ID: 1077333105

View in Genome Browser
Species Human (GRCh38)
Location 11:1991992-1992014
Sequence AGGCAGGGATTAGGGGCAGC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 471
Summary {0: 2, 1: 0, 2: 2, 3: 41, 4: 426}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1077333105_1077333114 0 Left 1077333105 11:1991992-1992014 CCAGCTGCCCCTAATCCCTGCCT 0: 2
1: 0
2: 2
3: 41
4: 426
Right 1077333114 11:1992015-1992037 GAAAACGTGCTCCTGGGTCACGG 0: 2
1: 0
2: 0
3: 8
4: 109
1077333105_1077333111 -7 Left 1077333105 11:1991992-1992014 CCAGCTGCCCCTAATCCCTGCCT 0: 2
1: 0
2: 2
3: 41
4: 426
Right 1077333111 11:1992008-1992030 CCTGCCTGAAAACGTGCTCCTGG 0: 2
1: 0
2: 0
3: 8
4: 124
1077333105_1077333112 -6 Left 1077333105 11:1991992-1992014 CCAGCTGCCCCTAATCCCTGCCT 0: 2
1: 0
2: 2
3: 41
4: 426
Right 1077333112 11:1992009-1992031 CTGCCTGAAAACGTGCTCCTGGG 0: 2
1: 0
2: 0
3: 5
4: 103

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1077333105 Original CRISPR AGGCAGGGATTAGGGGCAGC TGG (reversed) Intergenic
900088289 1:908817-908839 AGGGAGGGATGAGGGGCAGGGGG + Intergenic
900420330 1:2553414-2553436 TGGGAGGGATCTGGGGCAGCTGG - Intergenic
900424096 1:2568244-2568266 TGGGAGGGATCTGGGGCAGCTGG + Intergenic
900497094 1:2980698-2980720 AGGGAGGGAAGGGGGGCAGCTGG + Intergenic
900512081 1:3065524-3065546 GGGCTGGGGGTAGGGGCAGCTGG + Intergenic
900700771 1:4047454-4047476 AGGCAGGGATTGGGGGAGGGTGG + Intergenic
901019172 1:6247271-6247293 AGGAAGACATTAAGGGCAGCTGG + Intergenic
901086048 1:6613262-6613284 TGGCCGGGAGTAGGGGCGGCAGG - Intronic
901321972 1:8345584-8345606 AGGCAGGGACTAGGGGCTGGAGG + Intergenic
902905298 1:19552217-19552239 AGGCTGGGATTACAGGCACCTGG - Intergenic
903019994 1:20387040-20387062 AGGCAGGGCTGAGGGGGAGGAGG + Intergenic
903193148 1:21667987-21668009 AGGCAGTGATCAGGTCCAGCTGG - Intronic
903280885 1:22249213-22249235 AGGCTGGGGCCAGGGGCAGCTGG + Intergenic
903777899 1:25805027-25805049 AGGCAGGGGGTGGGGGTAGCTGG - Intronic
903832861 1:26184943-26184965 AGGCAGGGAGTAGGTTTAGCGGG + Intronic
904314118 1:29649363-29649385 GGGCAGGGAGTCGGGGTAGCTGG + Intergenic
904357271 1:29948429-29948451 TGGCAGGGAGTCAGGGCAGCTGG + Intergenic
904773956 1:32895522-32895544 AGGCCTGGAGTAGGGGCACCAGG - Intronic
904811922 1:33168975-33168997 AGTCAGGGAATAAGGACAGCGGG + Intronic
904990123 1:34585820-34585842 AGGCAGGGATAAATGGCAGGAGG - Intergenic
905370198 1:37478987-37479009 AGGGAGGGAGGTGGGGCAGCTGG - Intronic
906064170 1:42968352-42968374 TGCCAGGGATTAGGGGTAACAGG - Intergenic
906785431 1:48611289-48611311 AGGCAGGGAGTATGGAGAGCAGG + Intronic
907044766 1:51294085-51294107 AGGCTGGGATCACTGGCAGCCGG + Intronic
907261020 1:53218787-53218809 GGGCAGGGATTTGGGGAAACTGG - Intronic
907524602 1:55046801-55046823 AGGCAGGCAGTGGGGGCTGCAGG - Intronic
910396093 1:86795159-86795181 AGGCAGAGATTACGGTGAGCGGG + Intergenic
911057507 1:93721180-93721202 TGGCAGGGATTAGTAGTAGCTGG + Intronic
915443657 1:155962235-155962257 AGGCAGGGCTCAGGGCCAGAGGG + Intronic
915598207 1:156907206-156907228 AGGCAGGGTGCAGGGGGAGCTGG + Intronic
916934946 1:169618029-169618051 AGGCAGGGATGAGGTGCTGTGGG - Intronic
917099731 1:171432879-171432901 AGAGAGGGACTAGGGGCAGAGGG + Intergenic
917801454 1:178574374-178574396 TGGCAGGGGTTAGGGCCAGGGGG - Intergenic
917920949 1:179749324-179749346 AAGCAGGGATAAGGGGCTGTGGG + Intronic
919770184 1:201153756-201153778 AGGCAGGCTTAAGGAGCAGCTGG + Intronic
919813190 1:201421814-201421836 TGGGAGGGAGGAGGGGCAGCAGG - Intronic
921149234 1:212386476-212386498 GGGCAGGGATGAGGAGAAGCAGG - Intronic
921456849 1:215381045-215381067 AGCCAGGGAGTGGGTGCAGCAGG + Intergenic
921737280 1:218642776-218642798 AGGCAGGGTTGAGGGAAAGCCGG + Intergenic
922222321 1:223618142-223618164 AGGCAGGGAACATGGGGAGCAGG + Intronic
924608089 1:245552246-245552268 ACGCAGGGAAGAGGTGCAGCTGG + Intronic
1062818669 10:518242-518264 AGTCAGGCAGCAGGGGCAGCAGG - Intronic
1066454912 10:35564624-35564646 AGGCTGGGATCAGGGTCAGGAGG + Intronic
1066455068 10:35565508-35565530 AGGCAGGGATTATGGGGGGAGGG - Intronic
1067181057 10:43986298-43986320 AGGGTGGGATGAGGGGCTGCAGG - Intergenic
1067277668 10:44849503-44849525 AGTCAGGGTGTAGGGGCAGTTGG - Intergenic
1069703501 10:70442405-70442427 AGGCAGGGATTGGGGGATGTGGG - Intronic
