ID: 1077332933

View in Genome Browser
Species Human (GRCh38)
Location 11:1991253-1991275
Sequence CTTCCTGGAAGCCCACCTGC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 301
Summary {0: 2, 1: 0, 2: 1, 3: 37, 4: 261}

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1077332933_1077332943 6 Left 1077332933 11:1991253-1991275 CCTGCAGGTGGGCTTCCAGGAAG 0: 2
1: 0
2: 1
3: 37
4: 261
Right 1077332943 11:1991282-1991304 CCGCTGGCTTCCCTCAGCCCTGG No data
1077332933_1077332953 30 Left 1077332933 11:1991253-1991275 CCTGCAGGTGGGCTTCCAGGAAG 0: 2
1: 0
2: 1
3: 37
4: 261
Right 1077332953 11:1991306-1991328 AGGGGGCCAACGGTGTCACCAGG No data
1077332933_1077332944 10 Left 1077332933 11:1991253-1991275 CCTGCAGGTGGGCTTCCAGGAAG 0: 2
1: 0
2: 1
3: 37
4: 261
Right 1077332944 11:1991286-1991308 TGGCTTCCCTCAGCCCTGGAAGG No data
1077332933_1077332950 20 Left 1077332933 11:1991253-1991275 CCTGCAGGTGGGCTTCCAGGAAG 0: 2
1: 0
2: 1
3: 37
4: 261
Right 1077332950 11:1991296-1991318 CAGCCCTGGAAGGGGGCCAACGG No data
1077332933_1077332947 13 Left 1077332933 11:1991253-1991275 CCTGCAGGTGGGCTTCCAGGAAG 0: 2
1: 0
2: 1
3: 37
4: 261
Right 1077332947 11:1991289-1991311 CTTCCCTCAGCCCTGGAAGGGGG No data
1077332933_1077332946 12 Left 1077332933 11:1991253-1991275 CCTGCAGGTGGGCTTCCAGGAAG 0: 2
1: 0
2: 1
3: 37
4: 261
Right 1077332946 11:1991288-1991310 GCTTCCCTCAGCCCTGGAAGGGG No data
1077332933_1077332937 -10 Left 1077332933 11:1991253-1991275 CCTGCAGGTGGGCTTCCAGGAAG 0: 2
1: 0
2: 1
3: 37
4: 261
Right 1077332937 11:1991266-1991288 TTCCAGGAAGGGGCCCCCGCTGG No data
1077332933_1077332945 11 Left 1077332933 11:1991253-1991275 CCTGCAGGTGGGCTTCCAGGAAG 0: 2
1: 0
2: 1
3: 37
4: 261
Right 1077332945 11:1991287-1991309 GGCTTCCCTCAGCCCTGGAAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1077332933 Original CRISPR CTTCCTGGAAGCCCACCTGC AGG (reversed) Intergenic
900461772 1:2805203-2805225 CTGCCTGGCTGTCCACCTGCAGG - Intergenic
900562176 1:3312561-3312583 ATCCCGGGAACCCCACCTGCCGG - Intronic
901087650 1:6621336-6621358 TTTCATGGAAGCCCAGCTGATGG + Intronic
903349433 1:22709435-22709457 CATCCTGGAAGGCCACCAGGAGG - Intergenic
903550919 1:24156990-24157012 CTTCCGGGAAGTCCACCTAGCGG - Exonic
907320789 1:53600905-53600927 CTTCCTAGAAACCCACTAGCAGG - Intronic
908020583 1:59894052-59894074 CATTCTGGAAGCTCGCCTGCCGG - Intronic
909004385 1:70257703-70257725 CCTCCTGGAATGCCTCCTGCAGG - Intergenic
913329507 1:117655337-117655359 CGTCCTGGCAGCCAATCTGCAGG - Intergenic
913451589 1:118996500-118996522 CTTCCAGGAAGGCAACCTGGAGG + Intergenic
914585765 1:149060350-149060372 CTACCTGGAAGCCCAGATGAGGG - Intronic
915110446 1:153561510-153561532 ACTCCTGGAAGTCCACCTGCTGG + Exonic
918394269 1:184097748-184097770 CCTCCTGGAAGGTCACCTCCAGG - Intergenic
919776970 1:201200480-201200502 CTGCCTCCAAGCCCACCTCCAGG - Intronic
