129022722 CTGTAAGCCCAGCTGCATGGAGG + Intronic
998144087 5:139716414-139716436 CTAGATGCCCACCTGCTAGCGGG - Intergenic
999291032 5:150426529-150426551 CTGTAATCCCAGCTACAGGCTGG - Intergenic
999422494 5:151456981-151457003 CTGGATGCCCACCTTAAGCCTGG - Intronic
1000038016 5:157463452-157463474 CTGGAATCCCACCTGCCAACAGG + Intronic
1000884433 5:166735201-166735223 CTTAAAGCCCACAGGCAGGCAGG + Intergenic
1001309623 5:170601729-170601751 CAGGAAGCCCACAGGCCGGCAGG + Intronic
1001528480 5:172445834-172445856 CCAGATGCACACCTGCAGGCGGG - Intronic
1002043606 5:176530499-176530521 CTGGGAGCCCAGATGCAGGTCGG + Intronic
1002352019 5:178590027-178590049 CTGGACACCCAGCAGCAGGCAGG + Exonic
1003461025 6:6328329-6328351 CTGGAAGCCCACATCCAGGTAGG + Intergenic
1003555945 6:7140798-7140820 GTGCAAGCCCACCTGCGAGCAGG - Intronic
1003942829 6:11044929-11044951 CTGGAAGCCCCGCGTCAGGCCGG - Intergenic
1004755065 6:18601904-18601926 CCGGAGGCAGACCTGCAGGCTGG - Intergenic
1005782117 6:29202889-29202911 CTGCAAGCCCTCCTGCCTGCAGG - Intergenic
1006975038 6:38092045-38092067 ATGCCAGCCCACCTGCTGGCGGG - Intronic
1007171581 6:39867852-39867874 CTGGCATCCCACCTCCAGCCTGG - Intronic
1007376831 6:41462748-41462770 CTGGAAACCCAACAGCAGGCCGG + Intergenic
1008611426 6:53187849-53187871 CTGTAATCCCAGCTACAGGCAGG + Intergenic
1011259734 6:85458408-85458430 CTGGATGACCAGCTTCAGGCAGG + Intronic
1013764336 6:113557189-113557211 CTGGAAGCCCACCCACCAGCTGG + Intergenic
1015924273 6:138293512-138293534 CTGTAAGCCCCCCTCCAGGGCGG - Intronic
1016830012 6:148424730-148424752 CTGGAGCCCCACCTGAAGTCTGG - Intronic
1017791721 6:157805474-157805496 CTGGGAGCCCACATGGAGGCAGG - Intronic
1018289168 6:162272873-162272895 CTGTAATCCCAGCTACAGGCTGG + Intronic
1018714864 6:166524405-166524427 CTGCAAGCCCTCCTGCAGAAGGG + Intronic
1018864471 6:167736074-167736096 CTGGAAGCTGCCCTGCCGGCCGG + Intergenic
1019279873 7:194143-194165 CTGAAAGCCCAGCGGCAGCCTGG - Intronic
1019442469 7:1054423-1054445 CCTGAACCCCACCTGGAGGCCGG + Intronic
1019469500 7:1211236-1211258 CTGGCAGCCGGCCAGCAGGCGGG - Intergenic
1019641249 7:2104988-2105010 CAGGAATCCCATCTCCAGGCGGG - Intronic
1020844148 7:13261525-13261547 CTGTAATCCCAGCTACAGGCTGG - Intergenic
1021561633 7:21973450-21973472 CTGGAATCCAACCTGCAGGCTGG + Intergenic
1021844637 7:24752575-24752597 CTGGTATCCCAGGTGCAGGCTGG + Intronic
1022469009 7:30670541-30670563 CCAGAAGCTCATCTGCAGGCAGG - Intronic
1022845885 7:34209444-34209466 CTGGAAGCACACCAGCAGGATGG - Intergenic
1023145888 7:37150967-37150989 CTGGATGCTGACCTGCAGGGAGG - Intronic
1023802393 7:43846275-43846297 CAGGCAGCCCACCTGGGGGCTGG + Intergenic
1024437338 7:49374655-49374677 CTGGAGGCCCACATGCACTCAGG + Intergenic
1024573840 7:50747956-50747978 CAGGAAGCATACCTGCAGGTAGG + Intronic
1026888406 7:73967947-73967969 CAGGAGACCCACCTGGAGGCTGG - Intergenic
1027195438 7:76026936-76026958 CTGTAATCCCAGCTACAGGCTGG + Intronic
1027806599 7:82833233-82833255 CTGGAAGCCCAATTCCTGGCTGG - Intronic
1029736842 7:102469803-102469825 CCGGACGCCCGCCTGCTGGCCGG + Exonic
1034420396 7:150987530-150987552 CAGGGAGCCCACCTGAGGGCGGG - Intergenic
1034447034 7:151119008-151119030 CTGGAATACCAGCTGCAGCCAGG - Intronic
