ID: 1077332938

View in Genome Browser
Species Human (GRCh38)
Location 11:1991268-1991290
Sequence AGCCAGCGGGGGCCCCTTCC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 10 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1077332938_1077332950 5 Left 1077332938 11:1991268-1991290 CCAGGAAGGGGCCCCCGCTGGCT No data
Right 1077332950 11:1991296-1991318 CAGCCCTGGAAGGGGGCCAACGG 0: 2
1: 0
2: 2
3: 41
4: 385
1077332938_1077332956 26 Left 1077332938 11:1991268-1991290 CCAGGAAGGGGCCCCCGCTGGCT No data
Right 1077332956 11:1991317-1991339 GGTGTCACCAGGAGCAGGCCAGG No data
1077332938_1077332946 -3 Left 1077332938 11:1991268-1991290 CCAGGAAGGGGCCCCCGCTGGCT No data
Right 1077332946 11:1991288-1991310 GCTTCCCTCAGCCCTGGAAGGGG No data
1077332938_1077332943 -9 Left 1077332938 11:1991268-1991290 CCAGGAAGGGGCCCCCGCTGGCT No data
Right 1077332943 11:1991282-1991304 CCGCTGGCTTCCCTCAGCCCTGG No data
1077332938_1077332947 -2 Left 1077332938 11:1991268-1991290 CCAGGAAGGGGCCCCCGCTGGCT No data
Right 1077332947 11:1991289-1991311 CTTCCCTCAGCCCTGGAAGGGGG No data
1077332938_1077332944 -5 Left 1077332938 11:1991268-1991290 CCAGGAAGGGGCCCCCGCTGGCT No data
Right 1077332944 11:1991286-1991308 TGGCTTCCCTCAGCCCTGGAAGG No data
1077332938_1077332945 -4 Left 1077332938 11:1991268-1991290 CCAGGAAGGGGCCCCCGCTGGCT No data
Right 1077332945 11:1991287-1991309 GGCTTCCCTCAGCCCTGGAAGGG No data
1077332938_1077332955 21 Left 1077332938 11:1991268-1991290 CCAGGAAGGGGCCCCCGCTGGCT No data
Right 1077332955 11:1991312-1991334 CCAACGGTGTCACCAGGAGCAGG No data
1077332938_1077332953 15 Left 1077332938 11:1991268-1991290 CCAGGAAGGGGCCCCCGCTGGCT No data
Right 1077332953 11:1991306-1991328 AGGGGGCCAACGGTGTCACCAGG No data
1077332938_1077332957 27 Left 1077332938 11:1991268-1991290 CCAGGAAGGGGCCCCCGCTGGCT No data
Right 1077332957 11:1991318-1991340 GTGTCACCAGGAGCAGGCCAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1077332938 Original CRISPR AGCCAGCGGGGGCCCCTTCC TGG (reversed) Intergenic