920832894 1:209481294-209481316 ATTGCTGGAAGCCCAGCTGCAGG + Intergenic
920989889 1:210926471-210926493 CTTCCTGAGAGCCAAACTGCAGG - Intronic
921670899 1:217922741-217922763 CTTCCAGGAAGCCACCCTGGAGG + Intergenic
923708808 1:236368565-236368587 CTGCCTGTAATCCCAGCTGCTGG - Intronic
923746405 1:236704712-236704734 GTTCCTGGAGGGCGACCTGCTGG - Intronic
924204576 1:241698621-241698643 CTTCCTTGAAACCCCCATGCTGG + Intronic
924355883 1:243175758-243175780 CTTACTGTCATCCCACCTGCTGG + Intronic
924836017 1:247648224-247648246 CCTCCTGGGATCCCAACTGCAGG - Intergenic
1063270896 10:4509220-4509242 CATTCTGGAAACTCACCTGCAGG + Intergenic
1065897667 10:30178481-30178503 CTCCCTGGCACCCCACCTGGTGG + Intergenic
1066667828 10:37803440-37803462 CTTCCTGAAAGCCCATCCACTGG + Intronic
1067170662 10:43903589-43903611 CTGCCTCGTAGTCCACCTGCAGG - Intergenic
1067297465 10:44982899-44982921 CTTCCTGCAAGCCACCTTGCTGG + Intronic
1069544797 10:69320251-69320273 CCTCCTGGAAGCTGACCTCCAGG - Intronic
1069777017 10:70933219-70933241 CTTTCCTGAAACCCACCTGCTGG + Intergenic
1072806337 10:98425898-98425920 CTTCCTGGATGCCAACGTGAAGG - Exonic
1073041426 10:100609669-100609691 TTTCCTGGAAAACTACCTGCAGG - Intergenic
1074205796 10:111281709-111281731 TTTTCTGGAACTCCACCTGCTGG - Intergenic
1076621613 10:131792591-131792613 GGTCCTGGACGCCGACCTGCGGG - Intergenic
1077177997 11:1199286-1199308 CTCTCTGGAAGCCCACGGGCTGG + Intronic
1077210477 11:1368987-1369009 CGGCCTCCAAGCCCACCTGCTGG + Intergenic
1077332933 11:1991253-1991275 CTTCCTGGAAGCCCACCTGCAGG - Intergenic
1077350617 11:2091504-2091526 CTTCCCTGGAGCCCACCTGCTGG - Intergenic
1077378612 11:2217466-2217488 GTGCCTGGAGTCCCACCTGCTGG + Intergenic
1077552793 11:3208847-3208869 CGTCCTGGCATCCCACCTACTGG - Intergenic
1077922803 11:6654637-6654659 CTTCCAGGAAGCCCACCCCCAGG - Intronic
1083184094 11:61007632-61007654 CGTCCTGGGAGCCCGCGTGCGGG + Exonic
1083999164 11:66286895-66286917 CTCACTGGAAGCTCATCTGCGGG + Intronic
1084263282 11:67992006-67992028 CTTCCTGGACCGCCTCCTGCAGG + Intronic
1084810119 11:71607121-71607143 CTTCCTGGACCGCCTCCTGCAGG - Intergenic
1087058297 11:93954743-93954765 CATCCTGGGAGCCCACAAGCTGG - Intergenic
1088186400 11:107176402-107176424 CTTCCTGGAAGTCTTCCTTCTGG - Intergenic
1088648548 11:111937538-111937560 CCTCATTGAAGCCCTCCTGCAGG - Intronic
1088743373 11:112784952-112784974 CTTCCTGGAAGCCCAGATGGAGG + Intergenic
1088815785 11:113419904-113419926 CTTCCTGGGAGCTCACATGGGGG + Intronic
1089121811 11:116141482-116141504 CCTCCTGAAGGCCCAACTGCTGG + Intergenic
1089562319 11:119350204-119350226 CTTCCAGGAAGTCCTCCTGCTGG - Intergenic
1089847053 11:121466639-121466661 CTTCCTGTCAGCCTGCCTGCTGG + Intronic
1091123252 11:133074560-133074582 CCTCCTGGAAGCCAACCTCAAGG - Intronic
1202815916 11_KI270721v1_random:46429-46451 CTTCCTGGAAGCCCACCTGCAGG - Intergenic