1070187046 10:74074330-74074352 CTGCTGGGATCAGGGGCAGCAGG + Intronic
1070641999 10:78177040-78177062 AGGCGGGGAGAAGGGACAGCGGG - Intergenic
1070750219 10:78959693-78959715 AGACAGGGAATAGGGGCTGCAGG + Intergenic
1072200634 10:93155258-93155280 AGGCTGGGATTAGGGGGAGTGGG + Intergenic
1072466501 10:95667496-95667518 AGGAAGGGATGAGGGGCAGATGG + Intronic
1072764882 10:98087321-98087343 AGGCTGAGCTCAGGGGCAGCAGG - Intergenic
1073995024 10:109305794-109305816 AGGCATGGATATGGGGGAGCAGG + Intergenic
1074761428 10:116669969-116669991 AGGCAGGGATCCTGGGCGGCCGG - Exonic
1074937262 10:118193837-118193859 AAGATGGGAGTAGGGGCAGCTGG - Intergenic
1075028336 10:119003589-119003611 AGGCAGCAGCTAGGGGCAGCTGG + Intergenic
1075136519 10:119790918-119790940 AAGCAGTAATTAGGGGCTGCAGG - Intronic
1075422035 10:122308905-122308927 AGGCAGGGACTGGGGGAAGCAGG - Intronic
1075483343 10:122800268-122800290 AGGAAGGGCTTGGGGGCAGGAGG + Intergenic
1075955268 10:126518090-126518112 AGGCAGGGATTGAGGGCAGTGGG - Intronic
1076249952 10:128977764-128977786 AGGCATGGAGATGGGGCAGCTGG + Intergenic
1076621661 10:131792870-131792892 AGACTGTGATAAGGGGCAGCTGG + Intergenic
1077074535 11:694430-694452 AGGCAGGTATTTGTGGCAGGTGG + Intronic
1077148103 11:1054813-1054835 AGGCAGGGAACAGGTGCAGGGGG + Intergenic
1077333105 11:1991992-1992014 AGGCAGGGATTAGGGGCAGCTGG - Intergenic
1077536980 11:3129175-3129197 AGGAAGGAAGGAGGGGCAGCAGG + Intronic
1077881684 11:6355290-6355312 AAACAGGCCTTAGGGGCAGCTGG - Intergenic
1078573482 11:12479176-12479198 AGGCAGGCCTTAGAGGCAGAAGG - Intronic
1079043161 11:17077549-17077571 AGACAGGGAGTGTGGGCAGCGGG - Intronic
1081276350 11:41153948-41153970 AGGCAGAGATTAGGGGGATGTGG + Intronic
1082779278 11:57273835-57273857 AGGCAGGGAGTAGGGAGGGCAGG + Intergenic
1082890447 11:58133327-58133349 ATGCAGAGATTAGCTGCAGCAGG + Intronic
1083225355 11:61281283-61281305 AGGCAGGGTTTAGGGAGACCTGG + Intronic
1083324002 11:61864149-61864171 AAGCAAGGACAAGGGGCAGCAGG - Intronic
1083426820 11:62592308-62592330 AGGGAGGGACTACGGGGAGCTGG + Intergenic
1083792861 11:64997057-64997079 AGCCAGGGATTCTGAGCAGCTGG - Intergenic
1083832539 11:65241946-65241968 AGGCAGTGGTGAGGGGCAGGTGG - Intergenic
1083913055 11:65721034-65721056 AGGCAGGGAGGAGGGGGAGGGGG - Intergenic
1084042273 11:66549087-66549109 AGGCAGGCCGGAGGGGCAGCAGG - Intronic
1084085483 11:66853113-66853135 GGGCAGGGGTGAGGGGCAGGGGG + Intronic
1084189442 11:67492311-67492333 AGGCAGCGATGAGGGGGTGCTGG + Intronic
1084307982 11:68299091-68299113 AGTCTGGGACCAGGGGCAGCTGG - Intergenic
1084409788 11:69000134-69000156 AGGCAGGGATGGGGGACAGGGGG - Intergenic
1084958910 11:72705973-72705995 AGGCAGGGATGAGAGGCCACAGG + Intronic
1086429395 11:86720781-86720803 GGGCAGGGATGAGGGGGAGGAGG - Intergenic
1088707374 11:112475933-112475955 AGGCATCGATTAGAAGCAGCAGG - Intergenic
1088792510 11:113238478-113238500 AGGATGGGTCTAGGGGCAGCAGG - Intronic
1089491283 11:118885735-118885757 GGGCAGGGGGCAGGGGCAGCAGG + Intronic
1089529452 11:119116854-119116876 AGGGAGGGATGAGGAGCAGGAGG - Exonic
1089757708 11:120698650-120698672 AGCCAGGGGGAAGGGGCAGCAGG - Intronic
1090139382 11:124238489-124238511 AGGCAAGGAAGAGGGGCAGCTGG - Intergenic
1091194257 11:133718225-133718247 AGGCAGAACTGAGGGGCAGCTGG - Intergenic
1202816087 11_KI270721v1_random:47170-47192 AGGCAGGGATTAGGGGCAGCTGG - Intergenic
1091387352 12:103559-103581 AGGCAGGGCTCAGGGGGAGGTGG + Intronic
1091387394 12:103672-103694 AGGCAGGGCTCAGGGGTAGGTGG + Intronic
1091402878 12:191225-191247 AGGCAGGGATTTGGAGCTGATGG + Intronic
1091544456 12:1492080-1492102 CAGCAGGGAGTAGGGGGAGCTGG - Exonic
1091638801 12:2218448-2218470 AGGCAGTGCATAGGGGCAGAGGG + Intronic
1091698461 12:2643776-2643798 TGGCAGGGGTCAGGGGCTGCTGG - Intronic
1091769660 12:3142661-3142683 GGGCAGGGATGCGGGGCACCAGG - Intronic
1092481222 12:8860842-8860864 AGGCAGTGAGTCAGGGCAGCAGG - Intronic
1092762058 12:11819222-11819244 AGCCAGGGCAGAGGGGCAGCAGG - Intronic
1096041833 12:48523968-48523990 AGGTAGGGATTACCAGCAGCAGG + Intronic
1096072382 12:48782534-48782556 AGGTAGGGATGGAGGGCAGCAGG - Intronic
1096440200 12:51635937-51635959 AGGCAGTGATTAGGAGAAGTTGG - Intronic
1097262732 12:57728626-57728648 CGGCAGAGAGCAGGGGCAGCAGG + Intronic