1034893838 7:154862628-154862650 CTCGAGGAGCACCTGCAGGCTGG + Intronic
1034939935 7:155224040-155224062 CTGGAAGCCTTCCTGCAGTTGGG + Intergenic
1035353818 7:158265336-158265358 GTGGATGCACACCTGCAGGCAGG + Intronic
1035353837 7:158265426-158265448 CTGTGGGCACACCTGCAGGCAGG + Intronic
1035675888 8:1455314-1455336 GGGAAACCCCACCTGCAGGCAGG - Intergenic
1035743441 8:1945487-1945509 CTGGAGGCCCACCAGGAGGAAGG + Exonic
1035956587 8:4087293-4087315 CTGGAAAATCACCTGCAGGAAGG - Intronic
1036759402 8:11496919-11496941 TTGTGAGCCCACCTGCAGCCTGG + Intronic
1037030809 8:14102405-14102427 CTTCAAGGCCACCTGCAGGAAGG - Exonic
1037266846 8:17072794-17072816 CTGGAAGCTCACCATCTGGCGGG - Intronic
1037946054 8:22990384-22990406 CTGGGAGGCAGCCTGCAGGCAGG + Intronic
1041727447 8:61031307-61031329 CAGGAAACCCACCTGCAGGGTGG + Intergenic
1042264328 8:66892745-66892767 GTGGAACCCAACCTTCAGGCAGG - Intronic
1042352686 8:67793838-67793860 CTGGAAGGCCAAGTGCAGGCAGG + Intergenic
1042871830 8:73406715-73406737 CAAGAAGCCCTCCTGGAGGCTGG - Intergenic
1048252163 8:132875820-132875842 CTGGAAGCCCAGCTGTAATCAGG + Intronic
1048745387 8:137609279-137609301 CTGTAATCCCAGCTACAGGCAGG - Intergenic
1051686945 9:19667757-19667779 CTGGAATACCAAGTGCAGGCTGG - Intronic
1051764179 9:20503755-20503777 CTGAAAGACAACCTGCAGCCTGG + Intronic
1053342648 9:37350860-37350882 CTAGAAGCCTACCTGGAGACTGG - Intronic
1053527077 9:38841145-38841167 CTTGAAACCCACCTGCAGCCTGG - Intergenic
1054199300 9:62065576-62065598 CTTGAAACCCACCTGCAGCCTGG - Intergenic
1054639053 9:67522781-67522803 CTTGAAACCCACCTGCAGCCTGG + Intergenic
1056771976 9:89484156-89484178 CTGCAGGCCCACCTGCAGCTGGG + Intronic
1056960230 9:91116934-91116956 CTGGAAGCAGACTTGCAGACAGG - Intergenic
1057170852 9:92962237-92962259 CTGGCAGCACAGCAGCAGGCTGG - Intronic
1057547913 9:96031835-96031857 CTGGAAGCCCTCCTGCTTGCTGG + Intergenic
1061398404 9:130355596-130355618 CTGGAAGGCCTCCTGGAGGAAGG + Intronic
1061404424 9:130385565-130385587 CTGGGAGCCTGCCTGAAGGCCGG - Intronic
1061620743 9:131809855-131809877 CTGTGTGCCCACCAGCAGGCTGG - Intergenic
1061726168 9:132583017-132583039 TTGGACTCCCACCTGCAGCCCGG + Exonic
1062108271 9:134767388-134767410 CAGGGAATCCACCTGCAGGCGGG - Intronic
1062111336 9:134783648-134783670 CTGGAAAGCCACCTGCGAGCCGG - Intronic
1062279130 9:135744224-135744246 CCGGCAGGCCAGCTGCAGGCTGG - Intronic
1203706465 Un_KI270742v1:53268-53290 CTGGAGGCCCACATGCAGTGGGG - Intergenic
1185761551 X:2692610-2692632 TTGGAACCTCCCCTGCAGGCTGG - Intronic
1189298426 X:39935424-39935446 CAGGAGGCCCACCAGCAGGCAGG - Intergenic
1192286573 X:69744660-69744682 CTTGAAGACCACCTGCTGGCTGG - Intronic
1195579134 X:106481935-106481957 CTGGAAGACCTCCTGCAGTGAGG - Intergenic
1196950446 X:120871197-120871219 CTGTAATCCCACCCTCAGGCGGG - Intergenic
1197796669 X:130305522-130305544 CTGGAAGCACTCCTGCAGCCAGG - Intergenic
1199514318 X:148658499-148658521 CTCTAAGTCCACATGCAGGCAGG + Intronic
1200010171 X:153114593-153114615 CATGGGGCCCACCTGCAGGCAGG + Intergenic
1200029429 X:153285329-153285351 CATGGGGCCCACCTGCAGGCAGG - Intergenic
1200127703 X:153824519-153824541 CAGGAAGCCCCCATGCAAGCAGG + Intronic
1200162237 X:154015531-154015553 CTGGAAGGCCACTGTCAGGCTGG + Intronic