1091408082 12:221298-221320 CTGGCTGGCAGCCCACCTGTCGG + Intronic
1096214365 12:49791418-49791440 CCTCCTGGAGGCCCCCGTGCTGG - Exonic
1098522521 12:71449558-71449580 TTTCCTGGAAGGCCAGCAGCTGG - Intronic
1100464511 12:94833477-94833499 TTGCCTGGAAGCCCATCTGAGGG + Intergenic
1101961699 12:109255784-109255806 CTTCCTAAAATCCCACCTTCTGG + Intronic
1102368666 12:112362428-112362450 CTCTGTGGAAGCCAACCTGCAGG + Intronic
1102535272 12:113576327-113576349 CATCCTGGAAGGCCTCCTGGGGG + Intergenic
1104313628 12:127676893-127676915 CTTCCTGGATCCTCACATGCAGG - Intergenic
1104902373 12:132196472-132196494 CTTCCTGGGAGCCGAGCTGGGGG - Exonic
1104959354 12:132480876-132480898 CCACCTGGAAGCCCAGCTGCAGG - Intergenic
1104969780 12:132525979-132526001 CTTCCTGGACGCCCTTGTGCAGG - Intronic
1108129961 13:47288151-47288173 CTTCCTGTAACCCAAGCTGCTGG + Intergenic
1112303920 13:98256056-98256078 CCTCCTAGAAGCGAACCTGCTGG - Intronic
1112332569 13:98487810-98487832 GGTCCTGGAAGCAGACCTGCTGG + Intronic
1112495276 13:99899165-99899187 CTTCCAGGATCCCCACTTGCCGG + Intergenic
1112737420 13:102436318-102436340 CTCACTGCAAGCCCACCTCCCGG - Intergenic
1112967425 13:105213610-105213632 ATTCCTGGATGTCCAACTGCTGG - Intergenic
1113108435 13:106796467-106796489 ATGCCTGGCAGCCCACCTGCAGG - Intergenic
1114530991 14:23396405-23396427 CTGCCTTGAAGAACACCTGCAGG + Exonic
1114550978 14:23532746-23532768 CCAGCTGGCAGCCCACCTGCGGG - Exonic
1119494157 14:75064130-75064152 CGTCCTGAAATCCCACCTTCTGG - Intronic
1119727905 14:76933233-76933255 GCTGCTTGAAGCCCACCTGCAGG + Intergenic
1121214208 14:92234649-92234671 CTCCCTGAAAACCAACCTGCTGG + Intergenic
1121506329 14:94480268-94480290 CTTCATGGAAGCCCACCCAGTGG + Intergenic
1122931621 14:104935512-104935534 CTCCCTTGACCCCCACCTGCTGG + Exonic
1124689205 15:31807701-31807723 ATTCCTGGAAGACCAGCTCCAGG - Intronic
1131067708 15:89444587-89444609 CTGCCTGGAATCCCACCTGTGGG - Intergenic
1132712642 16:1276376-1276398 CCTCCTGGGTGCCCATCTGCGGG - Intergenic
1132866047 16:2093259-2093281 CTGCCCGGAACCCCACCTGGGGG + Intronic
1133104370 16:3496995-3497017 GTGCCTGTAATCCCACCTGCTGG - Intergenic
1133328151 16:4954866-4954888 GTTCCTGGAAGGCATCCTGCTGG - Intronic
1133525607 16:6602535-6602557 CTTACAGAAAGGCCACCTGCAGG + Intronic
1133597475 16:7306694-7306716 CTTCCTGGAAGCTCACCGCTAGG + Intronic
1134032598 16:11004467-11004489 CTTCCTGTGAGCCCTCCTCCTGG + Intronic
1135105478 16:19645690-19645712 TTTGCTGGAATCCCACCTGCTGG - Intronic
1135201714 16:20443072-20443094 CTTCCATCAAGCCCACCTGCTGG + Intergenic
1135203384 16:20460210-20460232 CTTCCTGGTGGCCCCACTGCAGG - Exonic
1135215619 16:20564728-20564750 CTTCCTGGTGGCCCCACTGCAGG + Exonic
1135217390 16:20584794-20584816 CTTCCATCAAGCCCACCTGCTGG - Intergenic
1136034145 16:27526046-27526068 GTTCATGGAAGCCCACCTGATGG - Intronic
1136518658 16:30782740-30782762 CTTCCTGGAAGCCCACGAGCTGG - Exonic