1098469972 12:70832267-70832289 GGGCAGAGCTTTGGGGCAGCAGG - Intronic
1100370671 12:93966593-93966615 ATGGAGGGATAAGGGGCAGATGG - Intergenic
1100735896 12:97530488-97530510 AGGCAGGGATAAAGGGAAACTGG + Intergenic
1101080609 12:101179625-101179647 AAGGAGGGAGTAGGGGCAGAAGG + Intronic
1101880935 12:108625183-108625205 GGGCAGGGAGAGGGGGCAGCAGG - Intronic
1102436815 12:112930536-112930558 AGGCAGGGACTTGGGGCATGAGG - Intronic
1104759089 12:131286439-131286461 AGGCTGGGATTCGGGGAAGGGGG + Intergenic
1105296232 13:19089908-19089930 AGGCAGGGATTAGGTGGCACTGG - Intergenic
1105443985 13:20436864-20436886 AAGCAGGGACTGGGGGCTGCAGG + Intronic
1105628430 13:22136859-22136881 AGGCAAGGACTGGGGGCAGAAGG + Intergenic
1106223773 13:27770040-27770062 AGGCAGGGAGAAAGGGCATCTGG - Intergenic
1108168930 13:47721504-47721526 AGACTGGGTTTAGGGTCAGCTGG - Intergenic
1111889075 13:94059397-94059419 AGACAAGGATGAGGGGCTGCAGG - Intronic
1113014936 13:105818080-105818102 AGGTATGGATTAGGTCCAGCAGG + Intergenic
1113461438 13:110485048-110485070 CGGCAGGGACTAGGGGCCCCTGG - Intronic
1113785461 13:113000028-113000050 AGGCAGGGCTGAGGTGCAGGTGG + Intronic
1113800271 13:113082843-113082865 AGGAGGGGATGAGGGGCAGGCGG - Intronic
1113811102 13:113143177-113143199 AGGCAGGGGTGTGGGGGAGCAGG - Intronic
1113885590 13:113656962-113656984 AGGCAGGGACCGGGGGCAGAAGG - Intronic
1115308599 14:31957269-31957291 AGACAGGGAGTGGGGGCAGTGGG - Intergenic
1115877424 14:37876215-37876237 GGGCAGGGTTTAGTGGCACCTGG + Intronic
1116167448 14:41351309-41351331 AGGCAAAGAGTAGGGGCAGGAGG - Intergenic
1116353125 14:43891747-43891769 AGTTAGGGATGAGGAGCAGCAGG + Intergenic
1116491739 14:45511642-45511664 AGCCAGAGATTAGGGGTAGAAGG - Intergenic
1117283498 14:54263925-54263947 AGCCAGTGAGGAGGGGCAGCAGG + Intergenic
1119719508 14:76881786-76881808 AGGCAGGGGTCATGGGCAGCTGG - Intergenic
1120995973 14:90419102-90419124 AGGGAGGGAGCTGGGGCAGCAGG + Intergenic
1121109544 14:91303257-91303279 AGGCAGGGCTTTGGGGAAGTGGG - Intronic
1121548084 14:94777425-94777447 AGGAAGGGGTTAAGGGCAGTGGG - Intergenic
1122075821 14:99233875-99233897 AGGCAGGGGAGGGGGGCAGCCGG + Intronic
1122627714 14:103092682-103092704 AGGCAGAGATGAGGGGTAACAGG - Intergenic
1122716768 14:103700789-103700811 ATGCAGGGACTGGGGGGAGCTGG + Intronic
1122929838 14:104928171-104928193 AGGGAAGGATGAGGGGCGGCAGG - Intronic
1202921530 14_KI270723v1_random:33433-33455 AGGCAGGGACTGGGGGCGGGTGG + Intergenic
1124071608 15:26398682-26398704 TGGCAAGGATAAGGGGCAGCAGG - Intergenic
1124657827 15:31523281-31523303 AGGCAGGGAGGAGGGGCAGGAGG + Intronic
1125577997 15:40768083-40768105 AGGGAGGGGTCAGGGACAGCAGG + Intronic
1125605534 15:40937911-40937933 AGGCAGGGGCTAAGGGCAGGTGG - Intronic
1126196589 15:45938251-45938273 AGGCAGGGGTCAGCGGCTGCAGG + Intergenic
1127360302 15:58239197-58239219 AGGGAGGGATTAGGGGAAATGGG + Intronic
1128824224 15:70696215-70696237 AGGCAGGGATTGGGGGAACTAGG - Intronic
1129388677 15:75209712-75209734 AGGGTGGAATTGGGGGCAGCAGG - Intronic
1129657947 15:77537147-77537169 GGGCAGGGAGTATGGGCAGCTGG - Intergenic
1130355347 15:83124932-83124954 AGGCTGGGGTTGGGAGCAGCAGG - Intronic
1131080341 15:89529278-89529300 ATGGAGGGAGTAGGGGCGGCGGG - Intergenic
1131529382 15:93179027-93179049 AGGGAGGGAGTATGTGCAGCGGG + Intergenic
1131592255 15:93762440-93762462 AGCCAGAGATTAGGGGCTGATGG - Intergenic
1132573319 16:653484-653506 AGGGAGGGTGTAGGGGCTGCAGG - Intronic
1132604904 16:789590-789612 AGGACGGGATTGCGGGCAGCTGG - Exonic
1132606948 16:797534-797556 AGTGAGGGGTGAGGGGCAGCTGG + Intronic
1132671949 16:1105694-1105716 AGGCAGGGGGTATGGGCTGCTGG + Intergenic
1133740412 16:8647011-8647033 AGGCAGGGGAAAGGGGCTGCAGG - Exonic
1134448769 16:14350467-14350489 AGGCAGTGAGTAGGAGCAGCAGG - Intergenic
1134490139 16:14690291-14690313 AGGCCAGGGTAAGGGGCAGCTGG + Intronic
1134495520 16:14729408-14729430 AGGCCAGGGTAAGGGGCAGCTGG + Intronic
1135419734 16:22297676-22297698 GGGCGGGGAGGAGGGGCAGCCGG + Intronic
1135579848 16:23616103-23616125 TGGCAGGGAGTTGGGGGAGCAGG - Intronic
1136114708 16:28087393-28087415 AGGCAGGGGGTGGGCGCAGCAGG + Intergenic
1136155438 16:28379112-28379134 AGGCAGGGAGAAGGGAGAGCTGG - Intergenic
1136207646 16:28736177-28736199 AGGCAGGGAGAAGGGAGAGCTGG + Intergenic
