ID: 1077332936

View in Genome Browser
Species Human (GRCh38)
Location 11:1991256-1991278
Sequence GCAGGTGGGCTTCCAGGAAG GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 615
Summary {0: 2, 1: 1, 2: 9, 3: 75, 4: 528}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1077332927_1077332936 -7 Left 1077332927 11:1991240-1991262 CCCAGCAAGCCGGCCTGCAGGTG 0: 2
1: 0
2: 0
3: 8
4: 143
Right 1077332936 11:1991256-1991278 GCAGGTGGGCTTCCAGGAAGGGG 0: 2
1: 1
2: 9
3: 75
4: 528
1077332925_1077332936 -3 Left 1077332925 11:1991236-1991258 CCTTCCCAGCAAGCCGGCCTGCA 0: 2
1: 0
2: 1
3: 24
4: 202
Right 1077332936 11:1991256-1991278 GCAGGTGGGCTTCCAGGAAGGGG 0: 2
1: 1
2: 9
3: 75
4: 528
1077332921_1077332936 14 Left 1077332921 11:1991219-1991241 CCTCTGCGAGAGCAGCCCCTTCC 0: 2
1: 0
2: 2
3: 17
4: 238
Right 1077332936 11:1991256-1991278 GCAGGTGGGCTTCCAGGAAGGGG 0: 2
1: 1
2: 9
3: 75
4: 528
1077332928_1077332936 -8 Left 1077332928 11:1991241-1991263 CCAGCAAGCCGGCCTGCAGGTGG 0: 2
1: 0
2: 0
3: 16
4: 173
Right 1077332936 11:1991256-1991278 GCAGGTGGGCTTCCAGGAAGGGG 0: 2
1: 1
2: 9
3: 75
4: 528
1077332923_1077332936 -1 Left 1077332923 11:1991234-1991256 CCCCTTCCCAGCAAGCCGGCCTG 0: 2
1: 0
2: 2
3: 31
4: 526
Right 1077332936 11:1991256-1991278 GCAGGTGGGCTTCCAGGAAGGGG 0: 2
1: 1
2: 9
3: 75
4: 528
1077332924_1077332936 -2 Left 1077332924 11:1991235-1991257 CCCTTCCCAGCAAGCCGGCCTGC 0: 2
1: 0
2: 0
3: 24
4: 181
Right 1077332936 11:1991256-1991278 GCAGGTGGGCTTCCAGGAAGGGG 0: 2
1: 1
2: 9
3: 75
4: 528

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1077332936 Original CRISPR GCAGGTGGGCTTCCAGGAAG GGG Intergenic