1137734897 16:50716467-50716489 TTTCCTGGAAGCACAGATGCTGG + Intronic
1138070847 16:53991667-53991689 CTTCCTGGAGGATCACCTGTAGG + Intronic
1138170890 16:54848817-54848839 CTTCCAGTAACCCCAACTGCAGG + Intergenic
1138249031 16:55488462-55488484 CTGGCTGGCTGCCCACCTGCCGG - Intronic
1141429796 16:83965665-83965687 CTTCCTTGAAGCACAGCAGCTGG - Exonic
1141969304 16:87469744-87469766 CTTCCGGGAGGCCCAGTTGCCGG - Intronic
1142292174 16:89198239-89198261 CTTCCTGGAGGCCGGCCTGGAGG - Exonic
1142411225 16:89918206-89918228 CTTCCTGGGAGCGGACCGGCTGG - Exonic
1144168836 17:12638791-12638813 ATTCATGGAAGCCCAGCTTCTGG - Intergenic
1146651038 17:34606597-34606619 CTTCCTGGAAGCCCAGTCCCTGG + Intronic
1147196697 17:38771218-38771240 CGTCGTGGATGCCCACCAGCAGG + Exonic
1147215810 17:38898405-38898427 CCTCCTTGTAGCGCACCTGCAGG - Exonic
1147363189 17:39944158-39944180 CTACCTGGATGCCAACCAGCTGG + Exonic
1147378694 17:40039042-40039064 CTTGCTGGATACCAACCTGCAGG + Intronic
1150135305 17:62692156-62692178 CTTCCTGCCTGCCCACCTGGGGG - Intronic
1150613835 17:66753841-66753863 CTCACCAGAAGCCCACCTGCTGG + Intronic
1150649714 17:67001822-67001844 CTTCCTGGAAAGCCACCAGTGGG + Intronic
1150675898 17:67245597-67245619 CTTCCTGGAAGCGCGGCCGCAGG - Intronic
1151597492 17:75087521-75087543 CTGCCTGGACTCCCACCGGCAGG + Intergenic
1152134324 17:78495012-78495034 CTTTCTGGAAGCCCGCCTTCTGG - Exonic
1152921348 17:83068124-83068146 CCTCCCGAAATCCCACCTGCAGG + Intergenic
1153925668 18:9832872-9832894 CTTCCTGCAGGCCTCCCTGCGGG + Intronic
1154370809 18:13761743-13761765 CTTACTGGAGCCACACCTGCAGG + Exonic
1156905600 18:42348625-42348647 CTTCAGGGAAGACTACCTGCTGG + Intergenic
1158962508 18:62598066-62598088 CTTCCTGCGGCCCCACCTGCAGG + Intergenic
1159188096 18:65005355-65005377 CTTCCAGGAAGTCCACATGTTGG + Intergenic
1160077784 18:75694354-75694376 CTTCCTGCATGCCCTCATGCAGG + Intergenic
1160149105 18:76385826-76385848 CTCCCAGGCAGCCCACCTGCAGG + Intronic
1160202743 18:76808869-76808891 TTTTCTGGGAGCCGACCTGCAGG - Intronic
1160747432 19:718734-718756 CTTCCTGGAAGGCTGCCTGGAGG + Intronic
1160820019 19:1053562-1053584 CCTCCAGGAAGCCCTCCTCCTGG - Intronic
1160997833 19:1892330-1892352 CTTCCAGGAATCCTCCCTGCAGG - Intergenic
1162017223 19:7852200-7852222 CTGCCTGGAGGCCCTGCTGCTGG + Intronic
1162396886 19:10422510-10422532 CTACCTGGATGCCCCACTGCTGG + Intronic
1162966840 19:14160159-14160181 CATCCTGGATGCCCAGCTGCAGG - Exonic
1163294905 19:16405736-16405758 CTTTCTGGAAGGCCCCCTCCAGG + Intronic
1163512120 19:17741576-17741598 CCTCCAGGAAGCCCTCCTTCTGG - Intergenic
1163787040 19:19280032-19280054 CTGCCTGGAAGCCTCCCCGCTGG + Intronic
1164773416 19:30831149-30831171 CTTCCTGGAATCCCACATTTGGG - Intergenic
1164836020 19:31355485-31355507 CTGCCTAGAAACCCACCTTCTGG + Intergenic
1167097244 19:47381013-47381035 CTTCCTGAAATCCCACCTTCAGG - Intronic