1136407177 16:30054834-30054856 TGGCAGGGATGGGGAGCAGCAGG - Exonic
1137757439 16:50913891-50913913 AGGCAGGGCTTATGAGCACCAGG - Intergenic
1138458022 16:57132470-57132492 AGGCAGGTGGTAGAGGCAGCGGG - Intronic
1139818630 16:69700130-69700152 AGGCAGGGAGGAGGGGGAGATGG - Intronic
1141033199 16:80607257-80607279 AGTCAGGGATGAGGCCCAGCAGG + Intronic
1141280564 16:82627136-82627158 AGGTAGGGAAGAGGGGCTGCCGG + Exonic
1141625012 16:85256629-85256651 AGGCAGGGATGGGGAGGAGCTGG - Intergenic
1141656942 16:85421587-85421609 AGGCAGGTTTTCGGGGCTGCTGG + Intergenic
1142472145 17:170476-170498 AGGCTGGGAGGAGGGGCAGGGGG + Intronic
1142865916 17:2791388-2791410 AGCCAGGCATTGGGGGTAGCTGG + Intronic
1143473968 17:7192580-7192602 AGGCAGGGGAGAGGGCCAGCGGG + Intronic
1143509477 17:7387516-7387538 AGGCATGGATTTAGGGCAGGGGG - Intronic
1143832235 17:9661770-9661792 AGGCTGGAGTGAGGGGCAGCAGG - Intronic
1144658066 17:17050761-17050783 AGGCAGAGTTTAGGGGCAGAAGG + Intronic
1145286201 17:21507555-21507577 AGGCAGGGAGTTGGGGCCGAGGG - Intergenic
1145391407 17:22458761-22458783 AGGCAGGGAGTTGGGGCCGAGGG + Intergenic
1147157117 17:38549594-38549616 AGGCAAGGGTGAGGGGCAGTGGG - Intronic
1147317228 17:39626851-39626873 AGGGAGGGTTTAGGGGAAACTGG - Intronic
1148861104 17:50604716-50604738 AGGCAGGAAGTGGGGGCTGCTGG + Intronic
1149582902 17:57763534-57763556 AGGCAGGGAAATGGGGCAGGAGG + Intergenic
1149630612 17:58119035-58119057 AGGCAAGGATCAGGGGAAGAGGG - Intergenic
1151699588 17:75736239-75736261 AGGCAGGGATGGGGCACAGCTGG + Intronic
1152098381 17:78286446-78286468 AGGCAGGGGTGGGGGGCAGGAGG - Intergenic
1152461914 17:80446065-80446087 AGGCAGGGACTGGGGAAAGCTGG - Intergenic
1152596905 17:81242219-81242241 AGGCAGGGGTGGGGGGCAGCCGG - Intergenic
1153618501 18:6954912-6954934 AGGCAGGTATGAGGGCCAGAAGG + Intronic
1153631020 18:7069786-7069808 AGGAGGGGGTTTGGGGCAGCTGG - Intronic
1154294624 18:13137518-13137540 AGCCAAGGTATAGGGGCAGCGGG - Intergenic
1155820716 18:30371682-30371704 AGACAGAAATTAGGGGAAGCTGG - Intergenic
1156297845 18:35808936-35808958 AGGCAGGGATTAGCCACAGAAGG + Intergenic
1157584212 18:48790929-48790951 GAGCAGGGATTGGGGGAAGCTGG - Intronic
1159082607 18:63752640-63752662 AGTCAGGAATCAGGGCCAGCAGG - Intergenic
1159876504 18:73817185-73817207 TGGCAAGGATATGGGGCAGCAGG - Intergenic
1160225580 18:77008653-77008675 AGCCAGGGCTTGGGGGCAGAAGG - Intronic
1160719937 19:592586-592608 AGGCAGGGAATGGGGTTAGCGGG + Intronic
1160857968 19:1225929-1225951 TAGCAGGGACTGGGGGCAGCTGG + Intronic
1161460076 19:4391339-4391361 AGGCTGTTATTAGGGGCACCTGG + Intronic
1161469077 19:4447498-4447520 AGGCTGGGGGTGGGGGCAGCTGG - Intronic
1161714621 19:5868242-5868264 AGGCAGGGAGTGGGGGGATCTGG + Intronic
1162340929 19:10091370-10091392 GGGCAGGGCTGAGGGGGAGCTGG - Intronic
1162921600 19:13906398-13906420 AGGCCGGGCTTGGGGGCAGGTGG + Exonic
1163255376 19:16152991-16153013 GGGCAGGGATGAGGGGGAGTAGG + Intronic
1163672118 19:18635753-18635775 GGGCAGGGATTTGGGGGAGTGGG + Intergenic
1164542610 19:29132097-29132119 AGGGAGGGAGTAGGGACAGTGGG + Intergenic
1165073811 19:33269872-33269894 AGCCTGGGGCTAGGGGCAGCTGG - Intergenic
1165460120 19:35939452-35939474 AGGCAGGGGCCAGCGGCAGCAGG - Exonic
1165472165 19:36009957-36009979 AGGCAGAGGTTAGAGGCAGTGGG + Intronic
1166104064 19:40589046-40589068 GGGCAGGGGTCAGGGCCAGCTGG - Intronic
1166328930 19:42067698-42067720 AGACAGGGTTGAGGGGCAGCAGG + Intronic
1166331731 19:42081626-42081648 TGGCAGGTATTAGGGGTAGTAGG + Intergenic
1166382483 19:42362228-42362250 AGGCAGGGATGAGAAGCAGCAGG + Intronic
1166742528 19:45123051-45123073 AGGCTGGGATCAGCTGCAGCGGG - Intronic
1167605851 19:50480992-50481014 AGGAAGGGAATAGGGGAGGCGGG - Intronic
1167633016 19:50637545-50637567 GGACAGAGATTAGGGGCAGATGG + Exonic
1167793437 19:51694251-51694273 AGGCAGAGACTAGGGGAAGCAGG + Intergenic
925365382 2:3307703-3307725 AGGCAGGGATGAAGAGAAGCTGG + Intronic
925417057 2:3677725-3677747 AGGAAGGGACTAGGGGTAGCAGG - Intronic
927674935 2:25098319-25098341 GGTCAGGGATTAGGGTCAGCAGG - Intronic
928088943 2:28362342-28362364 AGGCAGGGAATAAAAGCAGCTGG - Intergenic
929195137 2:39177317-39177339 AGACAGTGATTAGGGGGACCAGG + Intronic
929388127 2:41435696-41435718 AGGCAGGGAGAAGAGGCAGGTGG + Intergenic
