ID: 1077332937

View in Genome Browser
Species Human (GRCh38)
Location 11:1991266-1991288
Sequence TTCCAGGAAGGGGCCCCCGC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1077332928_1077332937 2 Left 1077332928 11:1991241-1991263 CCAGCAAGCCGGCCTGCAGGTGG 0: 2
1: 0
2: 0
3: 16
4: 173
Right 1077332937 11:1991266-1991288 TTCCAGGAAGGGGCCCCCGCTGG No data
1077332925_1077332937 7 Left 1077332925 11:1991236-1991258 CCTTCCCAGCAAGCCGGCCTGCA 0: 2
1: 0
2: 1
3: 24
4: 202
Right 1077332937 11:1991266-1991288 TTCCAGGAAGGGGCCCCCGCTGG No data
1077332933_1077332937 -10 Left 1077332933 11:1991253-1991275 CCTGCAGGTGGGCTTCCAGGAAG 0: 2
1: 0
2: 1
3: 37
4: 261
Right 1077332937 11:1991266-1991288 TTCCAGGAAGGGGCCCCCGCTGG No data
1077332931_1077332937 -6 Left 1077332931 11:1991249-1991271 CCGGCCTGCAGGTGGGCTTCCAG 0: 2
1: 0
2: 1
3: 35
4: 328
Right 1077332937 11:1991266-1991288 TTCCAGGAAGGGGCCCCCGCTGG No data
1077332924_1077332937 8 Left 1077332924 11:1991235-1991257 CCCTTCCCAGCAAGCCGGCCTGC 0: 2
1: 0
2: 0
3: 24
4: 181
Right 1077332937 11:1991266-1991288 TTCCAGGAAGGGGCCCCCGCTGG No data
1077332921_1077332937 24 Left 1077332921 11:1991219-1991241 CCTCTGCGAGAGCAGCCCCTTCC 0: 2
1: 0
2: 2
3: 17
4: 238
Right 1077332937 11:1991266-1991288 TTCCAGGAAGGGGCCCCCGCTGG No data
1077332927_1077332937 3 Left 1077332927 11:1991240-1991262 CCCAGCAAGCCGGCCTGCAGGTG 0: 2
1: 0
2: 0
3: 8
4: 143
Right 1077332937 11:1991266-1991288 TTCCAGGAAGGGGCCCCCGCTGG No data
1077332923_1077332937 9 Left 1077332923 11:1991234-1991256 CCCCTTCCCAGCAAGCCGGCCTG 0: 2
1: 0
2: 2
3: 31
4: 526
Right 1077332937 11:1991266-1991288 TTCCAGGAAGGGGCCCCCGCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1077332937 Original CRISPR TTCCAGGAAGGGGCCCCCGC TGG Intergenic
No off target data available for this crispr