1167147365 19:47690344-47690366 CTTCCTGGAAGCCTGTTTGCTGG + Intronic
1167304001 19:48696504-48696526 CTTCATGGAACCCAAACTGCTGG + Intronic
925048748 2:795243-795265 CTCCCTGGAAGCCCCCCGGATGG + Intergenic
925174596 2:1773340-1773362 CCTCCTGGAGGCCGCCCTGCTGG - Intergenic
925606894 2:5669010-5669032 GTTTCTGGAATACCACCTGCAGG + Intergenic
926202932 2:10814196-10814218 CCTCCAGGAAGCCCACCAGCCGG - Intronic
927176178 2:20410560-20410582 CTTCCTGGAAGCTCAGGTCCAGG + Intergenic
927710615 2:25323441-25323463 CTCCCTGGGAGGCCAACTGCGGG + Intronic
927958847 2:27226802-27226824 CCTTCTGGCATCCCACCTGCTGG + Intronic
928144512 2:28759970-28759992 TTTCCTGGAATGCCACCTGAAGG - Intronic
928410335 2:31049509-31049531 CATCCTGGAAGCTCAACTGCTGG + Intronic
929524237 2:42685515-42685537 CTCCCTTGAACCCCACCGGCAGG + Intronic
930423031 2:51177406-51177428 CTTCCTGAGAGCCAAACTGCAGG - Intergenic
931748945 2:65314130-65314152 CGTCCGGGAAGCTCACCTGGCGG + Exonic
934588307 2:95525555-95525577 CCTCCTGGACGCCCTCCTCCGGG - Intergenic
934657146 2:96122348-96122370 CTGCCTGGAAGCCTCCCAGCGGG + Intergenic
935610853 2:105024266-105024288 CTTCCAGGAAGGCCAACTGGGGG - Intergenic
935705221 2:105850993-105851015 CTGGCTGGAAGCCCATCTGGAGG - Intronic
936155415 2:110043618-110043640 GTGCCTGGAAGCCCAGCTCCTGG + Intergenic
938055053 2:128208485-128208507 CTTCCTGGCTGCCCACCGTCTGG + Intergenic
938077063 2:128345739-128345761 CTTCCTGGAAGGGAACCTGTGGG + Intergenic
938161981 2:128994277-128994299 CTGCCTCGAAGGCCACATGCTGG + Intergenic
938312452 2:130301977-130301999 CTTCCTTGGAGACCACCTGAAGG - Intergenic
944949158 2:204727563-204727585 CTGCCAGGATGGCCACCTGCAGG - Intronic
945681537 2:212919732-212919754 CTTCATGGAAGCCCAGATGGTGG - Intergenic
947219744 2:227780881-227780903 ACTCCTGGATCCCCACCTGCTGG + Intergenic
947796101 2:232894945-232894967 CTTCGTGGAAGGCCAACTTCAGG - Intronic
948033506 2:234839022-234839044 CTTCCTGAGACCCCACCTGGTGG - Intergenic
948148492 2:235726622-235726644 CTCTCTGGAAGCCCAGCTCCAGG + Intronic
949061517 2:241961262-241961284 TGTCCTGGAATCCCACCTGCAGG - Intergenic
1168812320 20:712041-712063 CTTTCTAAAATCCCACCTGCTGG - Intergenic
1170694769 20:18648182-18648204 CTTGCTGGGAGGCCAACTGCAGG + Intronic
1172526739 20:35604308-35604330 GTTCCTGGAAGCCCACATTGGGG + Intergenic
1173167958 20:40699363-40699385 CCTCCAGGAAGCCTTCCTGCTGG + Intergenic
1173518592 20:43682626-43682648 CTCACTGCAAGCCCACATGCCGG - Intronic
1173678711 20:44860935-44860957 ATTCCTGTAAGCCCAGCTCCTGG - Intergenic
1174286957 20:49480665-49480687 CTCACTGAAGGCCCACCTGCAGG - Intronic
1176869143 21:14072679-14072701 CTTCCTGGCAGCCCCTTTGCTGG - Intergenic
1178340094 21:31778829-31778851 CTGCCTGACTGCCCACCTGCTGG - Intergenic
1179409803 21:41153901-41153923 CTACCTGGAAGGCTACCTGCTGG - Intergenic
1183372679 22:37443217-37443239 CTTCCTGGCAGCCCACATGGTGG - Intergenic