929858358 2:45654166-45654188 GAGCAGGGATGAGGAGCAGCAGG + Intronic
929889066 2:45904780-45904802 AGGCAGGCTTCTGGGGCAGCGGG - Intronic
931214509 2:60228547-60228569 AGGCAGGAAATAGGCACAGCAGG - Intergenic
932610039 2:73192011-73192033 AGGCAGGGGGTAGGGGGAGGTGG + Intergenic
933505493 2:83171958-83171980 CTGCAGAGATTAAGGGCAGCAGG + Intergenic
933682750 2:85117435-85117457 AGGTAAGAATGAGGGGCAGCTGG + Intergenic
933730465 2:85452378-85452400 TGGCTAGGATTAGTGGCAGCAGG - Intergenic
934554701 2:95281205-95281227 AGGCAGGACTGAGGGACAGCAGG - Intronic
934975658 2:98800328-98800350 AGGCTGGGGTTGGGGGCAGGTGG + Intronic
935165249 2:100563862-100563884 AGGGAGGCATTAGGGGCTGGAGG + Intronic
936261071 2:110959902-110959924 AGGCAGGGGTTGGGGACAGGTGG + Intronic
936371538 2:111905885-111905907 AGGCAGGGAGAAGGGGCAGAAGG + Intronic
937015964 2:118605724-118605746 AGGTTGGCATTAGGGGAAGCTGG + Intergenic
937198548 2:120181405-120181427 AGGCAGGCCTCTGGGGCAGCTGG + Intergenic
937511268 2:122598154-122598176 AGGTGGGGCCTAGGGGCAGCAGG - Intergenic
938628531 2:133138878-133138900 ATGCAGGGGGTAGGAGCAGCAGG - Intronic
940530598 2:154872376-154872398 AAGGAGGGATTAGAAGCAGCTGG - Intergenic
940774879 2:157875701-157875723 AGGCAGGGATCGGGGGTGGCAGG - Intronic
941721345 2:168816412-168816434 AGGCAGGGATCATGGGGAGACGG - Intronic
942457294 2:176147200-176147222 AAGCAGGGGTGAGGGGCAGATGG + Intergenic
943823104 2:192352684-192352706 AGACTGGGGTTAGGGACAGCAGG - Intergenic
944056881 2:195531545-195531567 TGGCAAGGATTAGGGGTTGCAGG - Intergenic
945975704 2:216268905-216268927 AGGCAGAGGATGGGGGCAGCAGG - Intronic
946248076 2:218398500-218398522 AGGCTGGGAGTAGGGGCGGGAGG - Intronic
946865031 2:224035069-224035091 AGACTTGGATTTGGGGCAGCAGG + Intronic
947022962 2:225703828-225703850 AAGCAGTGATTAAGGGCAACTGG - Intergenic
947105090 2:226660905-226660927 TGACAGGGATTAGGGGCATGTGG - Intergenic
947489666 2:230582676-230582698 TGCCAGGGATTAGGGGCAGAGGG + Intergenic
947586827 2:231361703-231361725 AGGAAGTGGTGAGGGGCAGCTGG - Intronic
947956501 2:234196618-234196640 GGGAAGGGATTAGGGGCAGTAGG + Intergenic
948074887 2:235158325-235158347 TGGCAGGGATGAGGAGCAGCAGG - Intergenic
948206050 2:236163486-236163508 TGGCAGGGATGAGGGGCAGAGGG - Intergenic
948479246 2:238239925-238239947 CGGCAGGGGCTAGGAGCAGCGGG + Exonic
1168898003 20:1337152-1337174 AGGCAGGAACAATGGGCAGCCGG + Intronic
1169914809 20:10674147-10674169 TGGAAGGGGTTGGGGGCAGCGGG + Intergenic
1170591369 20:17774353-17774375 AGGGAAGGTTTAGGGGCAGTGGG - Intergenic
1170665252 20:18381099-18381121 AGGCAGAGATCGGGGGGAGCTGG - Intergenic
1170953359 20:20956280-20956302 AGGAAGGGAAGGGGGGCAGCAGG + Intergenic
1171459501 20:25290920-25290942 AGGCACGGCTGAGGGGCAGGAGG - Intronic
1171956356 20:31466789-31466811 AGGCAAGGCTTTGGGGCAACAGG + Intronic
1172354352 20:34269192-34269214 AGGCAGGGCTTCGGGGACGCGGG + Intronic
1173741576 20:45406054-45406076 AGCCAGGAATCAGGGGCAGCCGG + Intronic
1173868602 20:46328496-46328518 AGGCTGGGAGTAGGAGCGGCTGG - Intergenic
1174379202 20:50146013-50146035 AGGGAGGGACCAGGGGCAGCAGG - Intronic
1175199846 20:57269255-57269277 AGGCTGGGGGCAGGGGCAGCAGG + Intergenic
1175516813 20:59575424-59575446 AGGGAGGTATCAGGGGCTGCTGG - Intergenic
1175986787 20:62768059-62768081 ACACAGGGAACAGGGGCAGCAGG - Intergenic
1176131417 20:63498327-63498349 GGGCAGGGATGAGGGGAAGATGG - Intronic
1176379746 21:6106310-6106332 AGGCAGGGACTTGGGGCTGTTGG - Intergenic
1177049696 21:16217563-16217585 AGGAAGGGATTAGTGGAAGATGG - Intergenic
1177800351 21:25822717-25822739 ATTTAGGGATTAGGAGCAGCTGG + Intergenic
1178255077 21:31044846-31044868 AGTCAGTGATTAAGGGCTGCTGG - Intergenic
1178505902 21:33162825-33162847 GGGCTGGGAGTGGGGGCAGCAGG - Intergenic
1178537130 21:33419844-33419866 TGGCAGGGGTTTGGGGGAGCAGG + Intronic
1179053956 21:37914773-37914795 AGGCAGGGAACAGGGCTAGCAGG + Intronic
1179154775 21:38840313-38840335 AAGCAGGGATCAGGGGAGGCAGG - Intergenic
1179239972 21:39581373-39581395 AGGCAGGACATAGAGGCAGCAGG - Intronic
1179585162 21:42370110-42370132 AGGCACAGGTCAGGGGCAGCGGG - Intergenic
1179743728 21:43431927-43431949 AGGCAGGGACTTGGGGCTGTTGG + Intergenic
1180118188 21:45725865-45725887 AGGAAGGGGTGGGGGGCAGCTGG + Intronic
