ID: 1077334730

View in Genome Browser
Species Human (GRCh38)
Location 11:1998199-1998221
Sequence AGTCCCCAGGGACCCGCAGC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1077334730_1077334736 -7 Left 1077334730 11:1998199-1998221 CCAGCTGCGGGTCCCTGGGGACT No data
Right 1077334736 11:1998215-1998237 GGGGACTCGGATGGCACAGAGGG No data
1077334730_1077334737 15 Left 1077334730 11:1998199-1998221 CCAGCTGCGGGTCCCTGGGGACT No data
Right 1077334737 11:1998237-1998259 GCCCCTTCCTGCCACCATCACGG No data
1077334730_1077334735 -8 Left 1077334730 11:1998199-1998221 CCAGCTGCGGGTCCCTGGGGACT No data
Right 1077334735 11:1998214-1998236 TGGGGACTCGGATGGCACAGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1077334730 Original CRISPR AGTCCCCAGGGACCCGCAGC TGG (reversed) Intergenic
No off target data available for this crispr