1183823344 22:40365050-40365072 CTTCTTGGAAGCTTACCTGCTGG - Exonic
1184805444 22:46792428-46792450 GTTCCTGGGAGCCCACCTTTCGG + Intronic
1185003382 22:48260535-48260557 CTTTCAGGAAGCCCAGCTCCAGG + Intergenic
1185009387 22:48304812-48304834 CTGCCTGGGAGCCCTTCTGCGGG + Intergenic
1185139083 22:49090246-49090268 CTTCCAGGGAGCACAGCTGCTGG - Intergenic
1185340091 22:50287303-50287325 AGTCCTGTCAGCCCACCTGCCGG + Intronic
950680526 3:14582005-14582027 CTCCCTGGTAGCCCTGCTGCTGG - Intergenic
951885598 3:27520887-27520909 CTCACTGCAAGCCCACCTCCCGG - Intergenic
952478993 3:33740859-33740881 CTCACTGGAAGCTCACCTCCTGG + Intergenic
952860826 3:37810980-37811002 CTTCAAGAAAGCCCATCTGCTGG + Intronic
952879512 3:37974720-37974742 CTTCCTTGAAGCCCAGGAGCTGG - Intronic
952883995 3:38001842-38001864 CTACCTGGAAGATCACCAGCTGG - Exonic
953390426 3:42530772-42530794 CTGCCTTACAGCCCACCTGCAGG - Exonic
954136761 3:48585434-48585456 ATTCCTAGAAGCCCAGCTGGAGG - Intronic
954374366 3:50186242-50186264 CTTCCTGGGAGCACTCCTTCAGG + Intronic
954379803 3:50213421-50213443 TTTCCTGGAAGGCCCCCTGAGGG + Intronic
956643262 3:71434340-71434362 AGTCCTGGGAGTCCACCTGCAGG + Intronic
957078720 3:75619948-75619970 CTTCCTGGACCGCCTCCTGCAGG + Intergenic
957322768 3:78653518-78653540 CCACCTGGATTCCCACCTGCTGG + Intronic
961119320 3:124360069-124360091 GCTCCTGGATGCCCAGCTGCTGG - Intronic
961674459 3:128555997-128556019 CTTCCGCGAAGCCCCCCAGCTGG - Intergenic
962869428 3:139475243-139475265 CTCACTGCAAGCCCACCTCCCGG - Intronic
963533616 3:146500909-146500931 CTTCCTGGATGACCTCCTTCAGG - Intergenic
964761890 3:160142130-160142152 CTCCCAGGTAGCCCAACTGCTGG - Intergenic
967404192 3:189098515-189098537 TTTCCTGGAAGCCCATCCCCTGG - Intronic
967951287 3:194842964-194842986 CTTCCTTGAAGCCCCACTCCAGG - Intergenic
968574938 4:1361235-1361257 CTTCCTGGAGTCCCAGCTGCAGG - Intronic
968626035 4:1627106-1627128 CTTCCTGGGGGCCGACCTGGGGG - Intronic
968970715 4:3792098-3792120 CTTCTGTGAAGCTCACCTGCTGG - Intergenic
969021797 4:4143916-4143938 CTTCCTGGACCGCCTCCTGCAGG + Intergenic
969478796 4:7436039-7436061 CTTCCCGCCAGCCCTCCTGCTGG + Intronic
969732071 4:8963499-8963521 CTTCCTGGACCGCCTCCTGCAGG - Intergenic
969791664 4:9497584-9497606 CTTCCTGGACCGCCTCCTGCAGG - Intergenic
970029702 4:11660828-11660850 CTCACTGCAAGCCCACCTCCTGG + Intergenic
971210228 4:24609127-24609149 CTTCCTGGAATACTACTTGCTGG - Intergenic
973898777 4:55445279-55445301 CTTGCTGGAAAGCCACCTGCCGG - Intronic
973942480 4:55924602-55924624 CTTCCTTGAATCCCACCTGTGGG - Intergenic
976269530 4:83217203-83217225 CTCGCTGGAAGCCCAGCCGCTGG + Intergenic
976845862 4:89488925-89488947 CTTCCTGGCAGCCAAGCTGTGGG + Intergenic
976857885 4:89626752-89626774 CTTCCTTGAAGCATACCTTCAGG - Intergenic
977606618 4:98991085-98991107 CTTCCTAGATGCTCAACTGCAGG - Intergenic
978834541 4:113132964-113132986 CTTCATGGCAGCCCTCCAGCTGG + Intronic
