ID: 1077332943

View in Genome Browser
Species Human (GRCh38)
Location 11:1991282-1991304
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1077332924_1077332943 24 Left 1077332924 11:1991235-1991257 CCCTTCCCAGCAAGCCGGCCTGC 0: 2
1: 0
2: 0
3: 24
4: 181
Right 1077332943 11:1991282-1991304 CCGCTGGCTTCCCTCAGCCCTGG No data
1077332927_1077332943 19 Left 1077332927 11:1991240-1991262 CCCAGCAAGCCGGCCTGCAGGTG 0: 2
1: 0
2: 0
3: 8
4: 143
Right 1077332943 11:1991282-1991304 CCGCTGGCTTCCCTCAGCCCTGG No data
1077332928_1077332943 18 Left 1077332928 11:1991241-1991263 CCAGCAAGCCGGCCTGCAGGTGG 0: 2
1: 0
2: 0
3: 16
4: 173
Right 1077332943 11:1991282-1991304 CCGCTGGCTTCCCTCAGCCCTGG No data
1077332931_1077332943 10 Left 1077332931 11:1991249-1991271 CCGGCCTGCAGGTGGGCTTCCAG 0: 2
1: 0
2: 1
3: 35
4: 328
Right 1077332943 11:1991282-1991304 CCGCTGGCTTCCCTCAGCCCTGG No data
1077332923_1077332943 25 Left 1077332923 11:1991234-1991256 CCCCTTCCCAGCAAGCCGGCCTG 0: 2
1: 0
2: 2
3: 31
4: 526
Right 1077332943 11:1991282-1991304 CCGCTGGCTTCCCTCAGCCCTGG No data
1077332938_1077332943 -9 Left 1077332938 11:1991268-1991290 CCAGGAAGGGGCCCCCGCTGGCT No data
Right 1077332943 11:1991282-1991304 CCGCTGGCTTCCCTCAGCCCTGG No data
1077332925_1077332943 23 Left 1077332925 11:1991236-1991258 CCTTCCCAGCAAGCCGGCCTGCA 0: 2
1: 0
2: 1
3: 24
4: 202
Right 1077332943 11:1991282-1991304 CCGCTGGCTTCCCTCAGCCCTGG No data
1077332933_1077332943 6 Left 1077332933 11:1991253-1991275 CCTGCAGGTGGGCTTCCAGGAAG 0: 2
1: 0
2: 1
3: 37
4: 261
Right 1077332943 11:1991282-1991304 CCGCTGGCTTCCCTCAGCCCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1077332943 Original CRISPR CCGCTGGCTTCCCTCAGCCC TGG Intergenic