ID: 1077332933

View in Genome Browser
Species Human (GRCh38)
Location 11:1991253-1991275
Sequence CTTCCTGGAAGCCCACCTGC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 301
Summary {0: 2, 1: 0, 2: 1, 3: 37, 4: 261}

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1077332933_1077332946 12 Left 1077332933 11:1991253-1991275 CCTGCAGGTGGGCTTCCAGGAAG 0: 2
1: 0
2: 1
3: 37
4: 261
Right 1077332946 11:1991288-1991310 GCTTCCCTCAGCCCTGGAAGGGG No data
1077332933_1077332947 13 Left 1077332933 11:1991253-1991275 CCTGCAGGTGGGCTTCCAGGAAG 0: 2
1: 0
2: 1
3: 37
4: 261
Right 1077332947 11:1991289-1991311 CTTCCCTCAGCCCTGGAAGGGGG No data
1077332933_1077332950 20 Left 1077332933 11:1991253-1991275 CCTGCAGGTGGGCTTCCAGGAAG 0: 2
1: 0
2: 1
3: 37
4: 261
Right 1077332950 11:1991296-1991318 CAGCCCTGGAAGGGGGCCAACGG 0: 2
1: 0
2: 2
3: 41
4: 385
1077332933_1077332937 -10 Left 1077332933 11:1991253-1991275 CCTGCAGGTGGGCTTCCAGGAAG 0: 2
1: 0
2: 1
3: 37
4: 261
Right 1077332937 11:1991266-1991288 TTCCAGGAAGGGGCCCCCGCTGG No data
1077332933_1077332943 6 Left 1077332933 11:1991253-1991275 CCTGCAGGTGGGCTTCCAGGAAG 0: 2
1: 0
2: 1
3: 37
4: 261
Right 1077332943 11:1991282-1991304 CCGCTGGCTTCCCTCAGCCCTGG No data
1077332933_1077332953 30 Left 1077332933 11:1991253-1991275 CCTGCAGGTGGGCTTCCAGGAAG 0: 2
1: 0
2: 1
3: 37
4: 261
Right 1077332953 11:1991306-1991328 AGGGGGCCAACGGTGTCACCAGG No data
1077332933_1077332945 11 Left 1077332933 11:1991253-1991275 CCTGCAGGTGGGCTTCCAGGAAG 0: 2
1: 0
2: 1
3: 37
4: 261
Right 1077332945 11:1991287-1991309 GGCTTCCCTCAGCCCTGGAAGGG No data
1077332933_1077332944 10 Left 1077332933 11:1991253-1991275 CCTGCAGGTGGGCTTCCAGGAAG 0: 2
1: 0
2: 1
3: 37
4: 261
Right 1077332944 11:1991286-1991308 TGGCTTCCCTCAGCCCTGGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1077332933 Original CRISPR CTTCCTGGAAGCCCACCTGC AGG (reversed) Intergenic