1180158480 21:45988890-45988912 AGGCAGGGAGTGGGGGGAGCTGG + Intronic
1181041433 22:20194434-20194456 AGGCAGGGCAGAGGGGCGGCTGG - Intergenic
1181049823 22:20233207-20233229 AGGGAGGGACTGGGGTCAGCTGG + Intergenic
1181966740 22:26661566-26661588 AGGCAGGGATTAGGCATTGCAGG + Intergenic
1182621062 22:31618851-31618873 AGGCAGGTAGTAGGCCCAGCTGG - Exonic
1183324777 22:37185255-37185277 AGGCAGGGCGTGGGGGCGGCCGG + Exonic
1183627660 22:39014504-39014526 TGGCTGGGAGTGGGGGCAGCGGG - Intronic
1184222489 22:43110051-43110073 TGGGAGGGATTGGGGGCAGGGGG - Intergenic
1184286051 22:43472067-43472089 AGGTGGGGATTGGGGCCAGCTGG + Intronic
1184427576 22:44422075-44422097 AGACAGGCATTAGGGGTGGCTGG - Intergenic
1184840141 22:47047822-47047844 AGGCAAGGAGTAGAGGCAGACGG - Intronic
1185245249 22:49769854-49769876 TGGCAGGAACCAGGGGCAGCAGG - Intergenic
949300869 3:2582465-2582487 TGGCTGGGATTGGGGGCGGCGGG + Intronic
949840609 3:8315883-8315905 ATGCAGAGATTAGCTGCAGCAGG - Intergenic
950451091 3:13066351-13066373 AGGCAGGACTTCCGGGCAGCTGG + Intronic
950680964 3:14584824-14584846 AGGCAGGGTCTATGGGCTGCGGG - Intergenic
950902117 3:16507024-16507046 AGGTAGGAAATAAGGGCAGCAGG - Intronic
950958365 3:17079242-17079264 AGGCAGGGACCAGGGCCAGAGGG - Intronic
952821372 3:37488986-37489008 TGCCAGGGACTAGGGGAAGCAGG - Intronic
953385884 3:42505436-42505458 AGGCAGGTGGCAGGGGCAGCAGG - Intronic
953429817 3:42829878-42829900 AAGAAGAGTTTAGGGGCAGCAGG + Intronic
954444544 3:50539706-50539728 GGGCAGGGATTAGGGGCTCAAGG + Intergenic
954445281 3:50542999-50543021 AGGCAGGGAGAAGGTGGAGCTGG + Intergenic
954609047 3:51934594-51934616 AGGCAGGGAGGAGGGGTCGCCGG - Intronic
954793505 3:53149497-53149519 AGGCATGGCGTGGGGGCAGCAGG - Intergenic
955216131 3:56986305-56986327 AGGCAGAGATTAGGGACAACAGG - Intronic
956525580 3:70156067-70156089 AGGCAGGGATTCAGGGCAGAGGG - Intergenic
959042018 3:101432453-101432475 AGCCAGGGAGTAGTGACAGCAGG + Intronic
961028907 3:123585097-123585119 AGGAAGGGACGAGGGGCAGGCGG + Exonic
961057763 3:123803637-123803659 AGGCAGGGATGAGCTGCTGCAGG + Intronic
962693617 3:137926302-137926324 AGGAAGGGATTCTGGGCAGAGGG - Intergenic
963222467 3:142826976-142826998 AGGCAGAGATTGAGGGCAGGAGG - Intronic
966095755 3:176200797-176200819 AGACAGCAATGAGGGGCAGCAGG + Intergenic
966095808 3:176201612-176201634 AGACAGCAATGAGGGGCAGCAGG - Intergenic
968579991 4:1385386-1385408 AGGCAGGCATTCCGGGGAGCAGG - Intronic
968862607 4:3184643-3184665 GGGCAGACATTGGGGGCAGCAGG + Intronic
969202596 4:5617793-5617815 AGGCAGGGATTAGGTGCAGGTGG + Intronic
970234229 4:13942290-13942312 AGAATGGGATTAGGGGCAGCAGG + Intergenic
972581988 4:40403222-40403244 AGGCAGGGGTGCTGGGCAGCAGG - Intergenic
975699069 4:77044508-77044530 AGCCAGGGTTAAGGGGCAGATGG - Intergenic
978879527 4:113684942-113684964 AGGGAGAGATGAGGAGCAGCAGG - Intronic
980616197 4:135229006-135229028 AGGGAGGGAGTAGGGGAAGAAGG - Intergenic
985664617 5:1175523-1175545 AGGCTGGGATTGAGGGCACCTGG + Intergenic
985851443 5:2391691-2391713 AGGCAGGACTTGGGGCCAGCTGG - Intergenic
986220752 5:5766806-5766828 CGACAGGCATTAGTGGCAGCAGG + Intergenic
986760442 5:10875378-10875400 GGTCAGGGAGTGGGGGCAGCGGG + Intergenic
987037194 5:14030580-14030602 AGGAAGGGATTTGGGGCTGAAGG - Intergenic
987283546 5:16435285-16435307 AGGCAGGGCTTAGGGTCTCCTGG - Intergenic
988925977 5:35991404-35991426 ACCCAGGGAGGAGGGGCAGCGGG - Exonic
990592993 5:57284210-57284232 AGGCAGGGAGTGGTTGCAGCAGG + Intergenic
992365528 5:76085033-76085055 ATGAAGGGATTAGGTTCAGCGGG - Intronic
992647574 5:78826532-78826554 AGGCAGGTACTGGGGGCAGGGGG + Intronic
992786455 5:80174763-80174785 AGCAAGGGAGTAGGGGCAGGGGG + Intronic
994688146 5:102982435-102982457 AGGCAGGTATCAGTGGTAGCAGG - Intronic
994744945 5:103666555-103666577 AGAAAGGGAGTGGGGGCAGCTGG - Intergenic
997205898 5:132050032-132050054 ATGCAGGGAGTGGGGGCTGCAGG - Intergenic
997803468 5:136889793-136889815 AGGCAAGGATTTGGGGAACCAGG + Intergenic
997869027 5:137490526-137490548 AGGCAGGCTTTATGGGCACCAGG - Intronic
998132851 5:139659908-139659930 AGGCAGGGAGGAGGCGCAGCAGG + Intronic
998469758 5:142374580-142374602 AGGAAGGGAGAAGGGGCAGAAGG + Intergenic
999172393 5:149606490-149606512 TGGCAGGCAGTAGGGTCAGCTGG + Intronic
1000037350 5:157459724-157459746 AGGCAGGGAGGAAGGGCAGGAGG + Intronic