979245926 4:118503874-118503896 CTTGCTGTCATCCCACCTGCTGG - Intergenic
981748508 4:148072615-148072637 CTTCCTAGACGGCCACCTGCAGG + Exonic
982112651 4:152070995-152071017 CTTCCTTTAAGCCCACCTGGGGG - Intergenic
985652246 5:1112469-1112491 CTTCCTGCACCCCCTCCTGCTGG + Intergenic
985787117 5:1902249-1902271 CGTACTGGAAGCCTACATGCTGG - Intergenic
987343929 5:16962284-16962306 CTTACTGCAACCCCACCTCCTGG - Intergenic
991688282 5:69201782-69201804 CTTCCTGCAACCTCACCTCCTGG - Intronic
993134231 5:83937162-83937184 CATGCTGCAAGCCCACCTTCAGG + Intergenic
994117308 5:96075012-96075034 CTTCCTGGCAGACCACTTCCTGG - Intergenic
994164411 5:96593763-96593785 CTTCCTGGATTCCCACATGGTGG - Intronic
994194027 5:96901631-96901653 CTTCCTGGAAAACCCCCTGGAGG - Exonic
997611697 5:135220182-135220204 CTCCCTGGAAGCCCAGCATCTGG + Intronic
997698980 5:135883140-135883162 CTGGCTGAAAGCCCACCTGGTGG - Intronic
1001219092 5:169883775-169883797 CTTCCTTGAATCTCACCTGCTGG + Exonic
1002043604 5:176530495-176530517 CTGCCTGGGAGCCCAGATGCAGG + Intronic
1003461024 6:6328325-6328347 CTTTCTGGAAGCCCACATCCAGG + Intergenic
1003979257 6:11374723-11374745 CTTCATGGAACCCAATCTGCTGG + Intronic
1004536913 6:16511909-16511931 CTACCTGGAAGGCCACCTCGTGG - Intronic
1004545856 6:16597563-16597585 GTGCCTGGAAGCCCAGCTACTGG - Intronic
1007527445 6:42508829-42508851 CTCACTGCAAGCCCACCTCCCGG - Intergenic
1007652662 6:43432901-43432923 CTTCCAGGAAGCCCACCAGTAGG - Exonic
1007821694 6:44565119-44565141 GTTCCTGGGAGGCCTCCTGCAGG - Intergenic
1010064025 6:71659260-71659282 CTTCATGGAACCCCTCCTACAGG - Intergenic
1012423983 6:99094427-99094449 CTTCCTTCCAGCACACCTGCAGG + Intergenic
1012624767 6:101392700-101392722 CTCCCTGGAAGCCAAGCTGCGGG + Intergenic
1016440034 6:144073900-144073922 CTCCCTGGAGGCCAACCTGCAGG - Intergenic
1016657970 6:146543446-146543468 CTCCCCGGAGGCCCACCAGCGGG + Intergenic
1017630389 6:156391243-156391265 TTTCCTGGCTGCCCACCTGGAGG + Intergenic
1019280965 7:200062-200084 GTTCCTTGAAGCTCACCCGCTGG - Intronic
1019487137 7:1294518-1294540 CTCCCTGGAAACCCACCGGATGG + Intergenic
1021097630 7:16551502-16551524 CTTCCTGGAAGCCCTACTTCTGG + Intronic
1022505704 7:30907726-30907748 CTTCCTGGTGGCCCTCCTGGAGG + Intergenic
1022670475 7:32450606-32450628 CTTACTGGAAGCTCGCCTCCCGG - Intergenic
1023527201 7:41117226-41117248 ATTGCAGGAAACCCACCTGCTGG + Intergenic
1023964548 7:44956157-44956179 CTCCCTGCAATCCCACCAGCAGG + Intergenic
1024944168 7:54792422-54792444 CTGCCTGGCTGCCCACCTTCTGG - Intergenic
1024976127 7:55115589-55115611 GTTCCTGGAAGCCTTCCTGAAGG + Intronic
1026118087 7:67513212-67513234 CTTCCGGGAAGCCCACAGTCTGG + Intergenic
1029134376 7:98358848-98358870 CTTCCAGGAATCACACCTCCCGG + Intronic
1029541053 7:101182189-101182211 GTTCCTGGAATCCCACATACAGG + Intergenic
1029736839 7:102469799-102469821 CTGCCCGGACGCCCGCCTGCTGG + Exonic