1000228277 5:159290893-159290915 AGGGAGGGGTTCGGGGCATCAGG - Intergenic
1001328988 5:170749074-170749096 AGGGAGGGAGGAGAGGCAGCTGG - Intergenic
1001462888 5:171933906-171933928 AGGCAGGGAGTAAGGGAAGGAGG + Intronic
1002195191 5:177497400-177497422 AGGCAGGGGCCAGGGCCAGCGGG + Intronic
1002374674 5:178780140-178780162 AGGTGGGGCTTAGGTGCAGCAGG + Intergenic
1003139724 6:3460323-3460345 AGGCAGGGATGAGGGCAAGCTGG - Intergenic
1003154869 6:3583915-3583937 AGGCTGGGATGAAGGGCAGTGGG - Intergenic
1003254599 6:4463858-4463880 AGGAAGGGATGGAGGGCAGCTGG + Intergenic
1004510402 6:16279722-16279744 GGGCAGGCGTGAGGGGCAGCAGG + Intronic
1006173793 6:32109852-32109874 GGGCAGGGAGCAGGGGCAGAGGG + Intronic
1006288661 6:33117266-33117288 GCCCAGGGAGTAGGGGCAGCCGG + Intergenic
1006367136 6:33622241-33622263 AGGCGGGGAGAAGGGGCAGCTGG - Intronic
1006565913 6:34956979-34957001 GCTCAGGGATTAGGGGCACCAGG - Intronic
1006736038 6:36273311-36273333 AGTGGGGGATTAGGGGCAGCCGG - Intronic
1007175240 6:39891787-39891809 AGCCAGTGAATAGGGGCAGAGGG + Intronic
1007410080 6:41656513-41656535 CGGCAGGGATCAGGGCCACCTGG - Intergenic
1007627533 6:43254877-43254899 GGGCAGGGAGCAGGGTCAGCAGG + Intronic
1007724274 6:43905448-43905470 AGCCAGGGGCTAGGGGCAGAGGG - Intergenic
1007765601 6:44158047-44158069 AGGCAGGGCTGAGGGGCACTGGG + Intergenic
1008488824 6:52064266-52064288 AGTCAGGGATGAAGGGCAGTTGG - Intronic
1008806426 6:55434602-55434624 AGTCAGGGATGAGGAGCAGGAGG - Exonic
1010781221 6:79947621-79947643 AGGGAGGGAGGAGGGGCGGCCGG - Intergenic
1011334957 6:86250191-86250213 AGGAAGGCATCAGGGGCAGGTGG - Intergenic
1012402537 6:98854810-98854832 TGGCTGGGATTAGGGTTAGCTGG - Intergenic
1013845476 6:114445427-114445449 AGGCAGTGATTGAGCGCAGCAGG - Intergenic
1014050589 6:116948688-116948710 AAGCAGGGCATAAGGGCAGCTGG - Intergenic
1014126719 6:117784504-117784526 AGGAAGGTATAAGGGGCAGAAGG - Intergenic
1014921942 6:127223779-127223801 AGGAAGGAAATAGGGTCAGCAGG - Intergenic
1018727025 6:166620888-166620910 TGGCTGGGAGAAGGGGCAGCCGG + Intronic
1018857242 6:167683508-167683530 AGTCAGGGCTGAGGGCCAGCGGG - Intergenic
1019376846 7:697322-697344 ACGCAGGGATTACAGGCAGATGG + Intronic
1019420451 7:948268-948290 AGGGAGGGGTGAGGGGCAGAGGG - Intronic
1019627740 7:2029387-2029409 AGGCAGGGCTTTGGGGGAGGTGG + Intronic
1019666040 7:2252756-2252778 GGGCAGGGGTGAGGGGGAGCAGG - Exonic
1020345656 7:7160330-7160352 TGGCAGGGATTAGGGGTTGGAGG - Intronic
1022003020 7:26244045-26244067 ATGCTGGGATTATAGGCAGCCGG + Intergenic
1022372155 7:29782235-29782257 AGGCAGGACATAGGGACAGCTGG + Intergenic
1022785580 7:33634148-33634170 AGGCAGGGACTTGGGAGAGCAGG - Intergenic
1023907583 7:44533417-44533439 AGGCAGGAGGTAGGGGCAGCTGG - Exonic
1023957083 7:44895103-44895125 GGCCAGGGGTCAGGGGCAGCTGG - Intergenic
1024548878 7:50543953-50543975 CGGCAGGGATCAGCGGCCGCAGG + Exonic
1026965021 7:74434036-74434058 AGGCTGGGATCCCGGGCAGCAGG + Intergenic
1026970574 7:74465142-74465164 AGGCAGGGCTTTGGGGAAGGAGG + Intronic
1027038811 7:74946122-74946144 AGGCTGGGAGAAGTGGCAGCTGG - Intergenic
1028084936 7:86624931-86624953 AGGCAGTCATTAGGGTCAGTGGG + Intergenic
1028296182 7:89134614-89134636 AGGCAGGAAATTGGGGAAGCAGG - Intronic
1028339548 7:89701648-89701670 AGGCTGGGATCAGGGGAAGATGG + Intergenic
1029391754 7:100279898-100279920 AGGCTGGGAATAGTGGCAGATGG - Intergenic
1029679189 7:102096261-102096283 AGTCAGGGGTTAGCGGCCGCAGG - Intronic
1030675747 7:112383949-112383971 AGGCTGTGATTTGGAGCAGCAGG - Intergenic
1032782851 7:135178000-135178022 AGGGAGTTTTTAGGGGCAGCAGG + Intergenic
1032783302 7:135181832-135181854 AGGCAGGAATTACGTGAAGCAGG - Intergenic
1034160124 7:148987743-148987765 AGGCAGGGATCTTGGGCAGTGGG - Intergenic
1034251015 7:149690880-149690902 AGGCAGGAAGTCGGGGGAGCAGG - Intergenic
1034407842 7:150917096-150917118 AGGAAGGGAGGAGGGGAAGCAGG - Intergenic
1034815508 7:154169021-154169043 AGGCTGGCCTTAGGGACAGCGGG + Intronic
1035317521 7:158006105-158006127 AGGCAGGAGGAAGGGGCAGCAGG - Intronic
1035679764 8:1479267-1479289 AGGCGGGGATTGGGGGCGGTGGG + Intergenic
1036213796 8:6863248-6863270 TGGCAGGGAGTAGGGGAAGCTGG + Intergenic
1036221178 8:6922817-6922839 GGCCAGGGATTGGGGGCTGCAGG - Intergenic
1036290243 8:7481528-7481550 AGGCAGTGATTTGGGGAAGAGGG + Intergenic