1030195261 7:106846798-106846820 CTTACTGCAACCCCACCTCCCGG - Intergenic
1033482844 7:141759337-141759359 CTTCCAGGATGCACACCTGGAGG + Intronic
1035634216 8:1131360-1131382 CCACCAGGAACCCCACCTGCCGG - Intergenic
1035731688 8:1858109-1858131 CCTCCTGGAAACTCACCTGTGGG - Exonic
1038009416 8:23463000-23463022 CTTACTGCAAGCTCACCTCCTGG + Intergenic
1038152598 8:24956146-24956168 GGTCCTGGAAGCCGAGCTGCTGG - Exonic
1038905400 8:31896609-31896631 CTTCTTGGACGCCCACTTCCAGG + Intronic
1041256512 8:55983635-55983657 CTTCCTAGCTGCCCACCAGCAGG + Intronic
1042878631 8:73463010-73463032 CTTCCAGGATGCCTGCCTGCCGG + Intronic
1046233550 8:111391026-111391048 CTCACTGTAAGCCCACCTCCTGG - Intergenic
1048304439 8:133273802-133273824 CTTTGTGGAAGGCCACCTGGGGG - Intronic
1048932264 8:139324504-139324526 CTTCCTGACAGACCACTTGCAGG - Intergenic
1049261322 8:141640700-141640722 GCTCCAGGGAGCCCACCTGCAGG - Intergenic
1049792625 8:144478974-144478996 CTTCCTGGATTCCTACCTGGGGG + Intronic
1049998708 9:1053330-1053352 GGTCCTGGGAGCCCACCTGTCGG - Intronic
1050586677 9:7119803-7119825 CTTCCTGGCAGCCTCCCTCCTGG + Intergenic
1055592707 9:77834199-77834221 CTCCATCAAAGCCCACCTGCTGG - Intronic
1057189925 9:93081328-93081350 CTTCCTTCAGGCCCTCCTGCTGG + Intronic
1058876245 9:109247372-109247394 TTTCCTGGAAGCCCATCTCAAGG + Intronic
1060732373 9:126046792-126046814 CTTCCAGGAAGTCCATCTCCTGG + Intergenic
1061201942 9:129143113-129143135 CTTCCTGGAGCTCCCCCTGCTGG + Intronic
1061421002 9:130472793-130472815 CTGCCTGGAAGCCACCCTGCAGG - Intronic
1062344453 9:136108458-136108480 CGTCCTGGGAGCCCAGATGCTGG - Intergenic
1062363148 9:136197101-136197123 CTTGCTGGGAGGCCACCTGGCGG + Exonic
1062483985 9:136765090-136765112 CTTGCTGGAAGCCCAGCTGGGGG - Intronic
1203498344 Un_GL000224v1:174507-174529 TTTTCTGGAATCCCACGTGCAGG + Intergenic
1203510897 Un_KI270741v1:116756-116778 TTTTCTGGAATCCCACGTGCAGG + Intergenic
1187112130 X:16312893-16312915 CCACCTGGACCCCCACCTGCTGG - Intergenic
1187826266 X:23335175-23335197 CTTCCAGAAAGCCAACATGCTGG + Exonic
1188003575 X:25002839-25002861 CTTGGTGGAAGCCCGCCCGCGGG - Intergenic
1189889229 X:45581557-45581579 CTTCCTGCATGGTCACCTGCAGG - Intergenic
1189989933 X:46584683-46584705 CTTCCTGGTTTCCAACCTGCTGG - Intronic
1192242998 X:69349540-69349562 CTTTCTGGAAGCTTCCCTGCTGG + Intergenic
1192286574 X:69744664-69744686 CTTTCTTGAAGACCACCTGCTGG - Intronic
1192455116 X:71269839-71269861 CTTCCTGGCCGCCAACCTTCTGG - Intergenic
1192565146 X:72157336-72157358 CTTCCTGGAACCCCAGTTCCAGG + Intergenic
1193380605 X:80812248-80812270 CTTGCTGGAAACCCACCCTCTGG + Intergenic
1194701410 X:97119289-97119311 CTTCCTGAGAGCCGAGCTGCAGG + Intronic
1196675668 X:118418416-118418438 CTTCCTGTGAGCCGAGCTGCAGG + Intronic
1198627727 X:138597238-138597260 CTTCCTGTAATCCCAGCTACTGG + Intergenic
1200071017 X:153529364-153529386 CTTCCAGGAAACCCCCCTACTGG - Intronic