1036331234 8:7829992-7830014 AGGCAGTGATTTGGGGAAGAGGG - Intergenic
1036442046 8:8789946-8789968 AGGGAGGGACTGGGGGCAGGAGG - Intronic
1037982101 8:23261648-23261670 AGGCAGGGAGTGGGGACTGCAGG - Exonic
1040067999 8:43164180-43164202 AGGCAGGAATGAGGGACAGTGGG + Intronic
1041142976 8:54842792-54842814 AGGCTGGAGTTGGGGGCAGCAGG - Intergenic
1041349125 8:56930996-56931018 AGGCAGGAATTAGGAGCTTCTGG - Intergenic
1041473342 8:58235363-58235385 AGGCAGGAATTATGTGAAGCGGG - Intergenic
1042144318 8:65712303-65712325 AGGCAGGGGTTGGGGGGATCTGG - Intronic
1043171081 8:76967480-76967502 AGTCAGAGATTAGAGGCAGCTGG - Intergenic
1045322969 8:101095747-101095769 AGGCAGGTCTCAGGAGCAGCAGG - Intergenic
1045510766 8:102810612-102810634 AGGCCGGGCTTCGGGGCACCTGG - Intergenic
1045928436 8:107597591-107597613 AGGCAGGAAATATGTGCAGCAGG + Intergenic
1046057411 8:109095528-109095550 AGGCGGGAATTAGGTGTAGCAGG - Intronic
1047037629 8:120956740-120956762 AGGCAGGGATGTGGGGGAGATGG + Intergenic
1048214785 8:132484135-132484157 AGGCATGGAGGAGGGGAAGCAGG - Intergenic
1048787502 8:138065968-138065990 AGGTGGGGATGAGGGGCAGGTGG - Intergenic
1049034322 8:140062478-140062500 AGGCAGGGAGAAGCAGCAGCTGG - Intronic
1049174706 8:141184758-141184780 AGGCAGGGAGGGAGGGCAGCTGG - Intronic
1049195440 8:141313198-141313220 GGGCAGGGGTTGAGGGCAGCTGG - Intergenic
1049243016 8:141548327-141548349 AGGCAGGATTTAGGGGCTCCAGG + Intergenic
1049374822 8:142284363-142284385 AGGCAGGCCCTCGGGGCAGCAGG + Intronic
1049652043 8:143774512-143774534 GGGCAGGGATGTGGGGAAGCTGG + Intergenic
1050480153 9:6080331-6080353 GGGGCGGGATTGGGGGCAGCTGG - Intergenic
1050725404 9:8643550-8643572 ACGCAGGGCATAGGGGAAGCGGG + Intronic
1052807539 9:33025743-33025765 AGGCAGGGGCGAGGGGCTGCGGG + Intronic
1055726024 9:79230010-79230032 ACTCAGGGATTAGAGGCACCAGG + Intergenic
1056617430 9:88180504-88180526 AGCCAGGGGTTCGGGGCAGCAGG - Intergenic
1057263522 9:93599280-93599302 AGGCAGGGATTAGGTGGCACTGG + Intronic
1057422169 9:94921298-94921320 ATGCAGGGATGAGGAGGAGCCGG + Intronic
1057559283 9:96114684-96114706 ACGCAGGAATCAGGAGCAGCTGG + Exonic
1057669474 9:97076144-97076166 GGACAGGGTTTGGGGGCAGCTGG + Intergenic
1057722674 9:97545567-97545589 AGGCAGCGGGTAGGGCCAGCAGG + Intronic
1058592936 9:106584580-106584602 GTGCAGGGATGAGGGGCAGATGG + Intergenic
1058830763 9:108814273-108814295 GTGAAGGGATTAGGGGCAGAGGG + Intergenic
1059299131 9:113298609-113298631 AGTCAGGGATTTGAGGTAGCAGG - Exonic
1060393623 9:123300364-123300386 GGGTAGGGATTAGGGGCATGAGG - Intergenic
1061266027 9:129505572-129505594 AGGCAGTGAATGGGGGCCGCTGG - Intergenic
1061274595 9:129562129-129562151 AGGCAGGGGTGAGGGGCAGCTGG + Intergenic
1062186207 9:135219995-135220017 AGGCCTGGGTGAGGGGCAGCTGG - Intergenic
1185766955 X:2733112-2733134 AGGCAGGGAACAGGGAGAGCAGG - Intronic
1186743853 X:12545743-12545765 AGGCAGGGAGGAGGGGCAGATGG + Intronic
1187150839 X:16680028-16680050 AGGCAGGGAAGACTGGCAGCTGG + Intronic
1187695537 X:21915741-21915763 GTACAGGGATTTGGGGCAGCTGG + Intergenic
1190372560 X:49756816-49756838 AGGCAGGCATTGGAGCCAGCAGG + Intergenic
1191850401 X:65581891-65581913 AGAGAGGGATTGGGGACAGCAGG - Intergenic
1191850577 X:65582955-65582977 AGGCAGGCATTCTGGGCAGAAGG + Intergenic
1192601992 X:72474700-72474722 AGGCCTGGATTTGGGGCAGGAGG + Intronic
1192612376 X:72580068-72580090 AGGCAGGGATTAAGCGCATAAGG + Exonic
1193431683 X:81413945-81413967 AGGTTGGGATTGGGGGCAGAAGG + Intergenic
1194987676 X:100508211-100508233 AGGCAGGAATGAGGAGAAGCAGG + Intergenic
1195923401 X:110003357-110003379 AAGCAGGGGTCAGGGGAAGCCGG - Intronic
1196119293 X:112031294-112031316 AGGCAGGGACTGGAGGGAGCAGG - Intronic
1196345033 X:114645010-114645032 AGGAAGGGATTATGGGCAACTGG + Intronic
1196820217 X:119695090-119695112 TGGCAAGGAAGAGGGGCAGCTGG + Intergenic
1197872168 X:131070872-131070894 GGGCTGGTATTGGGGGCAGCTGG - Intronic
1198314662 X:135453444-135453466 AGGAAGGGAGTAAGGGAAGCAGG - Intergenic
1198733869 X:139764802-139764824 GGGGAGGGATTGGGGGAAGCTGG - Intronic
1199177753 X:144811431-144811453 AGGCAGGGAGTAGTTACAGCAGG + Intergenic
1199893076 X:152107537-152107559 AGACAGGGATTGGGGTCAACGGG + Intergenic
1201284685 Y:12369004-12369026 TGGCAGGCAGCAGGGGCAGCCGG + Intergenic